Bisphenol F degradation gene cluster bpf and its applications

By isolating and identifying the bisphenol F degradation gene cluster bpf in strain DN12, including the two-component oxidase BpfAB, monooxygenase BpfC and hydrolase BpfD, the problem of low degradation efficiency of bisphenol F in the prior art is solved and efficient biorepair effect is achieved.

CN119932057BActive Publication Date: 2025-07-08NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510412313.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-07-08
Estimated Expiration
2045-04-03

AI Technical Summary

Technical Problem

The lack of effective bisphenol F degradation genes and enzymes in the prior art limits the environmental behavior and ecological security research of bisphenol F, and it is difficult to efficiently remove bisphenol F pollution in the environment.

Method used

Strain DN12 was isolated and identified, and it was found that it contained the bisphenol F degradation gene cluster bpf, including the two-component oxidase BpfAB, monooxygenase BpfC and hydrolase BpfD, which could completely degrade 0.2 mM bisphenol F within 7 hours. The functions of these enzymes were confirmed by whole-genome and comparative transcriptome sequencing analysis, and recombinant vectors and recombinant microorganisms were constructed for heterologous expression.

Benefits of technology

Complete degradation of 0.2 mM bisphenol F within 7 hours was achieved, the optimal active conditions for each enzyme were determined, efficient biorepair methods were provided, and the ability to control bisphenol F contamination was enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119932057B_ABST
    Figure CN119932057B_ABST
Patent Text Reader

Abstract

The present invention discloses a bisphenol F degradation gene cluster bpf and its application. The strain DN12 was isolated in the present invention, which is capable of degrading BPF and growing with BPF as the sole carbon source and energy source. On this basis, a BPF degradation gene cluster was obtained from the strain DN12 by using whole-genome and comparative transcriptome sequencing analysis bpf . Three different degrading enzymes (two-component oxidase BpfAB, monooxygenase BpfC, hydrolase BpfD) were found in this gene cluster, which can catalyze the stepwise degradation of BPF to produce the simple aromatic ring compound p-hydroxybenzoic acid
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of environmental microbiology, and particularly to a bisphenol F degradation gene cluster bpf and its applications. Background Art

[0002] Bisphenol analogs are a class of endocrine disruptors and emerging pollutants in the aquatic environment. Studies have shown that exposure to bisphenol A (BPA) is associated with the incidence of health problems such as hypertension, obesity, type II diabetes, cardiovascular diseases, and cancer. With the strengthening of global regulation of BPA, the use of its substitute bisphenol F (BPF) has been on the rise. According to statistics, the annual global production of BPF reached hundreds of thousands of tons in 2018, mainly concentrated in developed countries and regions in North America, Europe, and Asia. As a key chemical industrial raw material, BPF has been widely used in the production of food can linings, coatings, adhesives, and electronic products. However, exposure to BPF can have negative effects on organisms, such as health risks for children and reproductive damage to aquatic organisms. Currently, BPF residues have been detected in environmental samples such as wastewater from industrial and municipal sewage treatment plants and landfill leachate. Bioremediation technology has become a green and sustainable method for treating such emerging pollutants, with advantages such as safety, high efficiency, and no secondary pollution. Bioremediation technology mainly uses microorganisms, plants, or enzymes to degrade or remove pollutants in the environment. In recent years, researchers have isolated an increasing number of BPF-degrading bacteria. For example Pseudomonas , Sphingobium and Bacillus etc., but there are no reports on the genes and enzymes related to BPF degradation, which seriously restricts the research on the environmental behavior and ecological safety of BPF. Therefore, it is necessary to deeply study the microbial degradation pathway and mechanism of BPF to enhance our understanding of the BPF biodegradation mechanism and provide guidance for the effective remediation of BPF-polluted environments.

[0003] Obtaining BPF-degrading strains and degradation genes has the following effects on the BPF accumulated in the environment during treatment: (1) for the elimination of BPF in soil and water; (2) constructing recombinant strains through modern bioengineering techniques and then studying the enzymatic properties, which is of great significance for the pollution remediation of BPF. In summary, conducting research on the degradation genes and enzymes during the BPF degradation process has very important theoretical and practical application values. Summary of the Invention

[0004] The object of the present invention is to provide a bisphenol F degradation gene cluster bpf and its applications to solve the deficiencies of the prior art.

[0005] The object of the present invention is achieved through the following technical solutions:

[0006] The first aspect of the present invention provides a bisphenol F degradation gene cluster bpf , whose nucleotide sequence is as shown in SEQ ID NO.9, and it can be applied to degrade bisphenol F.

[0007] The second aspect of the present invention provides a recombinant vector or recombinant microorganism of the above-mentioned bisphenol F degradation gene cluster bpf .

[0008] The third aspect of the present invention provides the application of the above-mentioned bisphenol F degradation gene cluster bpf in the degradation of bisphenol F.

[0009] The fourth aspect of the present invention provides a two-component oxidase gene bpfAB , which includes gene bpfA and gene bpfB , the nucleotide sequence of the said gene bpfA is as shown in SEQ ID NO.10, and the nucleotide sequence of the said gene bpfB is as shown in SEQ ID NO.12.

[0010] The fifth aspect of the present invention provides a two-component oxidase BpfAB encoded by the above-mentioned two-component oxidase gene bpfAB , including a protein BpfA encoded by gene bpfA and a protein BpfB encoded by gene bpfB , the amino acid sequence of the said protein BpfA is as shown in SEQ ID NO.11, and the amino acid sequence of the said protein BpfB is as shown in SEQ ID NO.13.

[0011] The sixth aspect of the present invention provides a recombinant vector or recombinant microorganism containing the above-mentioned two-component oxidase gene bpfAB .

[0012] The seventh aspect of the present invention provides a monooxygenase gene bpfC , whose nucleotide sequence is as shown in SEQ ID NO.14.

[0013] The eighth aspect of the present invention provides a monooxygenase BpfC encoded by the above-mentioned monooxygenase gene bpfC , whose amino acid sequence is as shown in SEQ ID NO.15.

[0014] The ninth aspect of the present invention provides a recombinant vector or recombinant microorganism containing the above-mentioned monooxygenase gene bpfC .

[0015] The tenth aspect of the present invention provides a hydrolase gene bpfD , whose nucleotide sequence is as shown in SEQ ID NO.16.

[0016] The eleventh aspect of the present invention provides the above-mentioned hydrolase gene bpfD encoded hydrolase BpfD, whose amino acid sequence is shown in SEQ ID NO.17.

[0017] The twelfth aspect of the present invention provides a recombinant vector or recombinant microorganism containing the above-mentioned hydrolase gene bpfD .

[0018] The thirteenth aspect of the present invention provides the application of any one or more of the following substances 1)-3) in the degradation of bisphenol F:

[0019] 1) The above-mentioned two-component oxidase gene bpfAB ;

[0020] 2) The above-mentioned monooxygenase gene bpfC ;

[0021] 3) The above-mentioned hydrolase gene bpfD .

[0022] The fourteenth aspect of the present invention provides the application of any one or more of the following substances 1)-3) in the degradation of bisphenol F:

[0023] 1) The above-mentioned two-component oxidase BpfAB;

[0024] 2) The above-mentioned monooxygenase BpfC;

[0025] 3) The above-mentioned hydrolase BpfD.

[0026] Advantages of the present invention:

[0027] 1. The present invention isolated strain DN12, which can degrade BPF and grow with BPF as the sole carbon source and energy source. On this basis, the present invention obtained a BPF degradation gene cluster from strain DN12 by whole-genome and comparative transcriptome sequencing analysis bpf . Three different degrading enzymes (two-component oxidase BpfAB, monooxygenase BpfC, hydrolase BpfD) were found in this gene cluster, which can catalyze the stepwise degradation of BPF to produce the simple aromatic ring compound p-hydroxybenzoic acid.

[0028] 2. The BPF degradation gene cluster provided by the present invention bpf can completely degrade 0.2 mM BPF within 7 h. In addition, the optimal activity temperature of the two-component oxidase BpfAB is 55 °C, and the optimal activity pH is 8; the optimal activity temperature of the monooxygenase BpfC is 40 °C, and the optimal activity pH is 8; the optimal activity temperature of the hydrolase BpfD is 40 °C, and the optimal activity pH is 9-9.5. Brief Description of the Drawings

[0029] Figure 1Identification diagram of strain DN12. A is the colony photo of strain DN12, B is the microscopic photo of the cells of strain DN12, and C is the phylogenetic tree constructed based on the 16S rRNA gene sequence of strain DN12.

[0030] Figure 2 Degradation and growth of strain DN12 on BPF.

[0031] Figure 3 Liquid chromatogram of BPF degradation by strain DN12 (A); BPF degradation pathway in strain DN12 (B).

[0032] Figure 4 For gene cluster bpf Diagram of heterologous expression strategy.

[0033] Figure 5 For strain B2(pBBR- bpf ) Liquid chromatogram of BPF degradation.

[0034] Figure 6 SDS-PAGE diagrams of oxidase BpfAB (Figure A), monooxygenase BpfC (Figure B), and hydrolase BpfD (Figure C). In A, lane M is the protein Marker; lane 1 is the crude enzyme solution of BpfAB; lane 2 is the permeate of the crude enzyme solution of BpfAB; lanes 3, 4, 5, 6, and 7 are the elution solutions with 10, 30, 50, 75, and 100 mM imidazole in sequence; in B, lane M is the protein Marker; lane 1 is the crude enzyme solution of BpfC; lanes 2, 3, 4, 5, and 6 are the elution solutions with 10, 30, 50, 75, and 100 mM imidazole in sequence; in C, lane M is the protein Marker; lane 1 is the crude enzyme solution of BpfD; lanes 2, 3, 4, 5, and 6 are the elution solutions with 10, 30, 50, 75, and 100 mM imidazole in sequence.

[0035] Figure 7 Effects of temperature and pH on the activity of two-component oxidase BpfAB.

[0036] Figure 8 Effects of temperature and pH on the activity of monooxygenase BpfC.

[0037] Figure 9 Effects of temperature and pH on the activity of hydrolase BpfD.

[0038] Biological material preservation information

[0039] Strain DN12, classified and named as Sphingobium yanoikuyae DN12, preserved in the China Center for Type Culture Collection, with the preservation address being Wuhan University, Wuhan, China, the preservation date being March 6, 2025, and the preservation number being CCTCC NO: M 2025387.

[0040] Strain B2, taxonomically named Sphingobium sp. B2, was deposited in the China Center for Type Culture Collection, with the deposit address being Wuhan University, Wuhan, China, the deposit date being October 16, 2018, and the deposit number being CCTCC NO: M2018684. Detailed implementation mode

[0041] The present invention will be further explained below in combination with embodiments and the accompanying drawings. The following embodiments are only used to illustrate the present invention, but do not limit the scope of implementation of the present invention.

[0042] The medium formulations involved in the following embodiments are as follows:

[0043] Inorganic salt liquid medium (hereinafter referred to as MSM), the formulation for a 1L system is: 1.0 g of NaCl, 1.0 g of NH4Cl, 1.5 g of K2HPO4, 0.5 g of KH2PO4, 0.2 g of MgSO4•7H2O, made up to 1 L with ultrapure water, sterilized at 121 °C for 20 min. The pH is 7.0.

[0044] LB liquid medium, the formulation for a 1L system is: 5.0 g of NaCl, 5.0 g of yeast powder, 10.0 g of tryptone, made up to 1 L with ultrapure water, sterilized at 121 °C for 20 min. The pH is 7.0. The LB medium is added 15 g agar powder.

[0045] Example 1 Degradation and growth experiment of strain DN12 on BPF

[0046] A strain of BPF-degrading bacterium was isolated and screened from river sediment through pressure acclimation of BPF, named DN12. Strain DN12 was cultured on LB medium at 30 °C for 2 - 3 days, and the colonies were yellow, round and smooth in shape ( Figure 1 A in), Gram-negative, with a rod-shaped cell morphology and dimensions of 0.5 - 0.7 μm × 1.7 - 2.0 μm ( Figure 1 B in). The phylogenetic tree constructed based on the 16S rRNA gene sequence ( Figure 1 C in) showed by comparative analysis that strain DN12 was Sphingobium yanoikuyae ATCC 51230 T and Sphingobium scionense WP01 T had the closest genetic relationship, with 16S rRNA gene homologies of 100% and 99.1% respectively. Combining the results of phylogenetic tree comparative analysis based on the 16S rRNA gene sequence and colony morphology, strain DN12 was identified as Sphingobium yanoikuyae。The strain DN12 has been deposited in the China Center for Type Culture Collection, with the deposit number CCTCC NO: M 2025387.

[0047] Pre-culture of the strain: Inoculate the strain DN12 into LB liquid medium and culture it at 30 °C and 180 rpm until the mid-logarithmic phase. Centrifuge at 6000 rpm for 8 min to collect the cells. Wash the cells twice with MSM and resuspend them in MSM to obtain the DN12 seed solution. Inoculate the DN12 seed solution with an initial inoculum OD 600 of approximately 0.1 into 20 mL of MSM supplemented with a final concentration of 0.2 mM BPF (the concentration of the BPF stock solution is 20 mM, using methanol as the solvent, and a total of 200 μL of the BPF stock solution is added) as the experimental group (DN12 + BPF group). Use 20 mL of MSM supplemented with a final concentration of 0.2 mM BPF (the concentration of the BPF stock solution is 20 mM, using methanol as the solvent, and a total of 200 μL of the BPF stock solution is added) as the negative control group (BPF group). Inoculate the DN12 seed solution with an initial inoculum OD 600 of approximately 0.1 into 20 mL of MSM supplemented with 200 μL of methanol as the positive control group. Incubate each group with shaking at 30 °C and 180 rpm. Collect 1 mL of samples at 0, 1, 2, 3, 4, 5, and 6 h, measure the cell growth by ultraviolet spectrophotometer, and perform quantitative analysis of BPF by HPLC. The specific operations are as follows:

[0048] Take 500 μL of the sample, add an equal volume of methanol, centrifuge at 12000 rpm for 5 min, filter the supernatant through a 0.22 μm filter membrane, and then perform HPLC analysis. Chromatographic conditions for HPLC detection of BPF concentration: The chromatographic column is Agilent ZORBAX SB C18 (specification: 250 mm × 4.6 mm × 5 μm); the mobile phase is methanol: 0.5 v / v% acetic acid water (v:v = 60:40); the flow rate is 1.0 mL·min -1 ; the detection wavelength is 230 nm; the column temperature is 35 °C; the injection volume is 20 μL. Take 500 μL of the sample and detect it with an ultraviolet spectrophotometer at a detection wavelength of 600 nm. The results are as Figure 2 shown. The strain DN12 can degrade 0.2 mM BPF within 6 h. At the same time, the biomass of the strain DN12 grows from approximately 0.1 to approximately 0.14, indicating that the strain DN12 can grow using BPF as the sole carbon source and energy source.

[0049] Example 2 Analysis of the BPF degradation pathway in strain DN12 and cloning and functional verification of the BPF degradation gene cluster

[0050] 2.1 Analysis of the BPF degradation pathway

[0051] After the strain DN12 was induced and cultured with the substrate BPF, the degradation efficiency of BPF increased significantly. Therefore, we searched for the target gene through whole-genome and comparative transcriptome sequencing analysis. The comparative transcriptome sequencing analysis showed that 73 transcripts in the strain DN12 were significantly up-regulated, accounting for about 1.3% of the total transcripts. Among them, the transcription levels of 48 transcripts in BPF-induced cells were increased by more than 4 times compared with those in non-induced cells. Among these 48 transcripts, we predicted a BPF degradation gene cluster bpf (which is located on the plasmid with the accession number CP173718 in the genome of the strain DN12), and its nucleotide sequence is as shown in SEQ ID NO.9, which contains a two-component oxidase gene bpfAB (two-component oxidase gene bpfAB includes gene bpfA and gene bpfB , the nucleotide sequence of gene bpfA is as shown in SEQ ID NO.10, and the amino acid sequence of the encoded protein BpfA is as shown in SEQID NO.11; the nucleotide sequence of gene bpfB is as shown in SEQ ID NO.12, and the amino acid sequence of the encoded protein BpfB is as shown in SEQ ID NO.13) 、 a monooxygenase gene bpfC (the nucleotide sequence of monooxygenase gene bpfC is as shown in SEQID NO.14, and the amino acid sequence of the encoded monooxygenase BpfC is as shown in SEQ ID NO.15) and a hydrolase gene bpfD (the nucleotide sequence of hydrolase gene bpfD is as shown in SEQ ID NO.16, and the amino acid sequence of the encoded hydrolase BpfD is as shown in SEQ ID NO.17).

[0052] The samples of the strain DN12 degrading BPF were analyzed by HPLC. First, the HPLC results showed that the strain DN12 produced three main metabolites when degrading BPF: M1, M2 and M3 ( Figure 3 A in). We purchased the standard products of possible metabolites through the reported BPF metabolic pathway. Through the chromatogram analysis of the three metabolites and the standard products, it was speculated that the metabolite M1 was 4,4’-dihydroxybenzophenone (DHBP), M2 was 4-hydroxyphenyl 4-hydroxybenzoate (HPHB), and M3 was 4-hydroxybenzoate (4HB) ( Figure 3In A). Combining with the predicted functions of degradation genes, a BPF biodegradation pathway was speculated. BPF was first oxidized to DHBP by the two-component oxidase BpfAB (the intermediate was bis(4-hydroxyphenyl)methanol), then underwent Baeyer-Villiger oxidation by the monooxygenase BpfC to generate HPHB, which was subsequently hydrolyzed by the hydrolase BpfD to 4HB and hydroquinone (1,4-hydroquinone, HQ), and finally entered the classical aromatic ring cleavage pathway ( Figure 3 In B).

[0053] 2.2 BPF degradation gene cluster bpf Heterologous expression

[0054] Using the primers pBBR1- bpf _F and pBBR1- bpf _R to amplify the BPF degradation gene cluster bpf fragment (the strategy is shown in Figure 4 ).

[0055] Forward primer pBBR1- bpf _F:

[0056] AACAAAAGCTGGGTACC GGGCCC GGAGAGGAGAACCCGTCATGGCACGGA (SEQ ID NO.1);

[0057] Reverse primer pBBR1- bpf _R:

[0058] TCACTATAGGGCGAATTG GAGCTC AGAACTTGGCGCCAACCT (SEQ ID NO.2); The underlined part represents the restriction site sequence.

[0059] Amplification program: Stage 1, pre-denaturation at 95°C (3 min); Stage 2, denaturation at 95°C (15 s), annealing at 57°C (15 s), extension at 72°C (5 min), 30 cycles; Stage 3, final extension at 72°C (5 min).

[0060] Digest the plasmid pBBR1MCS-2 with the restriction enzymes Apa I and Sac I at 30°C for 2 h, and then use the homologous recombination method to ligate the PCR-amplified gene fragment into the linearized pBBR1MCS-2 plasmid to obtain the recombinant plasmid pBBR- bpf . Transform these recombinant plasmids pBBR- bpf into E.coliIn DH5α cells, positive clones ( E. coli (pBBR- bpf )) were selected, and then the recombinant plasmid pBBR- E. coli HB101 (pRK2013) was transferred into bpf sp. B2 (accession number: CCTCC NO: M2018684) by triparental conjugation to obtain a heterologous expression strain, namely recombinant strain B2 (pBBR- Sphingobium ). The degradation efficiency of the heterologous expression strain on BPF was evaluated by HPLC. The recombinant strain B2 (pBBR- bpf ) was inoculated into LB liquid medium and cultured to the exponential phase. 2 mL of the bacterial solution was inoculated into 20 mL of MSM supplemented with a final concentration of 0.2 mM BPF. Samples were collected at 0 h and 7 h and detected by HPLC (the detection method was the same as in Example 1). The results were as bpf shown. The retention time of BPF was 4.8 min, and the recombinant strain B2 (pBBR- Figure 5 ) could completely degrade BPF at 7 h. The above results indicated that the BPF degradation gene was located in the putative BPF degradation gene cluster bpf . Combining the gene function annotations in this cluster and the results of the BPF metabolic pathway, it was speculated that the BPF degradation gene might be the two-component oxidase gene bpf , the monooxygenase gene bpfAB , and the hydrolase bpfC . bpfD .

[0061] Example 3 Purification and Activity Assay of BPF Degrading Enzyme

[0062] 3.1 Purification of Two-Component Oxidase BpfAB

[0063] 3.1.1 Construction of Recombinant Vectors and Recombinant Strains

[0064] Amplification primers for the gene fragment ligated with 6×His-Tag: bpfAB

[0065] Forward primer bpfAB _F:

[0066] AGAAGGAGATATA CATATG CACCACCACCACCACCACCCCCTATCTGTCGCCGAG (SEQ ID NO.3);

[0067] Reverse primer bpfAB _R:

[0068] GTGGTGGTGGTG CTCGAG ​TCATGGCTTGGGCTCCACAA (SEQ ID NO.4); the underlined part indicates the restriction site sequence.

[0069] Specifically amplify bpfAB gene fragments.

[0070] Amplification program: Stage 1, pre-denaturation at 95 °C (3 min); Stage 2, denaturation at 95 °C (15 s), annealing at 57 °C (15 s), extension at 72 °C (1 min), 30 cycles; Stage 3, final extension at 72 °C (5 min).

[0071] Digest the pET-29a(+) overexpression plasmid with restriction endonucleases Nde I and Xho I at 37 °C for 2 h, and then use the homologous recombination method to ligate the amplified gene fragments into the linearized plasmid pET-29a(+), obtaining the recombinant plasmid pET- bpfAB . Transform these recombinant plasmids into E.coli BL21(DE3) cells, and select positive clones for further experiments. The recombinant strains are named E.coli BL21(pET- bpfAB ).

[0072] 3.1.2 Expression and purification of BpfAB

[0073] Add the recombinant strain E.coli BL21(pET- bpfAB ) to LB liquid medium containing 50 mg / L kanamycin (Km) and culture at 37 °C and 180 rpm until the cell density reaches 0.6 - 0.8 (OD 600 ), then add IPTG with a final concentration of 0.5 mM and culture at 16 °C and 180 rpm for 12 h to induce protein expression. Then centrifuge at 12000 rpm for 8 min to collect the cells, wash the cells twice with 1×PBS (pH 7.2; diluted from 10×PBS, the same below), resuspend the cells with 15 mL of 1×PBS (pH7.2), ultrasonically disrupt at 550W for 10 min (disrupt for 1 s, pause for 2 s), centrifuge at 4 °C and 12000 rpm for 30 min, collect the supernatant, purify BpfAB using a nickel ion affinity chromatography column, and detect the purified enzyme by SDS-PAGE. The results show that the obtained band size is approximately 58 kDa, which is consistent with the theoretical value of BpfA (the gel pattern is a fragment of BpfA, BpfB is a cytochrome C and serves as an electron acceptor with a smaller fragment and an unclear gel pattern), and can be used for further experiments ( Figure 6 A).

[0074] 3.1.3 Determination of BpfAB Activity

[0075] To determine the optimal reaction temperature of BpfAB, its catalytic efficiency was evaluated in the temperature range of 10 - 70 °C. The enzyme activity reaction system of BpfAB (500 μL): in 500 μL of 1×PBS (pH 7.2) containing 0.1 mM flavin adenine dinucleotide (FAD), 0.2 mM methyl viologen (PMS), 0.137 μM BpfAB, and 0.2 mM BPF; reacting at 10 °C, 20 °C, 30 °C, 40 °C, 45 °C, 50 °C, 55 °C, 60 °C, 65 °C, 70 °C for 10 min respectively, and measuring the activity of BpfAB. After the reaction, the enzyme reaction solution was boiled for 3 min, an equal volume of methanol was added, centrifuged at 12000 rpm for 5 min, the supernatant was filtered through a 0.22 μm filter membrane, and the degradation of BPF was detected by HPLC. The results showed that the optimal reaction temperature for BpfAB to catalyze the degradation of BPF was 55 °C ( Figure 7 left).

[0076] At the optimal reaction temperature of BpfAB, the optimal pH value was determined using buffers with a pH range of 3.5 - 10.5: 50 mM sodium acetate (pH 3.5 - 6.0), 50 mM PBS (pH 5.5 - 8.0), 50 mM Tris-HCl (pH 7.5 - 9.0), and 50 mM glycine-NaOH (pH 8.5 - 10.5). The enzyme activity reaction system (500 μL): in 500 μL of the corresponding pH buffer (pH 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5 respectively) containing 0.1 mM FAD, 0.2 mM PMS, 0.137 μM BpfAB, and 0.2 mM BPF; reacting at 55 °C for 10 min, and measuring the activity of BpfAB. After the reaction, the enzyme reaction solution was boiled for 3 min, an equal volume of methanol was added, centrifuged at 12000 rpm for 5 min, the supernatant was filtered through a 0.22 μm filter membrane, and the degradation of BPF was detected by HPLC. The results showed that the optimal reaction pH for BpfAB to catalyze the degradation of BPF was 8 ( Figure 7 right).

[0077] 3.2 Purification of the Monooxygenase BpfC

[0078] 3.2.1 Construction of Recombinant Vectors and Recombinant Strains

[0079] The amplification primers for the bpfC gene fragment ligated with 6×His-Tag:

[0080] Forward primer bpfC_F:

[0081] TAAGAAGGAGATATA CATATG AGCGGCAACGACCGTG (SEQ ID NO.5);

[0082] Reverse primer bpfC_R:

[0083] TCAGTGGTGGTGGTGGTGGTG CTCGAG CTGCACGCTCTCCGCAAA (SEQ ID NO.6); The underlined part indicates the restriction site sequence.

[0084] Specific amplification of the gene fragment was performed using two primers. bpfC The amplification procedure was the same as in 3.1.1.

[0085] The specifically amplified bpfC gene fragment was used to construct recombinant vectors and recombinant strains according to 3.1.1, and E. coli BL21(pET- bpfC ) was obtained.

[0086] 3.2.2 Expression and purification of BpfC

[0087] The expression and purification of BpfC were the same as in 3.1.2. SDS-PAGE analysis showed that the obtained band size was approximately 46 kDa, which was consistent with the theoretical size of BpfC and could be used for further experiments ( Figure 6 B in

[0088] 3.2.3 Activity determination of BpfC

[0089] To determine the optimal reaction temperature of BpfC, its catalytic efficiency was evaluated in the temperature range of 10 - 70 °C. The enzyme activity reaction system of BpfC (500 μL): in 500 μL of 1×PBS (pH 7.2) containing 0.02 mM FAD, 0.4 mM nicotinamide adenine dinucleotide phosphate (NADPH), 0.218 μM BpfC, and 0.2 mM DHBP; reactions were carried out at 10 °C, 20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, 50 °C, 60 °C, and 70 °C for 15 min to determine the activity of BpfC. After the reaction, the enzyme reaction solution was boiled for 3 min, an equal volume of methanol was added, centrifuged at 12,000 rpm for 5 min, and the supernatant was filtered through a 0.22 μm filter membrane. The degradation of DHBP was detected by HPLC. The results showed that the optimal reaction temperature for BpfC to catalyze the degradation of DHBP was 40 °C ( Figure 8 left).

[0090] At the optimal reaction temperature of BpfC, its optimal pH value was determined using the corresponding buffer in 3.1.3. Enzyme activity reaction system (500 μL): in 500 μL of the corresponding pH buffer (pH 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9) containing 0.02 mM FAD, 0.4 mM NADPH, 0.022 μM BpfC, and 0.1 mM DHBP; react at 40 °C for 90 min to measure the activity of BpfC. After the reaction, boil the enzyme reaction solution for 3 min, add an equal volume of methanol, centrifuge at 12,000 rpm for 5 min, filter the supernatant through a 0.22 μm filter membrane, and detect the degradation of BPF by HPLC. The results showed that the optimal reaction pH for BpfC to catalyze the degradation of BPF was 8 ( Figure 8 right).

[0091] 3.3 Purification of hydrolase BpfD

[0092] 3.3.1 Construction of recombinant vector and recombinant strain

[0093] Amplification primers for the gene fragment ligated with 6×His-Tag: bpfD

[0094] Forward primer bpfD _F:

[0095] TAAGAAGGAGATATA CATATG ACCGAACGGTTCGTGCCTGAATGGA (SEQ ID NO.7);

[0096] Reverse primer bpfD _R:

[0097] TCAGTGGTGGTGGTGGTGGTG CTCGAG TCGAGATACCTCTTTCTG (SEQ ID NO.8); The underlined part indicates the restriction site sequence.

[0098] Specifically amplify the gene fragment with the two primers. bpfD The amplification procedure is the same as 3.1.1.

[0099] Construct the recombinant vector and recombinant strain with the specifically amplified gene fragment according to 3.1.1 to obtain bpfD BL21(pET- E. coli ) bpfD .

[0100] 3.3.2 Expression and purification of BpfD

[0101] ​The expression and purification of BpfD were the same as those in 3.1.2. SDS-PAGE analysis showed that the obtained band size was approximately 33 kDa, which was consistent with the theoretical value of BpfD and could be used for further experiments ( Figure 6 in C).

[0102] 3.3.3 Determination of BpfD Activity

[0103] To determine the optimal reaction temperature of BpfD, its catalytic efficiency was evaluated in the temperature range of 10 - 70 °C. The enzyme activity reaction system of BpfD (500 μL): in 500 μL of 1×PBS (pH 7.2) containing 0.021 μM BpfD and 0.2 mM HPHB; react at 10 °C, 20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, 50 °C, 60 °C, 70 °C for 5 min respectively, and determine the activity of BpfD. After the reaction, the enzyme reaction solution was boiled for 3 min, an equal volume of methanol was added, centrifuged at 12,000 rpm for 5 min, the supernatant was filtered through a 0.22 μm filter membrane, and the degradation of HPHB was detected by HPLC. The results showed that the optimal reaction temperature for BpfD to catalyze the degradation of HPHB was 40 °C ( Figure 9 left).

[0104] The corresponding buffer in 3.1.3 was used to determine its optimal pH value. The enzyme activity reaction system (500 μL): in 500 μL of the corresponding pH buffer (pH 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5 respectively) containing 0.021 μM BpfD and 0.2 mM HPHB; react at 30 °C for 5 min, and determine the activity of BpfD. After the reaction, the enzyme reaction solution was boiled for 3 min, an equal volume of methanol was added, centrifuged at 12,000 rpm for 5 min, the supernatant was filtered through a 0.22 μm filter membrane, and the degradation of BPF was detected by HPLC. The results showed that the optimal reaction pH for BpfD to catalyze the degradation of HPHB was 9 - 9.5 ( Figure 9 right).

Claims

1. Application of two-component oxidase gene bpfAB in the degradation of bisphenol F, wherein the two-component oxidase gene bpfAB comprises gene bpfA and gene bpfB , and the nucleotide sequence of the gene bpfA is shown in SEQ ID NO.10, and the nucleotide sequence of the gene bpfB is shown in SEQ ID NO.

12.

2. Application of the two-component oxidase BpfAB in the degradation of bisphenol F, wherein the two-component oxidase BpfAB is encoded by the two-component oxidase gene bpfAB and the two-component oxidase gene bpfAB comprises gene bpfA and gene bpfB . The nucleotide sequence of the gene bpfA is shown as SEQ ID NO.10, and the nucleotide sequence of the gene bpfB is shown as SEQ ID NO.

12. The two-component oxidase BpfAB comprises the protein BpfA encoded by the gene bpfA and the protein BpfB encoded by the gene bpfB . The amino acid sequence of the protein BpfA is shown as SEQ ID NO.11, and the amino acid sequence of the protein BpfB is shown as SEQ ID NO.13.