BKT gene for producing astaxanthin in cotton and application

Abstract

The invention discloses a BKT gene for producing astaxanthin in cotton and application of the BKT gene, and belongs to the technical field of plant genetic engineering. In cotton, an enhanced constitutive 2 * 35S promoter is used for driving a tobacco Rubisco signal peptide to guide the expression of a BKT gene in cotton chloroplast, and an astaxanthin biosynthetic pathway is successfully established, so that astaxanthin is generated in various tissues such as leaves, stems, anther, sepals and cotton seeds in cotton; detection on the cotton seeds corresponding to the transgenic cotton shows that the weight and the size of the transgenic cotton seeds are obviously increased, but the gossypol content is reduced. Therefore, the transgenic cotton material which is rich in astaxanthin on the whole, larger and heavier in cotton seeds, lower in gossypol content, more nutritional and lower in toxicity can be created through the method, and the cotton can be used as a biological factory for producing the astaxanthin. A stable, low-cost and effective alternative scheme is provided for a traditional astaxanthin source.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering and specifically relates to a BKT Genes and their applications in synthesizing astaxanthin in cotton, reducing cottonpol content, and increasing cottonseed weight and size. Background Art

[0002] Cotton is the world's most important natural textile fiber source plant, an important industrial raw material and military resource. The planting area is wide. There are about 80 subtropical and tropical countries in the world that grow cotton, of which 59 countries have a planting area of ​​at least 5,000 hectares (Wakelyn and P., 2009). In China, the total output, consumption and textile exports of the cotton industry are among the highest in the world, and it has an important economic position. In addition to the well-known main product cotton fiber, its by-product cotton seeds also have great resource value. In cotton, for every 1 kg of cotton fiber produced, 1.6 kg of cotton seeds can be obtained (Janga et al., 2019). Cotton seeds include 21% edible oil and 23% edible protein. They are rich in various vitamins, trace elements, etc. They are an efficient storage system for natural lipids and have high utilization value (Sarrion-Perdigones et al., 2011; Gao et al., 2022). Although cottonseed has multiple nutritional values ​​and application potential, anti-nutritional factors such as cottonphenol and its derivatives contained in cottonseed pigment glands can have a negative impact on the health of humans and monogastric animals (Gaoetal., 2020). Therefore, the development of a cottonseed material with low toxicity, high nutrition and high antioxidant capacity is the future trend of cottonseed transformation.

[0003] Astaxanthin is a sesquiterpene substance. Its special chemical structure makes astaxanthin show extremely high antioxidant activity, even more potent than vitamin E and coenzyme Q10. This makes it have pharmacological effects on diseases such as cancer, cardiovascular disease, diabetes, and inflammation. The increasing amount of astaxanthin supplementation in the fields of health products, food, and cosmetics has led to a huge increase in the market demand for natural astaxanthin (Ambati et al., 2014). At present, chemical synthesis and extraction from Haematococcus pluvialis are the main methods for producing astaxanthin. Although the chemical synthesis method has low cost and high yield, its product is mainly cis-isomer, and its bioavailability and antioxidant activity are much lower than those of trans-astaxanthin from natural sources, with only 10% antioxidant capacity. In contrast, natural astaxanthin extracted from Haematococcus pluvialis has higher biological activity and market value, but its production cost is high and is limited by culture conditions (such as light, temperature, nutrition, etc.) (Mussagyet al., 2023). In order to overcome these limitations, the rapid development of synthetic biology and metabolic engineering technologies in recent years has opened up new avenues for the production of astaxanthin. By analyzing the biosynthetic pathway of astaxanthin (including key enzymes such as β-carotene hydroxylase and ketolase), researchers have successively created successful cases of synthesizing astaxanthin in common crops using plant metabolic engineering, including tobacco (Hasunuma et al., 2008), Arabidopsis (Stålberg et al., 2003; Zhong et al., 2011), carrot (Ahn et al., 2012), tomato (Huang et al., 2013), apple (Jia et al., 2019), soybean (Emily et al., 2015), corn (Liu et al., 2021) and rice (Zhu et al., 2018). These plants are regarded as potential dietary sources of astaxanthin, providing new possibilities for the development of functional foods and improving human nutrition and health. Since higher plants (including cotton) generally do not produce astaxanthin, the purpose of the present invention is to rely on the genetic engineering manipulation of the astaxanthin biosynthesis pathway in the widely planted upland cotton, so as to obtain a transgenic cotton material in which the whole plant is rich in astaxanthin and the cotton seeds are larger, more nutritious and less toxic. Summary of the invention

[0004] One of the objects of the present invention is to provide a method for producing astaxanthin in cotton. BKT Gene.

[0005] The second object of the present invention is to provide BKT Application of genes in cotton breeding, the BKT The gene can induce cotton to synthesize astaxanthin, reduce the gossypol content of cotton seeds, and increase the weight and size of cotton seeds.

[0006] The third object of the present invention is to provide a cotton breeding method to create transgenic cotton materials with rich astaxanthin in the whole plant, larger and heavier cotton seeds, lower gossypol content, more nutrition and lower toxicity.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows: BKT The gene is a cotton codon-optimized gene from Chlamydomonas reinhardtii. CrBKT Gene (GenBank: MG976837, β-carotene ketolase), BKT The CDS sequence of the gene is shown in SEQ ID NO.1.

[0008] The present invention firstly targets cotton codon pairs from Chlamydomonas reinhardtii CrBKT The gene was optimized and the optimized gene was named BKT Genes, then BKT Gene sequence, driven by the enhanced constitutive 2×35S promoter to drive the tobacco Rubisco signal peptide gene BKT The recombinant vector for gene expression is used to transform cotton materials to obtain cotton plants rich in astaxanthin, with larger and heavier cotton seeds and reduced cottonphenol content. The Rubisco signal peptide is derived from tobacco, and its CDS sequence is shown in SEQ ID NO.2.

[0009] Secondly, the present invention discloses a method for constructing a cotton transgenic material: optimizing the cotton codon from Chlamydomonas reinhardtii CrBKT Genes, and BKT The tobacco Rubisco signal peptide gene was fused to the gene by homologous recombination, and the gene was targeted to the chloroplast. The tobacco Rubisco signal peptide gene and BKT The gene is connected to the Cotton2.0 vector through homologous recombination to form an OE-BKT vector, which is then transferred into cotton materials through cotton genetic transformation to obtain transgenic cotton materials with rich astaxanthin as the whole plant, lower gossypol content, larger cotton seeds, more nutrition and less toxicity.

[0010] In addition, it contains BKT The recombinant vector of the gene and the tobacco Rubisco signal peptide gene and the application of the recombinant vector in synthesizing astaxanthin in cotton, increasing the weight and size of cotton seeds, and reducing the content of cottonphenol also fall within the protection scope of the present invention.

[0011] The recombinant vector is driven by an enhanced constitutive 2×35S promoter. The cotton is upland cotton, and the upland cotton material is L328.

[0012] The present invention also discloses a cotton breeding method, which comprises the following steps: (1) BKT The gene was constructed into the pUC57 vector to obtain the target gene fragment. pUC57-BKT Plasmids; (2) pUC57-BKT Plasmid and tobacco cDNA were used as templates for PCR amplification BKT gene and tobacco Rubisco signal peptide gene and recover the target gene fragment; (3) Enzyme digestion of the Cotton2.0 vector to obtain a linear vector; (4) Recombining the target gene fragment and the linear vector cut by enzymes to construct a recombinant vector; (5) Transform the recombinant vector into Escherichia coli and select positive clones; (6) Cultivate the positive clones and extract the plasmid; (7) transforming the extracted plasmid into cotton material under the mediation of Agrobacterium; (8) The transformed cotton material obtained in step (7) is subjected to corresponding resistance screening conditions to generate regenerated seedlings; the regenerated seedlings are hardened and then transplanted or grafted to obtain transgenic cotton materials enriched with high astaxanthin content, with reduced cottonphenol content and increased cottonseed weight and size.

[0013] Advantages of the present invention: The present invention uses an enhanced constitutive 2×35S promoter to drive the tobacco Rubisco signal peptide in cotton BKT The gene is expressed in chloroplasts, and the astaxanthin biosynthesis pathway is successfully established, so that astaxanthin is produced in various tissues of cotton, such as leaves, stems, anthers, sepals and cotton seeds. The astaxanthin content in transgenic leaves can reach up to 126.1657 μg / gDW, accounting for 20.43% of the total carotenoids. In the detection of cotton seeds corresponding to transgenic cotton, it was found that the size of transgenic cotton seeds was significantly larger than that of cotton seeds with empty vector control (EV). 0.1737 μg / g DW of astaxanthin accumulation was detected in transgenic cotton seeds, and the gossypol content of transgenic cotton seeds decreased. A transgenic cotton material with rich astaxanthin as a whole plant and larger and heavier cotton seeds, more nutrition and less toxicity has been created.

[0014] The present invention provides a cost-effective and scalable alternative to astaxanthin biosynthesis based on cotton production. Astaxanthin is fat-soluble like cottonphenol, and in cottonseed, the conversion of cottonphenol to astaxanthin not only reduces toxicity, but also enhances the functionality and nutritional value of cottonseed, making it more suitable for human consumption and livestock feed. This invention will not only directly alleviate the current problem of insufficient astaxanthin production, but will also significantly improve the economic and nutritional value of cotton. Cotton can be used as a biofactory for astaxanthin production, providing a stable, low-cost and effective alternative to traditional astaxanthin sources. In addition, the dual benefits of enhanced nutrition and reduced toxicity can greatly expand the potential application of cottonseed in the human food, animal feed and functional ingredient markets. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Map of the vector construction for enhancing the constitutive 2×35S promoter to drive the tobacco Rubisco signal peptide gene and BKT gene.

[0016] Figure 2 The phenotypes of transgenic materials at callus and embryonic callus stages are shown in Figure 1. Scale bar = 1 mm.

[0017] Figure 3 For the detection of transcription level of transgenic materials, n=3, ** p <0.01.

[0018] Figure 4 This is the phenotype of the vegetative organs of field plants of transgenic material.

[0019] Figure 5 This is the reproductive organ phenotype of field plants of transgenic materials. Flower scale bar = 1 cm, sepal and stamen scale bar = 2 mm, anther scale bar = 250 μm, fiber scale bar = 1 cm.

[0020] Figure 6 To detect the phenotype and gossypol content of cotton seeds of transgenic materials, n≥3. DETAILED DESCRIPTION

[0021] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0022] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0023] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0024] Phanta Max super-fidelity DNA polymerase, Taq plus DNA polymerase, and DNA Maker used in the present invention were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; anhydrous ethanol, n-hexane, acetone, dichloromethane, chromatographic grade methanol, etc. were purchased from Fuyu Fine Chemical Co., Ltd.; rifampicin, kanamycin, and cephalosporin were purchased from Beijing Solaibao Biotechnology Co., Ltd.; 2,6-di-tert-butyl-p-cresol (BHT) chromatographic grade was purchased from Aladdin Biochemical Technology Co., Ltd.; RNAprepPure polysaccharide and polyphenol plant total RNA extraction kit was purchased from German Tiangen Biochemical Technology Co., Ltd.; reverse transcription kit (Hifair® Ⅲ 1st Strand cDNA Synthesis SuperMix forqPCR) was purchased from Shanghai Yisheng Biotechnology Co., Ltd.; qRT-PCR kit (2× Universal SYBR Green Fast qPCRMix) was purchased from Wuhan Aibotek Biotechnology Co., Ltd.; plasmid rapid small extraction kit was purchased from German Tiangen Biochemical Technology Co., Ltd.; homologous recombination enzyme ClonExpressMultiS One Step Cloning Kit was purchased from Beijing Novogene Biotechnology Co., Ltd.; SpeI enzyme and EcoRI enzyme were purchased from New England Biotechnology (Beijing) Co., Ltd. Plant transformation and tissue culture related culture media were purchased from Beijing Coolbo Technology Co., Ltd.; the primers used and sequencing work were completed in Shanghai Shenggong Biotechnology Co., Ltd.

[0025] Embodiment 1: Cotton-BKT Vector construction 1. According to the codon preference of upland cotton, the codon optimization software was used to optimize CrBKT The CDS sequence of the optimized gene is shown in SEQ ID NO.1. BKT Gene, the optimized BKT The gene was constructed into the pUC57 universal vector to obtain the pUC57-BKT plasmid containing the target gene fragment.

[0026] 2. Target fragment amplification: Using tobacco cDNA as a template, design primers Rubisco-F and Rubisco-R according to the sequence of the tobacco Rubisco signal peptide gene. Primer Rubisco-F is added with the homologous fragment linker of the vector, and the tobacco Rubisco signal peptide gene is amplified with Phanta enzyme. Using pUC5-BKT plasmid as a template, design primers BKT-F and BKT-R. BKT-F primer is added with the tobacco Rubisco signal peptide gene linker, and BKT-R primer is added with the homologous fragment linker of the vector, and the Phanta enzyme is used to amplify BKT Gene.

[0027] PCR amplification system: 2×Phanta Max Buffer 25 μL; dNTPMix (10 mM) 1 μL; primer F / R (10 μm) 1 μL; template plasmid (pUC57-BKT) 1 μL (150 ng / μL); Phanta Max Super-Fidelity DNA Polymerase 1 μL; dd H2O made up to 50 μL.

[0028] Rubisco-F: CCTGCAGGCGGCCGCACTAGTATGGCTTCCTCAGTTCTTTCCTC; Rubisco-R: CAAGAAAGCTGGGTTCTAGAATACCTAATGGCCCGGGCTAGCATG; BKT-F: TCTCATACCTTCCTGATTTGAGCACTAGTATGGGACCTGGTATTCAGCCTAC; BKT-R: GTAGGCTGAATACCAGGTCCCATACTAGTGCTCAAATCAGGAAGGTATGAGA.

[0029] The PCR reaction program was as follows: 95°C for 3 min; 95°C for 15 s; 58°C for 15 s; 72°C for 30 s / kb; 38 cycles; 72°C for 5 min; and storage at 4°C.

[0030] The PCR amplification product was subjected to 1.5% agarose gel electrophoresis (120 V, 15 min). The length of the tobacco Rubisco signal peptide gene sequence was 237 bp. BKT The gene sequence length is 984 bp. The target gene was purified using a PCR purification kit to obtain the target fragment product with a linker sequence and stored in a -20°C refrigerator.

[0031] 3. Enzyme digestion: Select appropriate enzyme digestion sites for the multiple cloning site of Cotton2.0 vector, which has an enhanced constitutive 2×35S promoter and a spectinomycin resistance gene. Use a 50 μL enzyme digestion system and double-digest the vector with restriction endonucleases SpeI and EcoRI from NEB. The enzyme digestion system is: 2 μg of Cotton2.0 vector; 1 μL of restriction endonuclease SpeI; 1 μL of restriction endonuclease EcoRI; 5 μL of CutSmart Buffer; 50 μL of dd H2O. The enzyme digestion system is placed in a 37°C constant temperature metal bath for 3 h. After the enzyme digestion is completed, the enzyme digestion product is subjected to 1.5% agarose gel electrophoresis (120 V, 15 min), and the plasmid before enzyme digestion is used as a control. After confirming that the band of the appropriate size is cut, the successfully cut linear vector is gel-recovered and purified.

[0032] 4. Homologous recombination: Use ClonExpress MultiS One Step Cloning Kit to clone the purified tobacco Rubisco signal peptide gene and BKT The two target fragments of the gene were recombined and connected with the Cotton2.0 linear vector after double digestion with SpeI and EcoRI. The reaction system was 10 μL, and the specific system was: 2 μL of 5×CE MultiS Buffer; 1 μL of homologous recombinase Exnase MultiS; 1 μL of linear vector digested with enzymes (50 ng / μL); 1 μL of each of the two target fragments with connectors (30 ng / μL); dd H2O was added to make up to 10 μL. After the system was prepared, it was heated in a 37℃ metal bath for 30 minutes and placed on ice for 5 minutes to terminate the reaction. The recombinant vector was named Cotton2.0-BKT, and the vector map is shown in the figure. Figure 1 shown.

[0033] 5. Transformation of E. coli: Add the recombinant vector Cotton2.0-BKT to 30 μL DH5 α In the competent state, place it on ice for 30 minutes; then transform the vector into the competent state by heat shock at 42°C, add 400 μL LB liquid non-resistant culture medium, activate it on a shaker at 37°C for 1 hour, then spread it on Spe-resistant LB solid culture medium, culture it upside down in a 37°C incubator, and select single clones for positive detection after 12-16 hours.

[0034] 6. Agrobacterium transformation: After the positive monoclonal bacteria detected correctly are expanded, the plasmid is extracted and transformed into the competent state of Agrobacterium LBA4404 by electroporation. 400 μL of LB liquid non-resistant medium is added, and after activation on a 28°C shaker for 1 hour, 50 μL of bacterial solution is drawn and coated on Spe+Rif resistant LB solid medium, and inverted culture is placed in a 28°C incubator. After 24 hours, a single clone is selected for positive detection. After the bacterial solution detected correctly by PCR is expanded, sterilized glycerol is added to a concentration of 20%, and the bacterial solution is stored at -80 for subsequent experiments.

[0035] Example 2: Cotton Genetic Transformation The cotton genetic transformation method was carried out according to the method described by Jin Shuangxia et al. (Jin Shuangxia, 2006).

[0036] 1. Planting of sterile cotton seedlings: prepare shelled seeds, 0.1% mercuric chloride (HgCl2), sterile water, sterile conical flask, and waste liquid bottle; sterilize tweezers by burning them with an alcohol lamp in a clean bench, put shelled seeds into a sterile conical flask, and sterilize them with 0.1% mercuric chloride for 7 minutes; pour the mercuric chloride back into the bottle, and wash the seeds with sterile water 4-5 times, each time for 2-3 minutes; use sterile tweezers to evenly place the washed seeds on the sterile seedling culture medium, and culture them at 28°C in the dark; after 24 hours of culture, when the radicle grows to about 1 cm, use sterile tweezers to gently insert the radicle into the sterile seedling culture medium at 28°C in the dark for 5-7 days. Then use it for cotton genetic transformation.

[0037] 2. Genetic transformation of cotton: LBA4404 Agrobacterium carrying the Cotton2.0-BKT vector was propagated, 8 mL of the inoculated culture was cultured in a shaking incubator at 28°C for 16-18 h, and then centrifuged at low speed at 4000 rpm for 10 min, and then resuspended with sterilized MGL to reach an appropriate concentration; the cultured sterile seedlings were cut off from the radicle and cotyledons, and the remaining hypocotyls were cut into small sections; the hypocotyls were infected with the resuspended Agrobacterium for 8 min, and the water was absorbed by filter paper; the sterilized filter paper was moistened on the co-culture medium and placed on the culture medium (filter paper can inhibit bacterial growth and also help infection); the hypocotyls were placed in the culture medium, sealed, and cultured at 21°C in the dark for 3 days, and then explants were cultured and selected on a culture medium containing 50 µg / mL Kana to grow transgenic positive callus tissue; the callus tissue was then transferred to the induction medium to induce embryonic callus tissue and produce positive transgenic plants. Transgenic callus and embryonic callus phenotypes are as follows Figure 2 As shown, transgenic calli and embryonic calli showed obvious red pigmentation compared with calli and embryonic calli of empty vector control (EV).

[0038] Example 3: Identification of positive lines of transgenic material 1. Cotton tissue RNA extraction: Cotton tissue RNA extraction uses RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit from German Tiangen Biochemical Technology Co., Ltd., and the extraction steps are carried out according to the instructions. After RNA extraction, 200 ng of each sample is drawn for 1.5% agarose gel electrophoresis (120 V, 15 min) to ensure the quality of the extracted RNA.

[0039] 2. Reverse transcription of total RNA into cDNA: Using a reverse transcription kit (Hifair® Ⅲ 1st Strand cDNA Synthesis SuperMix for qPCR), all RNA samples were reverse transcribed into a total amount of 1 μg according to the instructions, and then the reverse transcribed cotton cDNA was diluted 50 times as a template for qRT-PCR amplification.

[0040] 3. qRT-PCR amplification: qRT-PCR amplification was performed using the Roche Light Cycler 96 real-time fluorescence quantitative PCR instrument and 2× UniversalSYBR Green Fast qPCR Mix quantitative reagent. The template required for amplification was the cDNA reaction product synthesized in the previous step. △ The Ct method was used to calculate the gene transcription level, and the cotton ubiquitin gene UB7 The gene expression levels were analyzed by data homogenization. Figure 3 As shown, a series of overexpressed target genes were detected BKT transgenic positive seedlings.

[0041] UB7-RT-F:CGGGGTACCGATGATAGAGCGA UB7-RT-R:GGGAAGGCTTTGCTTGACGTGC BKT-RT-F: ATGGGACCTGGTATTCAGCCTA BKT-RT-R: CGAACCACAAACCATACACGAAA.

[0042] Example 4: Field trial The transgenic plants and wild-type plants were phenotypically analyzed under field conditions ( Figure 4 , Figure 5 ).Depend on Figure 4It can be seen that compared with empty vector control (EV) plants, OE-BKT transgenic cotton plants stably exhibited red pigmentation associated with astaxanthin accumulation at multiple developmental stages. In vegetative organs, all green tissues, including leaves, petioles, stipules, and stems of cotton, showed significant red pigmentation, which was particularly obvious in young tissues and became less obvious in mature chlorophyll-rich tissues, which may be due to the presence of chlorophyll masking the color of red pigmentation. Figure 5 It can be seen that in the reproductive organs, significant red pigmentation was also observed in the bracts, calyx and stamens; in contrast, the color change of the petals was relatively weak; in addition, so far, no red pigmentation has been observed in mature cotton fibers.

[0043] Example 5: Identification of genetically modified cotton seeds In order to collect relevant data of the harvested transgenic cotton seeds, the length and width of 10 cotton seeds of the empty vector control (EV) and the four OE-BKT transgenic lines were measured using a vernier caliper; in addition, the weight of 20 seeds of each material was weighed, and the collected statistical data was converted into a bar graph format using software, such as Figure 6 As shown in the figure, the weight and size of OE-BKT seeds were significantly larger than those of the control. After the cotton hulls of representative transgenic cotton seeds were removed, OE-BKT showed uneven light red pigmentation in the cotyledons, while EV seeds maintained the creamy phenotype and the color of their seed glands changed from dark brown to red.

[0044] Example 6: Cottonseed Cottonphenol Detection Determination of cottonpol content in cottonseed The extraction and quantification process of cottonpol was carried out according to the method described by Zhang et al. (Zhang et al., 2024).

[0045] Grind the tissues such as seeds that need to be tested for cotton phenol with liquid nitrogen, quickly weigh 0.05 g of the fully ground powder, add 0.5 mL of cotton phenol extract (Table 1), and place on ice for 15 minutes. Heat in a 27°C water bath until the liquid is uniform, then sonicate for 15 minutes in the dark. Centrifuge at 12,000 rpm for 15 minutes, avoid the precipitate and aspirate the supernatant, and try to avoid light throughout the process. Then filter with a 0.22 μm filter membrane, aspirate 150 μL and place it in a brown liquid injection bottle with an inner insert.

[0046] Table 1 Cottonsephenol extract solution preparation

[0048] Prepare the gradient concentration standard of cotton phenol, draw 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 mL of 1,000 mg / L cotton phenol standard stock solution, dilute with chromatography grade acetonitrile to the standard solution with mass concentration of 20, 30, 40, 50, 60, 70 mg / L, filter with 0.22 μm filter membrane, and draw 150 μL of each concentration into the corresponding brown liquid injection bottle with inner insert. The HPLC detection conditions are as follows: mobile phase A: methanol and mobile phase B: 0.1% (volume fraction) phosphoric acid mixture. The volume ratio of phase A to phase B is 85:15. Flow rate 1.0 mL / min, isocratic elution; column temperature 40 °C; injection volume 10 μL. The detection wavelength is at 235 nm. The cotton phenol detection results are also as shown. Figure 6 As shown, the gossypol content in BKT (X1) transgenic cotton seeds was reduced by 19.9%-37.2% compared with the empty vector control EV.

[0049] Example 7: Detection of carotenoid composition and content in cotton tissue Freeze-dried cotton tissue samples such as leaves and cotton seeds were ground into powder using a grinder. 50 mg of the ground sample was weighed and extracted with 500 μL of a mixed solution of n-hexane / ethanol / acetone (volume ratio 1:1:1) carotenoid extract (containing 0.01% BHT (g / mL)). The samples were vortexed for 20 min at room temperature, centrifuged at 12,000 rpm for 5 min after precooling to 4°C, and the supernatant was retained after centrifugation. The precipitate was extracted repeatedly and centrifuged to retain the supernatant. The two supernatants were combined and dried and concentrated using a nitrogen blow dryer. The dried sample was then re-dissolved with 150 μL of dichloromethane, filtered with a filter membrane, and stored in a brown injection bottle for subsequent LC-MS / MS analysis (Inbaraj et al., 2008). The data acquisition instrument system mainly includes ultra-high performance liquid chromatography (UPLC) (ExionLC™ AD) and tandem mass spectrometry (MS / MS) (QTRAP® 6500+). The UPLC liquid phase conditions mainly use the chromatographic column: YMC C30 (3 μm, 100 mm×2.0mm id). The mobile phase during the detection process is: Phase A, methanol / acetonitrile (1:3, v / v) with 0.01% BHT and 0.1% formic acid. Phase B, methyl tert-butyl ether with 0.01% BHT. The gradient elution program was: A / B was 100:0 (V / V) at 0 min, 100:0 (V / V) at 3 min, 30:70 (V / V) at 5 min, 5:95 (V / V) at 9 min, 100:0 (V / V) at 10 min, and 100:0 (V / V) at 11 min; flow rate was 0.8 mL / min; column temperature was 28°C; injection volume was 2 μL.

[0050] The mass spectrometry conditions mainly include: atmospheric pressure chemical ion source temperature 350°C, curtain gas 25 psi. In the Q-Trap 6500+, each ion pair is scanned and detected according to the optimized declustering voltage and collision energy (Inbaraj et al., 2008; Rodrigues et al., 2016) The test results are shown in Tables 2 and 3. In Table 2, astaxanthin that was undetectable in the control EV was detected in the leaves of transgenic cotton (such as BKT-22, BKT-29, BKT-50, BKT-18, and BKT-10), and the highest content was 126.17 μg / gDW. In the true leaves of BKT-10, the astaxanthin content accounted for 20.43% of the total carotenoids. This result fully demonstrated the great potential of cotton as a bioengineering platform for astaxanthin biosynthesis. In addition, CrBKT The expression of the gene also led to a significant increase in the content of astaxanthin precursors in the carotenoid synthesis pathway, such as canthaxanthin and echinone, while the content of α-carotene, lutein and α-cryptoxanthin in another branch of the lycopene synthesis pathway that is different from the β-carotene synthesis pathway decreased. The redistribution of metabolic resources further indicated that CrBKT The expression of successfully activated the biosynthesis pathway of astaxanthin in cotton. In Table 3, the carotenoid composition and content of transgenic cotton (such as BKT-18, BKT-29, and BKT-50) cotton seeds also showed the same situation as the leaves. The accumulation of astaxanthin was detected in transgenic cotton seeds, and the content of calendula and canthaxanthin upstream of astaxanthin increased significantly compared with the control EV, while the content of lutein in another branch of the lycopene synthesis pathway that is different from the β-carotene synthesis pathway decreased.

[0051] Table 2 Contents of carotenoid components and metabolites in transgenic leaves (μg / g (DW))

[0052] Table 3 Contents of carotenoid components and metabolites in transgenic cotton seeds (μg / g (DW))

[0053] Note: N / A in Table 2 and Table 3 means not detected.

[0054] In summary, the enhanced constitutive 2×35S promoter was used to drive the tobacco Rubisco signal peptide in cotton. BKTThe gene is expressed in chloroplasts, and the astaxanthin biosynthesis pathway is successfully established, so that astaxanthin is produced in various tissues of cotton, such as leaves, stems, anthers, sepals and cotton seeds; in the detection of cotton seeds corresponding to transgenic cotton, it was found that the size of transgenic cotton seeds was significantly larger than that of the empty vector control, astaxanthin accumulation was detected in the transgenic cotton seeds, and the cottonphenol content of the transgenic cotton seeds decreased. Therefore, the method of the present invention can create transgenic cotton materials with rich astaxanthin in the whole plant, larger and heavier cotton seeds, lower cottonphenol content, and more nutrition and lower toxicity.

[0055] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A method for producing astaxanthin in cotton BKT A gene characterized by Said BKT The CDS sequence of the gene is shown in SEQ ID NO.

1.

2. The method according to claim 1 BKT The application of the gene in cotton breeding is characterized by: Said BKT The gene can promote cotton to synthesize astaxanthin, reduce the gossypol content of cotton seeds, and increase the weight and size of cotton seeds.

3. The use according to claim 2, characterized in that: Said BKT The gene is a cotton codon-optimized Chlamydomonas reinhardtii BYZGR The CDS sequence of the gene BYZGR The gene sequence number in the GenBank data is MG976837.

4. The use according to claim 2, characterized in that: For the gene sequence shown in SEQ ID NO.1, the enhanced constitutive 2×35S promoter was used to drive the tobacco Rubisco signal peptide gene to induce BKT The recombinant vector for gene expression is used to transform cotton materials to obtain cotton plants rich in astaxanthin, with reduced cottonphenol content and increased cottonseed weight and size. The Rubisco signal peptide gene is derived from tobacco, and its CDS sequence is shown in SEQ ID NO.

2.

5. Contains BKT The invention relates to an application of a recombinant vector of a gene and a tobacco Rubisco signal peptide gene in cotton breeding, characterized in that: Said BKT The CDS sequence of the gene is shown in SEQ ID NO.1, the CDS sequence of the tobacco Rubisco signal peptide gene is shown in SEQ ID NO.2, and the recombinant vector can promote cotton to synthesize astaxanthin, reduce the cottonphenol content of cotton seeds, and increase the weight and size of cotton seeds.

6. The use according to claim 4 or 5, characterized in that: The recombinant vector is driven by an enhanced constitutive 2×35S promoter.

7. A cotton breeding method, characterized in that: The method comprises the following steps: (1) The method of claim 1 BKT The gene was constructed into the pUC57 vector to obtain the target gene fragment. pUC57- BKT Plasmids; (2) pUC57-BKT Plasmid and tobacco cDNA were used as templates for PCR amplification BKT gene and tobacco Rubisco signal peptide gene and recover the target gene fragment; (3) Enzyme digestion of the Cotton2.0 vector to obtain a linear vector; (4) Recombining the target gene fragment and the linear vector cut by enzymes to construct a recombinant vector; (5) Transform the recombinant vector into Escherichia coli and select positive clones; (6) Cultivate the positive clones and extract the plasmid; (7) transforming the extracted plasmid into cotton material under the mediation of Agrobacterium; (8) The transformed cotton material obtained in step (7) is subjected to resistance screening to obtain regenerated seedlings; the regenerated seedlings are hardened and then transplanted or grafted to obtain transgenic cotton materials enriched with high astaxanthin content, with reduced cottonseed gossypol content, and increased cottonseed weight and size.

8. The method according to claim 7, characterized in that The cotton is upland cotton.

9. The method according to claim 7, characterized in that The CDS sequence of the tobacco Rubisco signal peptide gene is shown in SEQ ID NO.2.

Images