Bkt gene for producing astaxanthin in cotton and application thereof

Abstract

The invention discloses a method for producing astaxanthin in cotton BKT Gene and application, belonging to the field of plant genetic engineering technology. In cotton, the enhanced constitutive 2×35S promoter is used to drive the tobacco Rubisco signal peptide to induce BKT The gene is expressed in cotton chloroplasts, successfully establishing an astaxanthin biosynthetic pathway, enabling astaxanthin production in various cotton tissues, including leaves, stems, anthers, sepals, and seeds. Testing of transgenic cotton seeds revealed a significant increase in weight and size, but a decrease in gossypol content. Therefore, the method of the present invention can create transgenic cotton plants rich in astaxanthin, with larger and heavier cotton seeds, lower gossypol content, and a more nutritious and less toxic profile. This method can be used to create cotton plants that are bio-factories for astaxanthin production, providing a stable, low-cost, and effective alternative to traditional astaxanthin sources.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to a BKT gene and application thereof in synthesis of astaxanthin, reduction of gossypol content, and increase of weight and size of cotton seeds. BACKGROUND

[0002] Cotton is the most important natural textile fiber source plant in the world, and is an important industrial raw material and military resource. It has a wide planting area, and about 80 subtropical and tropical countries in the world grow cotton, of which 59 countries have a planting area of at least 5,000 hectares (Wakelyn and P., 2009). In China, the total output, consumption and textile export of the cotton industry rank among the top in the world, and have an important economic position. In addition to the well-known main product cotton fiber, the byproduct cotton seed also has great resource value. In cotton, 1 kg of cotton fiber can produce 1.6 kg of cotton seed (Janga et al., 2019). Cotton seed contains 21% edible oil and 23% edible protein, and is rich in various vitamins, trace elements and other natural lipid efficient storage systems, and has high utilization value (Sarrion-Perdigones et al., 2011; Gao et al., 2022). Although cotton seed has various nutritional values and application potential, the anti-nutritional factors such as gossypol and its derivatives contained in the pigment glands of cotton seed can have a negative impact on the health of humans and monogastric animals (Gao et al., 2020). Therefore, developing a cotton seed material with low toxicity, high nutrition and high antioxidant capacity is the future trend of cotton seed modification.

[0003] Astaxanthin is a sesquiterpenoid. Its unique chemical structure allows it to exhibit extremely high antioxidant activity, even more potent than vitamin E and coenzyme Q10. This makes it pharmacologically active against diseases such as cancer, cardiovascular disease, diabetes, and inflammation. The increasing use of astaxanthin in health supplements, food, and cosmetics has led to a significant increase in market demand for natural astaxanthin (Ambati et al., 2014). Currently, chemical synthesis and extraction from Haematococcus pluvialis are the primary methods for producing astaxanthin. While chemical synthesis offers low cost and high yield, its product is primarily the cis-isomer, with significantly lower bioavailability and antioxidant activity than naturally derived trans-astaxanthin, representing only 10% of the antioxidant capacity. In contrast, natural astaxanthin extracted from Haematococcus pluvialis has higher bioactivity and market value, but its production is costly and limited by culture conditions (such as light, temperature, and nutrients) (Mussagy et al., 2023). To overcome these limitations, the rapid development of synthetic biology and metabolic engineering technologies in recent years has opened up new avenues for astaxanthin production. By elucidating the astaxanthin biosynthetic pathway (including key enzymes such as β-carotene hydroxylase and ketolase), researchers have successfully synthesized astaxanthin in common crop plants using plant metabolic engineering. These include tobacco (Hasunuma et al., 2008), Arabidopsis thaliana (Stålberg et al., 2003; Zhong et al., 2011), carrot (Ahn et al., 2012), tomato (Huang et al., 2013), apple (Jia et al., 2019), soybean (Emily et al., 2015), maize (Liu et al., 2021), and rice (Zhu et al., 2018). These plants are considered potential dietary sources of astaxanthin, offering new possibilities for developing functional foods and improving human nutritional health. Since higher plants (including cotton) generally do not produce astaxanthin, the purpose of the present invention is to rely on the genetic engineering manipulation of the astaxanthin biosynthesis pathway in the widely planted upland cotton to obtain transgenic cotton material with rich astaxanthin as a whole plant and larger, more nutritious and less toxic cotton seeds. Summary of the Invention

[0004] One of the objects of the present invention is to provide a method for producing astaxanthin in cotton. BKT Gene.

[0005] The second object of the present invention is to provide BKT Application of genes in cotton breeding, BKT The gene can promote cotton to synthesize astaxanthin, reduce the gossypol content of cotton seeds, and increase the weight and size of cotton seeds.

[0006] The third object of the present invention is to provide a cotton breeding method to create transgenic cotton materials with rich astaxanthin in the whole plant, larger and heavier cotton seeds, lower gossypol content, and more nutrition and lower toxicity.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows:

[0008] BKT The gene is a cotton codon-optimized gene from Chlamydomonas reinhardtii. CrBKT Gene (GenBank: MG976837, β-carotene ketolase), BKT The CDS sequence of the gene is shown in SEQ ID NO.1.

[0009] The present invention first targets cotton codon pairs from Chlamydomonas reinhardtii CrBKT The gene was optimized and the optimized gene was named BKT Genes, then BKT Gene sequence, tobacco Rubisco signal peptide gene driven by enhanced constitutive 2×35S promoter BKT The recombinant vector expressing the gene is used to transform cotton materials to obtain cotton plants rich in astaxanthin, with larger and heavier cotton seeds and reduced gossypol content. The Rubisco signal peptide is derived from tobacco, and its CDS sequence is shown in SEQ ID NO.2.

[0010] Secondly, the present invention discloses a method for constructing a cotton transgenic material: the cotton codon is optimized from Chlamydomonas reinhardtii. CrBKT genes, and in BKT The tobacco Rubisco signal peptide gene was fused to the gene by homologous recombination, and the gene was targeted to the chloroplast. The enhanced constitutive 2×35S promoter was used to drive the tobacco Rubisco signal peptide gene and BKT The gene is connected to the Cotton2.0 vector through homologous recombination to form an OE-BKT vector, which is then transferred into cotton materials through cotton genetic transformation to obtain transgenic cotton materials with rich astaxanthin as the whole plant, lower gossypol content, larger cotton seeds, more nutrition and less toxicity.

[0011] In addition, it contains BKT The recombinant vector of the gene and the tobacco Rubisco signal peptide gene and the use of the recombinant vector in synthesizing astaxanthin in cotton, increasing cottonseed weight and size, and reducing gossypol content also fall within the protection scope of the present invention.

[0012] The recombinant vector is driven by an enhanced constitutive 2×35S promoter. The cotton is upland cotton, and the upland cotton material is L328.

[0013] The application also discloses a cotton breeding method, which comprises the following steps:

[0014] (1) the said BKT gene is constructed into a pUC57 vector to obtain a pUC57-BKT plasmid containing the target gene fragment;

[0015] (2) the target gene fragment and the tobacco Rubisco signal peptide gene are amplified by PCR with the pUC57-BKT plasmid and the tobacco cDNA as templates respectively, and the target gene fragment is recovered; BKT

[0016] (3) the Cotton2.0 vector is subjected to enzyme cutting to obtain a linear vector;

[0017] (4) the target gene fragment and the linear vector subjected to enzyme cutting are subjected to recombination and connection to construct a recombination vector;

[0018] (5) the recombination vector is transformed into E. coli, and a positive clone is picked;

[0019] (6) after the positive clone is cultured, the plasmid is extracted;

[0020] (7) the extracted plasmid is transformed into cotton material under the mediation of Agrobacterium;

[0021] (8) the cotton material subjected to transformation obtained in the step (7) is subjected to regeneration seedling under the condition of corresponding resistance screening; and after the regeneration seedling is hardened, the regeneration seedling is transplanted or grafted to obtain a transgenic cotton material rich in astaxanthin, low in gossypol content and high in weight and size of cotton seeds.

[0022] The application has the following advantages:

[0023] In the application, the tobacco Rubisco signal peptide is guided by the enhanced constitutive 2x35S promoter to drive the expression of the BKT gene in chloroplast, the astaxanthin biosynthetic pathway is successfully established, astaxanthin is produced in various tissues of cotton such as leaves, stems, anthers, sepals and cotton seeds, the astaxanthin content in the transgenic leaves can reach 126.1657 μg / g DW, accounting for 20.43% of the total carotenoids, the size of the transgenic cotton seeds is obviously larger than that of the cotton seeds of the empty vector control (EV), 0.1737 μg / g DW of astaxanthin is detected in the transgenic cotton seeds, and the gossypol content of the transgenic cotton seeds is reduced.

[0024] ​The present application provides a cost-effective and scalable alternative method for astaxanthin biosynthesis based on cotton production. Astaxanthin, like gossypol, is fat-soluble, and in cotton seeds, the conversion of gossypol to astaxanthin not only reduces toxicity but also enhances the functionality and nutritional value of cotton seeds, making them more suitable for human consumption and livestock feed. This invention not only directly alleviates the current shortage of astaxanthin production, but also significantly improves the economic and nutritional value of cotton. Cotton can serve as a biological factory for astaxanthin production, providing a stable, low-cost and effective alternative to traditional astaxanthin sources. In addition, the dual benefits of enhanced nutrition and reduced toxicity can greatly expand the potential applications of cotton seeds in the human food, animal feed and functional ingredient markets. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 To enhance the constitutive 2x35S promoter to start the tobacco Rubisco signal peptide gene and BKT gene vector construction map.

[0026] Figure 2 For the phenotype of transgenic material callus and embryonic callus stage, scale = 1 mm.

[0027] Figure 3 For the transcription level detection of transgenic material, n = 3, ** for p <0.01.

[0028] Figure 4 For the phenotype of vegetative organs of transgenic material in the field.

[0029] Figure 5 For the phenotype of reproductive organs of transgenic material in the field, flower scale = 1 cm, sepal and stamen scale = 2 mm, anther scale = 250 μm, fiber scale = 1 cm.

[0030] Figure 6 For the phenotype of cotton seeds of transgenic material and gossypol content detection, n ≥ 3. DETAILED DESCRIPTION

[0031] The advantages and features of the present application will become more apparent with the description of the specific embodiments. However, the specific experimental methods involved in the following examples are conventional methods or implemented according to the suggested conditions in the manufacturer's instructions, unless otherwise specified.

[0032] Unless specifically indicated, the technical means used in the examples are conventional means known to those skilled in the art. The experimental methods in the following examples are conventional methods, unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained from the market.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Methods and materials similar or equivalent to those described herein can be used in the practice of the present application. The exemplary methods and materials described herein are illustrative only and not intended to be limiting.

[0034] Phanta Max super-fidelity DNA polymerase high-fidelity enzyme, Taq plus DNA polymerase high amplification enzyme, DNA Maker used in the present application are purchased from Nanjing Novozyme Biotech Co., Ltd.; Anhydrous ethanol, n-hexane, acetone, dichloromethane, chromatographic grade methanol are purchased from Fuyu Fine Chemical Co., Ltd.; Rifampicin, kanamycin, cephalosporin are purchased from Beijing Solaybao Biological Technology Co., Ltd.; 2,6-Di-tert-butyl-p-cresol (BHT) chromatographic grade is purchased from Aladdin Biochem Technology Co., Ltd.; RNAprepPure polysaccharide polyphenol total RNA extraction kit is purchased from Germany Tiangen Biochemical Technology Co., Ltd.; Reverse transcription kit (Hifair® Ⅲ 1st Strand cDNA Synthesis SuperMix for qPCR) is purchased from Shanghai Yixing Biological Technology Co., Ltd.; qRT-PCR kit (2× Universal SYBR Green Fast qPCR Mix) is purchased from Wuhan Aibote Biological Technology Co., Ltd.; Plasmid rapid small extraction kit is purchased from Germany Tiangen Biochemical Technology Co., Ltd.; Homologous recombinase ClonExpress MultiS One Step Cloning Kit is purchased from Beijing Novozyme Biotech Co., Ltd.; SpeI enzyme, EcoRI enzyme are purchased from New England Biolabs (Beijing) Co., Ltd. Plant transformation and tissue culture related medium are purchased from Beijing Coolab Co., Ltd.; The primers and sequencing work are completed in Shanghai Shenguo Biological Engineering Co., Ltd.

[0035] Example 1: Cotton-BKT Vector construction

[0036] 1. According to the codon preference of Gossypium hirsutum, the CDS sequence of CrBKT is optimized by codon optimization software, and the optimized sequence is shown as SEQ ID NO. 1. The optimized gene is named BKT gene, and the optimized BKT gene is constructed into a pUC57 universal vector to obtain a pUC57-BKT plasmid containing the target gene fragment.

[0037] 2, The purpose fragment amplification: using tobacco cDNA as template, according to the sequence of tobacco Rubisco signal peptide gene design primer Rubisco-F and Rubisco-R, primer Rubisco-F with the vector homologous fragment joint, using Phanta enzyme to amplify tobacco Rubisco signal peptide gene. Using pUC5-BKT plasmid as template, design primer BKT-F and BKT-R, BKT-F primer plus tobacco Rubisco signal peptide gene joint, BKT-R primer plus vector homologous fragment joint, using Phanta enzyme to amplify BKT Gene.

[0038] PCR amplification system: 2×Phanta Max Buffer 25 μL; dNTPMix (10 mM) 1 μL; primer F / R (10 μm) 1 μL; template plasmid (pUC57-BKT) 1 μL (150 ng / μL); Phanta Max Super-Fidelity DNA Polymerase 1 μL; dd H2O to 50 μL.

[0039] Rubisco-F: CCTGCAGGCGGCCGCACTAGTATGGCTTCCTCAGTTCTTTCCTC;

[0040] Rubisco-R: CAAGAAAGCTGGGTTCTAGAATACCTAATGGCCCGGGCTAGCATG;

[0041] BKT-F: TCTCATACCTTCCTGATTTGAGCACTAGTATGGGACCTGGTATTCAGCCTAC;

[0042] BKT-R: GTAGGCTGAATACCAGGTCCCATACTAGTGCTCAAATCAGGAAGGTATGAGA.

[0043] PCR reaction program as follows: 95℃ 3 min; 95℃ 15 s; 58℃ 15 s; 72℃ 30 s / kb; 38 cycles; 72℃ 5 min; 4℃ storage.

[0044] The PCR amplification product was subjected to 1.5% agarose gel electrophoresis (120 V, 15 min), the length of tobacco Rubisco signal peptide gene sequence was 237 bp, BKT The length of the gene sequence was 984 bp. The target gene was purified using a PCR purification kit to obtain the target fragment product with a joint sequence, and was stored in a refrigerator at -20℃.

[0045] 3. Enzymatic digestion: Select the appropriate enzyme digestion site in the polyclonal site of the Cotton 2.0 vector, which has an enhanced constitutive 2x35S promoter and a spectinomycin resistance gene. Use 50 μL of enzyme digestion system to double-digest the vector with NEB restriction enzymes Spe I and EcoRI. The enzyme digestion system is: Cotton 2.0 vector 2 μg; restriction enzyme Spe I 1 μL; restriction enzyme EcoRI 1 μL; CutSmart Buffer 5 μL; dd H2O to 50 μL. The enzyme digestion system is placed in a 37°C constant temperature metal bath for enzyme digestion for 3 h. After enzyme digestion, perform 1.5% agarose gel electrophoresis (120 V, 15 min) on the enzyme digestion product, and use the plasmid before enzyme digestion as a control. After confirming that the appropriate size band is cut, the successfully cut linear vector is gel recovered and purified.

[0046] 4. Homologous recombination: Use the Novozyme ClonExpress MultiS One Step Cloning Kit homologous recombination kit to recombine and connect the purified tobacco Rubisco signal peptide gene and BKT gene two target fragments and the Cotton 2.0 linear vector digested with Spe I and EcoRI. The reaction system is 10 μL, and the specific system is: 5x CE MultiS Buffer 2 μL; homologous recombination enzyme Exnase MultiS 1 μL; linearly digested vector 1 μL (50 ng / μL); two target fragments with adaptors each 1 μL (30 ng / μL); dd H2O to 10 μL. After the system is prepared, heat it in a 37°C metal bath for 30 min, and terminate the reaction on ice for 5 min. The recombined vector is named Cotton 2.0-BKT, and the vector map is shown in Figure 1 .

[0047] 5. Transform E. coli: Add the recombinant vector Cotton 2.0-BKT to 30 μL of DH5 α competent cells, and place it on ice for 30 min. Then, transform the vector into the competent cells by heat shock at 42°C, add 400 μL of LB liquid non-resistant medium, activate it at 37°C for 1 h, and then spread it on a Spe-resistant LB solid medium. Invert it and culture it in a 37°C incubator for 12-16 h, and then select single colonies for positive detection.

[0048] 6. Agrobacterium transformation: The correct positive monoclonal bacteria were detected and then extracted plasmid, through the electric shock transformation into Agrobacterium LBA4404 competent, add 400 μL LB liquid non-resistant medium, 28°C shaking table activation 1 h after 50 μL bacteria liquid suction coated in Spe+Rif resistance LB solid medium, inverted culture in 28°C incubator, 24 h after picking single clone for positive detection. The bacteria liquid was expanded after PCR detection, and sterilized glycerol was added to a concentration of 20%, and the bacteria liquid was stored at -80 for subsequent experiments.

[0049] Example 2: Cotton genetic transformation

[0050] The cotton genetic transformation method referred to the method described by Jin Shuangxie et al. (Jin Shuangxie, 2006).

[0051] 1. Cotton sterile seedling planting: Prepare shelled seeds, 0.1% mercuric chloride (HgCl2), sterile water, sterile conical flask, waste liquid bottle; in the clean bench, the forceps was sterilized by burning with alcohol lamp, the shelled seeds were put into the sterile conical flask, and 0.1% mercuric chloride was used for disinfection for 7 min; the mercuric chloride was poured back into the bottle, and the seeds were washed with sterile water for 4-5 times, each time for 2-3 min; the washed seeds were evenly placed on the sterile seedling culture medium with sterile forceps, and cultured at 28°C in the dark; after 24 h of culture, the radicle was about 1 cm long, and the radicle was gently inserted into the sterile seedling culture medium with sterile forceps, and cultured at 28°C in the dark for 5-7 days. Then it was used for cotton genetic transformation.

[0052] 2. Cotton genetic transformation: LBA4404 Agrobacterium of Cotton2.0-BKT vector was expanded, 8 mL of bacteria was inoculated and cultured at 28°C for 16-18 h, then centrifuged at 4000 rpm for 10 min, and then resuspended with sterilized MGL to reach the appropriate concentration; the radicle and cotyledon of the cultured sterile seedling were cut off, and the remaining hypocotyl was cut into small pieces; the resuspended Agrobacterium was used to infect the hypocotyl for 8 min, and the water was absorbed with filter paper; the sterilized filter paper was moistened on the co-culture medium and placed on the medium (the filter paper can inhibit the growth of bacteria and also help the infection); the hypocotyl was placed in the medium, sealed, and cultured at 21°C in the dark for 3 days, then the explants were cultured and screened on the medium containing 50 μg / mL Kana, to grow transgenic positive callus; then the callus was transferred to the induction medium to induce embryogenic callus and produce positive transgenic plants. The transgenic callus and embryogenic callus phenotype is shown in Figure 2 , compared with the callus and embryogenic callus of empty vector control (EV), the transgenic callus and embryogenic callus showed obvious red pigment deposition.

[0053] Example 3: Identification of positive lines of transgenic material

[0054] 1. Cotton tissue RNA extraction: Cotton tissue RNA extraction used RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit from Tian Gen Bio-chemical Technology Co., Ltd. in Germany, and the extraction steps were performed according to the instructions. After RNA extraction, 200 ng of sample was taken from each sample for 1.5% agarose gel electrophoresis (120 V, 15 min) to ensure that the quality of the extracted RNA was qualified.

[0055] 2. Total RNA reverse transcription cDNA: All RNA samples were reverse transcribed according to the instructions of the reverse transcription kit (Hifair® Ⅲ 1st Strand cDNA Synthesis SuperMix for qPCR) to a total of 1 μg, and then the reverse transcribed cotton cDNA was diluted 50 times as a template for qRT-PCR amplification.

[0056] 3. qRT-PCR amplification: Roche Light Cycler 96 real-time fluorescent quantitative PCR instrument and 2x Universal SYBR Green Fast qPCR Mix quantitative reagent were used for qRT-PCR amplification, and the required template for amplification was the cDNA reaction product synthesized in the previous step. 2- △ Ct method was used to calculate the gene transcription level, and the cotton ubiquitin protein gene UB7 was used as the internal reference gene for data normalization analysis. The results are shown in Figure 3 , a series of transgenic positive seedlings of overexpressed target genes were detected. BKT

[0057] UB7-RT-F: CGGGGTACCGATGATAGAGCGA

[0058] UB7-RT-R: GGGAAGGCTTTGCTTGACGTGC

[0059] BKT-RT-F: ATGGGACCTGGTATTCAGCCTA

[0060] BKT-RT-R: CGAACCACAAACCATACACGAAA.

[0061] Example 4: Field test

[0062] Phenotypic analysis of transgenic plants and wild type plants was carried out under field conditions Figure 4 , Figure 5 ). The results are shown in Figure 4 ​It can be seen that OE-BKT transgenic cotton plants stably exhibited red pigmentation associated with astaxanthin accumulation at multiple developmental stages compared to empty vector control (EV) plants. In the vegetative organs, all green tissues, including cotton leaves, petioles, stipules, and stems, exhibited significant red pigmentation, which was particularly evident in young tissues, while in mature chlorophyll-rich tissues, the red pigmentation became less evident, possibly due to the masking of the red pigmentation color by the presence of chlorophyll. By Figure 5 It can be seen that in the reproductive organs, significant red pigmentation was also observed in the bracts, sepals, and stamens; in contrast, the color change in the petals was relatively weak; in addition, so far, no red pigmentation has been observed in mature cotton fibers.

[0063] Example 5: Transgenic material cotton seed identification

[0064] To statistically collect the relevant data of the harvested transgenic material cotton seeds, the length and width of each of 10 cotton seeds of the empty vector control (EV) and the 4 OE-BKT transgenic lines were measured using a vernier caliper; in addition, the weight of 20 seeds of each material was weighed, and these collected statistical data were converted into a bar chart format by software, as shown in Figure 6 As shown, the weight and size of the OE-BKT seeds were significantly larger compared to the control. After removing the cotton shells from representative transgenic material cotton seeds, OE-BKT exhibited uneven light red pigmentation in the cotyledons, while EV seeds maintained the phenotype characteristic of creamy color, and the color of their seed glands changed from dark brown to red.

[0065] Example 6: Cottonseed gossypol detection

[0066] The determination of gossypol content in cotton seeds was carried out according to the method described by Zhang et al. (Zhang et al., 2024).

[0067] Grind the tissues such as seeds that need to be detected for gossypol with liquid nitrogen, quickly weigh 0.05 g of well-grounded powder, add 0.5 mL of gossypol extraction solution (Table 1), and place it on ice for 15 min. After heating in a 27°C water bath until the liquid is uniform, avoid light and ultrasonic for 15 min. Centrifuge at 12000 rpm for 15 min, avoid the precipitate and aspirate the supernatant, try to avoid light throughout. Then filter with a 0.22 μm filter membrane, and aspirate 150 μL into a brown liquid phase sample bottle containing an internal cannula.

[0068] Table 1 Gossypol extraction solution configuration

[0069]

[0070] Gossypol standard solution was prepared by diluting 1,000 mg / L gossypol standard stock solution with chromatographic grade acetonitrile to a mass concentration of 20, 30, 40, 50, 60, and 70 mg / L, respectively. After filtration with a 0.22 μm filter, 150 μL of each concentration was placed into the corresponding brown liquid chromatography sample bottle containing an internal cannula. The high-performance liquid chromatography detection conditions were as follows: mobile phase A: methanol and mobile phase B: 0.1% (v / v) phosphoric acid mixture. The volume ratio of A to B was 85:15. The flow rate was 1.0 mL / min, isocratic elution; the column temperature was 40 °C; the injection volume was 10 μL. The detection wavelength was at 235 nm. The gossypol detection results are also shown in Figure 6 As shown in Table 2, compared with the empty vector control EV, the gossypol content in the BKT (X1) transgenic cotton seeds was reduced by 19.9%-37.2%.

[0071] Example 7: Detection of carotenoid components and content in cotton tissues

[0072] The freeze-dried cotton tissue samples such as leaves, cotton seeds, etc. were ground into powder with a grinder, 50 mg of the ground sample was weighed, and 500 μL of a carotenoid extraction solution (containing 0.01% BHT (g / mL)) of a mixture of n-hexane / ethanol / acetone (volume ratio 1:1:1) was used to extract the sample; the sample was vortexed at room temperature for 20 min with a vortex instrument, pre-cooled at 4°C, centrifuged at 12000 rpm for 5 min, and the supernatant was retained after centrifugation. The supernatant was combined with the supernatant obtained by repeated extraction of the precipitate, and then concentrated by nitrogen blowing. 150 μL of dichloromethane was used to redissolve the dried sample, which was filtered with a filter membrane and stored in a brown sample bottle for subsequent LC-MS / MS analysis (Inbaraj et al., 2008). The data acquisition instrument system mainly includes ultra-high performance liquid chromatography (UPLC) (Exion LC™ AD) and tandem mass spectrometry (MS / MS) (QTRAP® 6500+). The UPLC liquid phase conditions mainly use a chromatographic column: YMC C30 (3 μm, 100 mm x 2.0 mm i.d.). The mobile phase during detection is: A phase, methanol / acetonitrile (1:3, v / v) with 0.01% BHT and 0.1% formic acid. B phase, methyl tert-butyl ether with 0.01% BHT. The gradient elution program is: 0 min A / B is 100:0 (V / V), 3 min is 100:0 (V / V), 5 min is 30:70 (V / V), 9 min is 5:95 (V / V), 10 min is 100:0 (V / V), 11 min is 100:0 (V / V) flow rate 0.8 mL / min; column temperature 28°C; sample size 2 μL.

[0073] The mass spectrometry conditions mainly include: atmospheric pressure chemical ion source temperature 350°C, gas curtain gas 25 psi. In the Q-Trap 6500+, each ion pair is scanned and detected according to the optimized declustering voltage and collision energy (Inbaraj et al., 2008; Rodrigues et al., 2016)

[0074] The detection results are shown in Tables 2 and 3. In Table 2, astaxanthin, which was not detected in the control EV, was detected in the leaves of transgenic cotton (such as BKT-22, BKT-29, BKT-50, BKT-18, BKT-10), and the highest content was 126.17 μg / g DW. In the true leaves of BKT-10, the content of astaxanthin accounted for 20.43% of the total carotenoids, which fully proved the great potential of cotton as a biological engineering platform for astaxanthin biosynthesis. In addition, CrBKTThe expression of the gene also resulted in a significant increase in the content of precursors of astaxanthin synthesis pathway, such as canthaxanthin and echinenone, and a decrease in the content of a-carotene, lutein and a-cryptoxanthin in another branch downstream of lycopene, which is different from the pathway for synthesizing β-carotene, further indicating the re-allocation of metabolic resources, CrBKT The expression of the gene successfully activated the astaxanthin biosynthesis pathway in cotton. In Table 3, the detection of carotenoid components and content in transgenic cotton seeds (such as BKT-18, BKT-29, BKT-50) also showed the same situation as the leaves. The accumulation of astaxanthin was detected in transgenic cotton seeds, and the contents of adonirubin and canthaxanthin upstream of astaxanthin were significantly increased compared with the control EV, while the content of lutein in another branch downstream of lycopene, which is different from the pathway for synthesizing β-carotene, was decreased.

[0075] Table 2 Carotenoid components and metabolites in transgenic leaves (μg / g (DW))

[0076]

[0077] Table 3 Carotenoid components and metabolites in transgenic cotton seeds (μg / g (DW))

[0078]

[0079] Note: N / A in Table 2 and Table 3 means not detected.

[0080] In summary, the gene was expressed in the chloroplast of cotton by using the enhanced constitutive 2x35S promoter to drive the tobacco Rubisco signal peptide to guide BKT The astaxanthin biosynthesis pathway was successfully established, and astaxanthin was produced in various tissues of cotton, such as leaves, stems, anthers, sepals and cotton seeds. In the detection of the corresponding cotton seeds of transgenic cotton, it was found that the size of the transgenic cotton seeds was significantly larger than that of the empty vector control, astaxanthin accumulation was detected in the transgenic cotton seeds, and the content of gossypol in the transgenic cotton seeds was decreased. Therefore, through the method of the present application, transgenic cotton materials can be created which are rich in astaxanthin, have larger and heavier cotton seeds, have lower gossypol content, and are more nutritious and less toxic.

[0081] The above-described embodiments are only preferred embodiments of the present application, merely used to explain the present application, and are not intended to limit the scope of the present application. For those skilled in the art, of course, other embodiments can be easily made by substitution or change based on the technical content disclosed in the present specification, and therefore, any changes and improvements made on the principle of the present application shall be included in the scope of the patent application of the present application.

Claims

1. A cotton BKT gene, characterized in that, The BKT The CDS sequence of the gene is shown as SEQ ID NO.

1.

2. The method of claim 1 BKT application of the gene in reducing gossypol content of cottonseed and increasing weight and size of cottonseed, characterized in that, The gene sequence shown in SEQ ID NO. 1 is guided by a 2x35S promoter driving the tobacco Rubisco signal peptide gene BKT The recombinant vector of gene expression, transforming cotton material, obtaining cotton plants rich in astaxanthin, reducing gossypol content and increasing weight and size of cotton seeds, the Rubisco signal peptide gene derived from tobacco, the CDS sequence is shown in SEQ ID NO. 2, and the cotton is Gossypium hirsutum.

3. Use according to claim 2, characterized in that, The BKT gene is a CDS sequence of a Chlamydomonas reinhardtii CrBKT gene which is codon-optimized for cotton, and the CrBKT gene sequence of the CrBKT gene in GenBank data is MG976837.

4. A composition comprising BKT The recombinant vector of the gene and the tobacco Rubisco signal peptide gene is applied to reduce the gossypol content of cotton seeds and increase the weight and size of the cotton seeds, characterized in that, The BKT The CDS sequence of the gene is shown as SEQ ID NO. 1, the CDS sequence of the tobacco Rubisco signal peptide gene is shown as SEQ ID NO. 2, and the cotton is Gossypium hirsutum.

5. Use according to claim 4, characterized in that, The recombinant vector is driven by an enhanced constitutive 2x35S promoter.

6. A method of reducing the gossypol content of cottonseed and increasing the weight and size of the cottonseed, characterized by, The method comprises the following steps: (1) The method of claim 1, wherein the method comprises BKT constructing the gene into a pUC57 vector to obtain a plasmid containing the gene fragment of interest pUC57- BKT plasmid; (2) respectively with pUC57-BKT Plasmid and tobacco cDNA as templates, PCR amplification BKT Genes and tobacco Rubisco signal peptide genes and recover the target gene fragments; (3) linear carrier is obtained by enzyme digestion of the expression vector; (4) the target gene fragment and the enzyme-digested linear carrier are recombined to construct a recombinant vector; (5) the recombinant vector is transformed into E. coli, and a positive clone is picked; (6) after the positive clone is cultured, the plasmid is extracted; (7) the extracted plasmid is transformed into cotton material under the mediation of Agrobacterium; (8) the transformed cotton material obtained in step (7) is subjected to resistance screening to obtain regenerated seedlings; the regenerated seedlings are transplanted or grafted after hardening to obtain transgenic cotton material with enriched astaxanthin, reduced gossypol content in cottonseed, and increased weight and size of cottonseed; The cotton is Gossypium hirsutum, and the CDS sequence of the tobacco Rubisco signal peptide gene is shown in SEQ ID NO. 2.

Images