Recombinant expression vector, recombinant strain and method for synthesizing rebaudioside D by one-step method
By constructing a recombinant expression vector containing the gene encoding glycosyltransferase and sucrose synthase, the problem of low yield of rebaudioside D in the prior art was solved, and efficient one-step synthesis of rebaudioside D was achieved, which was suitable for industrial production.
Patent Information
- Application Number
- CN202410671524.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-28
- Publication Date
- 2025-05-06
AI Technical Summary
In the prior art, the yield of rebaudioside D is relatively low and cannot meet market demand.
The recombinant expression vector was used to form a recombinant strain co-expressing three enzymes, and rebaudioside D was synthesized by one-step method.
The conversion rate of substrate steviol STV and the yield of product rebaudioside D are improved, efficient industrial production is achieved, and the production operation process is simplified.
Smart Images
Figure CN119932059A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biocatalytic synthesis, and in particular to a recombinant expression vector, a recombinant strain and a one-step method for synthesizing rebaudioside D. Background Art
[0002] Stevioside is a natural sweetener extracted from the Stevia rebaudiana plant. Due to its high sweetness and low calorie properties, it is gradually becoming a substitute for sucrose and other artificial sweeteners. Especially in health-conscious food and beverage products, the components of rebaudioside are widely studied and used in the formulation of sugar-free or low-sugar products because of their high sweetness, taste close to sucrose, good thermal stability and acid and alkali resistance.
[0003] Rebaudioside I is a member of the stevioside family and is widely used as a sweetener added to various foods and beverages, such as sugar-free beverages, baked goods, candies, yogurt, etc., to reduce the calorie content of the product while providing sweetness. In addition, Rebaudioside D is suitable for use in the production of foods or health products for diabetic patients, as well as products for people who pay attention to health and weight management.
[0004] However, the yield of rebaudioside D in the prior art is relatively low and cannot meet the market demand. Summary of the invention
[0005] In view of this, the object of the present invention is to provide a recombinant expression vector, a recombinant strain and a one-step method for synthesizing rebaudioside D, so as to overcome the problem of the yield of rebaudioside D in the prior art.
[0006] In a first aspect, the present invention provides a recombinant expression vector comprising a gene encoding a glycosyltransferase UGT76G1 mutant 68S, a gene encoding a glycosyltransferase UGT91C1 mutant 2-12E, and a gene encoding a sucrose synthase.
[0007] The coding gene sequence of the glycosyltransferase UGT76G1 mutant 68S in the above technical solution is shown in SEQ ID NO.1;
[0008] The coding gene sequence of glycosyltransferase UGT91C1 mutant 2-12E is shown in SEQ ID NO.2;
[0009] The coding gene sequence of sucrose synthase is shown in SEQ ID NO.3.
[0010] Compared with the prior art, the recombinant expression vector of the present application contains the coding gene of the glycosyltransferase UGT76G1 mutant 68S, the coding gene of the glycosyltransferase UGT91C1 mutant 2-12E, and the coding gene of the sucrose synthase. After the recombinant expression vector is transferred into the host strain, the constructed three-enzyme co-expression recombinant strain can realize the fermentation enzyme production of a single strain, thereby saving the use of equipment and materials, improving production efficiency, and saving production costs.
[0011] In a second aspect, the present invention provides a recombinant strain containing the above-mentioned recombinant expression vector.
[0012] Compared with the prior art, the recombinant strain in the present application contains the coding genes of three enzymes, namely, glycosyltransferase UGT76G1 mutant 68S, glycosyltransferase UGT91C1 mutant 2-12E and sucrose synthase. Therefore, the enzyme product expressed by the recombinant strain can be used for the one-step synthesis of rebaudioside D, directly converting stevioside STV into rebaudioside D, thereby improving the conversion rate of the substrate stevioside STV and the yield of the product rebaudioside D.
[0013] In a third aspect, the present invention provides a method for constructing a recombinant strain, which is used for constructing the above-mentioned recombinant strain, comprising the following steps:
[0014] Step S1, connecting the coding gene of glycosyltransferase UGT76G1 mutant 68S, the coding gene of glycosyltransferase UGT91C1 mutant 2-12E and the coding gene of sucrose synthase to an expression vector to obtain a recombinant plasmid;
[0015] Step S2, transferring the recombinant plasmid into a host strain to obtain a three-enzyme co-expressing recombinant strain.
[0016] Compared with the prior art, in the above technical scheme, the coding gene of glycosyltransferase UGT76G1 mutant 68S, the coding gene of glycosyltransferase UGT91C1 mutant 2-12E and the coding gene of sucrose synthase are transferred into the host strain through a recombinant plasmid, so that a three-enzyme co-expression recombinant strain can be obtained. The use of the three-enzyme co-expression recombinant strain to produce enzymes can not only save materials and equipment and simplify production operations, but also realize the conversion of stevioside STV into rebaudioside D by adding enzymes in only one step, thereby improving the conversion rate of the catalytic reaction.
[0017] Further, the expression vector is PYB1s;
[0018] The host strain includes but is not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum. In a fourth aspect, the present invention provides a one-step method for synthesizing rebaudioside D, comprising the following steps:
[0019] (1) inoculating the recombinant strain into a culture medium containing stevioside STV and L-arabinose for selective culture, wherein the recombinant strain is the above-mentioned recombinant strain;
[0020] (2) selecting colonies with uniform color, raised colonies, round and smooth surfaces, and a colony diameter of 2 to 3 mm in step (1), inoculating them into LB liquid culture medium, culturing them at a temperature of 35 to 40° C. and shaking at 200 to 300 rpm for 5 to 8 hours to obtain seed solution;
[0021] (3) inoculating the seed solution into a new LB medium at an inoculum amount of 0.5-1.2 v / v%, and performing shaking culture at a temperature of 35-40° C. and 200-300 rpm;
[0022] (4) OD of the culture medium to be shaken 600 When the pH value is 0.6-0.8, add the inducer to carry out induction culture;
[0023] (5) After the induction culture is completed, the bacteria are collected, resuspended, the cells are broken, and centrifuged. The supernatant is the crude enzyme solution;
[0024] (6) Add stevioside STV, sucrose, UDPG, crude enzyme solution and sodium phosphate buffer solution to the catalytic reaction system for reaction, inactivate the enzyme in a boiling water bath and dissolve the reaction precipitate, and centrifuge to obtain the supernatant, which is the product rebaudioside D.
[0025] Compared with the prior art, the technical solution of the present invention inoculates the recombinant strain containing the recombinant expression vector into a culture medium containing stevioside STV and L-arabinose for selective culture and screening, and can obtain a recombinant strain with robust growth, excellent performance, and more suitable for the industrial transformation of stevioside STV. When the enzyme product expressed by the screened three-enzyme co-expression recombinant strain is used for the one-step synthesis of rebaudioside D, the conversion efficiency of the substrate stevioside STV in the reaction system can be improved to more than 90%. At the same time, the recombinant strain obtained by the present invention through breeding has been tested for 50 generations, proving that it has good genetic stability and can be applied to actual production.
[0026] Moreover, the crude enzyme solution in the catalytic reaction system of the present invention can directly convert the substrate stevioside STV into rebaudioside D, that is, a one-step synthesis of rebaudioside D is achieved, which not only increases the yield of rebaudioside D, but also simplifies the production operation process, making it suitable for industrial production.
[0027] Furthermore, in step (1), the concentration of stevioside STV in the culture medium is 40 mg / L to 100 mg / L, and the concentration of L-arabinose is 1 g / L to 5 g / L;
[0028] When the culture is selected in step (1), the culture temperature is 30 to 40° C. and the culture is carried out for 12 to 18 hours.
[0029] Compared with the prior art, the above technical scheme defines the concentration range of stevioside STV and L-arabinose in the culture medium for selective culture. A small amount of stevioside STV and L-arabinose can stimulate the recombinant strain to express a small amount of enzyme that can catalyze the reaction of stevioside STV. The recombinant strain with higher enzyme activity has a greater survival advantage. Therefore, in the culture medium, excellent strains that can express enzyme products that make the substrate stevioside STV have a higher conversion rate can be screened, and the excellent strains have good genetic stability and are suitable for use in large-scale industrial production.
[0030] Furthermore, the LB medium in step (2) includes: 10 g / L NaCl, 5 g / L yeast powder, 10 g / L peptone and 40-70 mg / L streptomycin sulfate.
[0031] Compared with the prior art, the above technical solution contains an appropriate concentration of streptomycin sulfate in the LB medium. Streptomycin sulfate inhibits the growth of non-target microorganisms and helps the target recombinant strain to quickly become the dominant microorganism in the culture medium, thereby accelerating the preparation process of the seed solution and improving the quality and stability of the seed solution.
[0032] Furthermore, the inducer in step (4) is arabinose, the final concentration of the inducer in the LB medium is 2-5 g / L, the induction culture temperature is 20-30° C., and the shaking culture is carried out at 200-300 rpm for 16-24 hours.
[0033] Compared with the prior art, arabinose at a final concentration of 2 to 5 g / L can induce the three-enzyme co-expression recombinant strain to express the target enzyme product. Within this final concentration range, the expression amount of the target enzyme product can be further increased.
[0034] Furthermore, the catalytic reaction system contains stevioside STV 25-50mM, sucrose 300-800mM, UDPG 1-2mM, crude enzyme solution and sodium phosphate buffer solution 50-100mM; the OD of the recombinant strain culture solution used in preparing the crude enzyme solution is 600 The value is 2 to 4.
[0035] It should be understood that the concentrations of the reaction substrates stevioside STV, sucrose and UDPG in the above technical solution are all final concentrations in the catalytic reaction system. The amount of crude enzyme solution added should be determined according to the volume of the total reaction system and the concentration of each substrate in the reaction system.
[0036] Furthermore, during the catalytic reaction, the reaction temperature is 35-40° C., the pH is 6-8, and the reaction time is 6-48 hours. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 This is the growth curve of the three-enzyme co-expressing recombinant Escherichia coli in Test Example 2 in the fermenter.
[0038] Figure 2 This is a graph showing the change in the yield of the product rebaudioside D (RD) over time in the reaction system of Test Example 3.
[0039] Figure 3 This is the detection spectrum of HPLC after 24 hours of reaction in Test Example 3. DETAILED DESCRIPTION
[0040] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0041] It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified.
[0042] Example 1
[0043] Amplification of target gene
[0044] Using the cDNA of the glycosyltransferase UGT76G1 mutant 68S from wild-type rice (Oryza sativa) as a template, 68s-F and 68s-R as primers, and high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) was used for PCR amplification to obtain the correct mutant 68S gene fragment.
[0045] 68s-F (SEQ ID NO.4):
[0046] GCTAACAGGAGGAATTAACCATGGCCGAAAATAAAACG
[0047] 68s-R (SEQ ID NO.5):
[0048] TCCTCTTCCTGCGTTTGACGTATGTTACAACGATGAAATGTA
[0049] Using the cDNA of the glycosyltransferase UGT91C1 mutant 2-12E from wild-type rice (Oryza sativa) as a template, ugt76g1-F and ugt76g1-R as primers, and high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) was used for PCR amplification to obtain the correct mutant 2-12E gene fragment.
[0050] ugt76g1-F (SEQ ID NO.6):
[0051] CGTCAAACGCAGGAAGAGGAGGAAATAATGGACTCCGGCTAC
[0052] ugt76g1-R (SEQ ID NO.7):
[0053] CCTCCTCTTCCTGCGTTTGACGTATGTCAATCCTTGTAAGATCTC
[0054] The cDNA of the sucrose synthase gene from Arabidopsis thaliana was used as a template, atsus-F and atsus-R were used as primers, and PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct sucrose synthase gene fragment.
[0055] atsus-F (SEQ ID NO.8):
[0056] CAAACGCAGGAAGAGGAGGAAATAATGGCAAACGCTGAACGTATG
[0057] atsus-R (SEQ ID NO.9):
[0058] GTACCAGATCTACCCTCGAGAACCCAAAGGCTTCATATA
[0059] Example 2
[0060] Construction of recombinant expression vector
[0061] Using PYB1s-F and PYB1s-R as primers and PYB1s empty vector as template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct pYB1s empty expression vector fragment. (Qun Liu, Baixue Lin, Yong Tao. Improved methylation in E. coli via an efficient methylsupply system driven by betaine. Metabolic Engineering, Volume 72, 2022, 46-55, published this vector.)
[0062] PYB1s-F: (SEQ ID NO.10)CTCGAGGGTAGATCTGGTAC
[0063] PYB1s-R: (SEQ ID NO.11)GGTTAATTCCTCCTGTTAGCCCA
[0064] The mutant 68S gene fragment, mutant 2-12E gene fragment and sucrose synthase gene fragment were ligated with the pYB1s empty expression vector fragment by using the Gibson assembly method to obtain a recombinant expression vector.
[0065] E. coli DH5α competent cells were prepared by the CaCl2 method (Beijing Quanshijin Biotechnology Co., Ltd.), and the above-mentioned Gibson ligation product was added to the E. coli DH5α competent cells, reacted on ice for 30 minutes, then reacted in a 42°C water bath for 90 seconds, and then placed on ice for 2 minutes. Subsequently, E. coli was added to 1mL LB medium, placed on a 37°C shaker for 1 hour of recovery, and then spread on an LB plate containing 50mg / L streptomycin sulfate and cultured at 37°C overnight. The composition of the above-mentioned LB medium is: NaCl 10g / L, yeast powder 5g / L, peptone 10g / L, and the LB solid medium also contains 15g / L agar powder.
[0066] Single clones were picked and plasmids were extracted from them and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing verification. The recombinant expression vector with correct sequencing was named pYB1s-68s-2-12E-atsus.
[0067] Example 3
[0068] Construction and cultivation of recombinant Escherichia coli expressing three enzymes
[0069] The composition of the LB medium used in this example is: NaCl 10g / L, yeast powder 5g / L, peptone 10g / L, the LB solid medium also contains agar powder 15g / L, and different auxiliary components are added to the LB medium according to different culture stages.
[0070] The competent cells of E. coli BW25113 were prepared by the CaCl2 method, and the above-mentioned recombinant expression vector pYB1s-68s-2-12E-atsus was transferred into the competent cells of E. coli BW25113. Then, the cells were spread on LB plates containing 50 mg / L streptomycin sulfate and cultured at 37°C overnight. The positive clones containing the recombinant expression vector pYB1s-68s-2-12E-atsus were selected, which were the recombinant E. coli expressing the three enzymes.
[0071] A single colony of the recombinant Escherichia coli expressing the three enzymes was inoculated into an LB solid medium containing 50 mg / L stevioside STV and 1 g / L L-arabinose, and cultured at 35°C for 16 h. Colonies with uniform color, raised colonies, rounded and smooth surfaces, and a colony diameter of 2 to 3 mm were selected and inoculated into 5 mL of LB liquid medium containing 50 mg / L streptomycin sulfate. The culture was placed in a shaker and shaken at 37°C and 220 rpm for 7 h to obtain a seed solution.
[0072] The above seed solution was inoculated into another 400 mL LB medium containing 50 mg / L streptomycin sulfate at an inoculum volume of 1 v / v%, and cultured in a shaker at 37°C and 220 rpm. 600 When the pH value was 0.8, arabinose with a final concentration of 3 g / L was added for induction, and shaking culture was continued at 25°C and 220 rpm in a shaker for 20 h.
[0073] After the induction culture was completed, the OD of the culture medium was measured. 600 The value was 4, and the cells were collected by centrifugation at 5000×g for 10 min. The cells were resuspended in 15 mL of 100 mM sodium phosphate buffer (pH 7.0). The bacterial cells were disrupted by ultrasound at 260W for 30 min to release the intracellular enzymes. After the disruption, the cells were centrifuged at 8000×g for 10 min in a refrigerated centrifuge at 4°C, and the supernatant was collected as the crude enzyme solution.
[0074] Test Example 1
[0075] 25mM stevioside STV and 300mM sucrose were dissolved in 100mM sodium phosphate buffer, 1.5mM UDPG and 10mL crude enzyme solution in Example 3 were added, and finally 100mM sodium phosphate buffer with pH 7.0 was added to 50mL. After being placed in a water bath at 37°C for 6h, the reaction was terminated in a boiling water bath for 5min and the reaction precipitate was dissolved. The content of rebaudioside D (RD) detected by HPLC was 18.6mM, the yield of RD was 74.4%, and the residual content of stevioside STV was 2.5mM, that is, the conversion rate of stevioside STV was 90%.
[0076] Test Example 2
[0077] In order to be closer to industrial production, the three-enzyme co-expressing recombinant E. coli constructed in Example 3 was fermented at high density in a 5L fermenter to obtain a fermentation broth. The fermentation curve of the bacteria in the fermenter is shown in FIG. Figure 1 shown.
[0078] The specific fermentation process is as follows:
[0079] A TB fermentation medium (4 mL / L glycerol, 24 g / L yeast extract, 12 g / L tryptone, and a phosphate buffer system consisting of 72 mmol / L K2HPO4 and 17 mmol / L KH2PO4) was prepared in a 5 L fermentor and sterilized. The seed solution in Example 3 was inoculated into the TB fermentation medium at an inoculation amount of 1% of the volume of the fermentation medium. Fermentation was carried out at 37° C. The ventilation pressure of the fermentor was 0.02 MPa, and the stirring speed could be controlled at 300 to 1000 rpm. The stirring speed in this example was 500 rpm, and the dissolved oxygen was maintained at 25 to 35%. A 50 wt % glucose solution was added at a rate of 5 g / L / h. After the bacterial concentration grew to OD600 of 50, the fermentation liquid was cooled to 25° C., and a final concentration of 2 g / L arabinose was added for induction culture. The fermentation culture was continued for 36 h to obtain a fermentation liquid.
[0080] Take 2L of fermentation liquid and centrifuge it at 4000rpm and 25℃ for 15min to collect the fermentation bacteria. Resuspend the fermentation bacteria with sodium phosphate buffer to a total volume of 1L. Homogenize the resuspended fermentation bacteria cells at a homogenization pressure of 80Mpa. After homogenization twice, centrifuge at 4000rpm for 15min to collect the supernatant enzyme solution.
[0081] Test Example 3
[0082] The substrate stevioside STV was added stepwise, and the concentration of the substrate stevioside STV was increased to 50mM at an addition amount of 10mM / time / 1h, sucrose was 700mM, UDPG 1.5mM was added, 500mL of the supernatant enzyme solution in Test Example 2 was added, and the sodium phosphate buffer was supplemented to 2000mL, wherein the concentration of the sodium phosphate buffer was 100mM and the pH was 7.0.
[0083] The reaction conversion system was heated to 37° C. and reacted for 24 h, then placed in a boiling water bath for 5 min to terminate the reaction and dissolve the reaction precipitate.
[0084] The results of HPLC detection showed that the content of rebaudioside D (RD) was 42.7 mM, and the calculated yield of RD was 85.4%. The residual content of stevioside STV was 3.2 mM, and the calculated conversion rate of stevioside STV reached 93.6%.
[0085] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A recombinant expression vector, characterized in that: It includes the coding gene of glycosyltransferase UGT76G1 mutant 68S, the coding gene of glycosyltransferase UGT91C1 mutant 2-12E and the coding gene of sucrose synthase.
2. A recombinant strain, characterized in that: The recombinant strain contains the recombinant expression vector according to claim 1.
3. A method for constructing a recombinant strain, used for constructing the recombinant strain according to claim 2, characterized in that: The steps include: Step S1, connecting the coding gene of glycosyltransferase UGT76G1 mutant 68S, the coding gene of glycosyltransferase UGT91C1 mutant 2-12E and the coding gene of sucrose synthase to an expression vector to obtain a recombinant plasmid; Step S2, transferring the recombinant plasmid into a host strain to obtain a three-enzyme co-expressing recombinant strain.
4. The construction method according to claim 3, characterized in that: The expression vector is PYB1s; The host strain includes but is not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.
5. A one-step method for synthesizing rebaudioside D, characterized in that: The following steps are involved: (1) inoculating the recombinant strain into a culture medium containing stevioside STV and L-arabinose for selective culture, wherein the recombinant strain is the recombinant strain according to claim 2; (2) selecting colonies with uniform color, raised colonies, round and smooth surfaces, and a colony diameter of 2 to 3 mm in step (1), inoculating them into LB liquid culture medium, culturing them at a temperature of 35 to 40° C. and shaking at 200 to 300 rpm for 5 to 8 hours to obtain seed solution; (3) inoculating the seed solution into a new LB medium at an inoculum amount of 0.5-1.2 v / v%, and performing shaking culture at a temperature of 35-40° C. and 200-300 rpm; (4) OD of the culture medium to be shaken 600 When the pH value is 0.6-0.8, add the inducer to carry out induction culture; (5) After the induction culture is completed, the bacteria are collected, resuspended, the cells are broken, and centrifuged. The supernatant is the crude enzyme solution; (6) Add stevioside STV, sucrose, UDPG, crude enzyme solution and sodium phosphate buffer solution to the catalytic reaction system for reaction, inactivate the enzyme in a boiling water bath and dissolve the reaction precipitate, and centrifuge to obtain the supernatant, which is the product rebaudioside D.
6. The method according to claim 5, characterized in that Step (1) The concentration of stevioside STV in the culture medium is 40 mg / L to 100 mg / L, and the concentration of L-arabinose is 1 g / L to 5 g / L; When the culture is selected in step (1), the culture temperature is 30 to 40° C. and the culture is carried out for 12 to 18 hours.
7. The method according to claim 5, characterized in that The LB culture medium in step (2) includes: 10 g / L NaCl, 5 g / L yeast powder, 10 g / L peptone and 40-70 mg / L streptomycin sulfate.
8. The method according to claim 5, characterized in that The inducer in step (4) is arabinose, and the final concentration of the inducer in the LB medium is 2-5 g / L. The induction culture temperature is 20-30° C., and the shaking culture is carried out at 200-300 rpm for 16-24 hours.
9. The method according to claim 5, characterized in that The catalytic reaction system contains stevioside STV 25-50mM, sucrose 300-800mM, UDPG 1-2mM, crude enzyme solution and sodium phosphate buffer solution 50-100mM; the OD of the recombinant strain culture solution used in preparing the crude enzyme solution is 600 The value is 2 to 4.
10. The method according to claim 5, characterized in that During the catalytic reaction, the reaction temperature is 35-40°C, the pH is 6-8, and the reaction time is 6-48h.