Seminal plasma circular RNA (Ribonucleic Acid) biomarker and diagnostic application thereof in male infertility

Abstract

The invention provides a seminal plasma circular RNA (Ribonucleic Acid) biomarker and a diagnostic application thereof in male infertility. Specific changes of seminal plasma circRNA in the male dyszoospermia process are found through sequencing, seminal plasma circRNA with remarkable differential expression in sterile and normal people is screened out from the seminal plasma circRNA, and the circRNA is detected to serve as a new biological index for diagnosing male infertility. Detection of the seminal plasma circRNA biomarker has indicating significance for finding male infertility, genetic information at a molecular level is provided, and data support is provided for molecular causes, pathogenesis and the like of male reproductive dysfunction. The circRNA related to reproduction is detected in seminal plasma, and the circRNA has high specificity and sensitivity and can be used as a molecular marker for male reproductive dysfunction.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to seminal plasma circular RNA biological markers and their diagnostic application in male infertility. Background Art

[0002] Globally, about 1 / 7 couples suffer from infertility, of which about 50% are caused by male patients. Male infertility is currently widely divided into oligospermia, asthenospermia, oligoasthenospermia, oligoasthenozoospermia, oligoasthenozoospermia and azoospermia according to the semen parameter guidelines issued by the World Health Organization. Although traditional semen analysis provides basic information about sperm quantity and vitality, including sperm count, concentration, vitality, motility and morphology, it often cannot determine the specific cause of infertility and lacks key information for the treatment of the disease. At present, male infertility is mainly diagnosed through family genetic history, genetic diagnosis, clinical routine semen analysis, in vitro examination, endocrine evaluation, ultrasound detection and diagnostic puncture, but 40% of infertile men still cannot determine the cause, and there is a lack of systematic molecular diagnosis in the diagnosis of male infertility. Therefore, in addition to testing the basic information of sperm, developing new molecular markers for male infertility to more clearly identify the cause of infertility is of great clinical significance for the diagnosis and treatment of male infertility.

[0003] Seminal plasma, as an important biological fluid of the male reproductive system, contains a variety of free nucleic acids, including DNA, messenger RNA (mRNA), microRNA (miRNA), long noncoding RNA (lncRNA), piwi protein-interacting RNA (piRNA) and circular RNA (circRNA). The expression levels of these nucleic acids can evaluate male reproductive health, help diagnose infertility and assess fertility. Circular RNA is a covalently closed circular RNA formed by reverse splicing of precursor RNA. Compared with linear mRNA, it lacks a 5' cap structure and a 3' poly A tail, is not easily cleaved and degraded by nuclease, has higher stability, and has more potential as a biomarker for diagnosis and treatment than other types of RNA molecules. There are reports that circular RNA can stably exist in the form of RNA protein complexes and exosomes in seminal plasma, so seminal plasma circular RNA has application prospects as a biological marker for male infertility.

[0004] However, current literatures all use sequencing of testicular and seminal plasma exosomes to perform seminal plasma circular RNA sequencing to search for potential biological markers in seminal plasma. Circular RNA sequencing of seminal plasma is not performed directly, and therefore cannot truly reflect the expression of circular RNA in seminal plasma. Summary of the invention

[0005] In order to solve the above technical problems existing in the prior art, the purpose of the present invention is to discover the specific changes of seminal plasma circRNA in the process of male spermatogenesis disorder through sequencing, explore the seminal plasma circRNA with significant differential expression in infertile and normal populations, and detect these circRNAs as new biological indicators for diagnosing male infertility. The detection of seminal plasma circRNA biomarkers is indicative for the discovery of male infertility, provides genetic information at the molecular level, and helps provide data support for the molecular causes and pathogenesis of male reproductive dysfunction.

[0006] The technical solution of the present invention is as follows:

[0007] The first object of the present invention is to provide a circRNA marker for diagnosing male infertility, wherein the marker includes circular RNA hsa-SAP130_0002, the circular RNA hsa-SAP130_0002 sequence is shown in SEQ ID NO.1, and the male infertility is oligospermia and asthenospermia and / or non-obstructive azoospermia.

[0008] SEQ ID NO.1

[0009] hsa-SAP130_0002sequence(264bp):

[0010] CCAAGGTGGTGCCCCAGCAGATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCCAATCCTGTGGCCATGGAAACCCGAA GTGACAACAGACCGTCTGTTCCCGTTCAGTTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCATACCCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAG

[0011] The second object of the present invention is to provide the use of the aforementioned circRNA marker hsa-SAP130_0002 or a reagent for detecting the aforementioned circRNA marker hsa-SAP130_0002 in the preparation of a male infertility diagnostic reagent, wherein the reagent for detecting the aforementioned circRNA marker includes a PCR primer pair for detecting circular RNA hsa-SAP130_0002: hsa-SAP130_0002-F: 5'-ATCCGACAGTATCCAGCCAA-3' (SEQ ID NO.2); hsa-SAP130_0002-R: 5'-CAGTGGGTATGCAGAAGGGG-3' (SEQ ID NO.3).

[0012] The third object of the present invention is to provide a circRNA marker for diagnosing male infertility, wherein the marker includes circular RNA hsa-TRPC1_0001, and the circular RNA hsa-TRPC1_0001 sequence is shown in SEQ ID NO.4, and the male infertility is oligospermia and asthenospermia and / or non-obstructive azoospermia.

[0013] SEQ ID NO.4

[0014] hsa-TRPC1_0001sequence(650bp)

[0015] CTGGAATGCCGGAGGCTATCCTTTTTGTTTTTTGCAGAACACAATGTGCATTCACAGCCAACTGCATGGGGCTTGGGTAGAGATACATCCTGTTTTAAGAGCATTGTAAGAATTTCATAGTTGTTACGATGAGCAGCTAAAATGACAGGTGCAACATCCATA GTTGTTGAATACTCAGGATTCTGAATTCGTTCCATTAGTTTCTTAGGTCAAGAGTTCCAGACCAGACTGGCCAACATGGTGAAACCCCATCTCTATTAAAAATACAAAATTAGCTGGGCATGGTGGGACGTGCCTGTAATCCCAGTTACTCCGGAGGCTGAAG CAGGAGAATCACTTGAACCCGGGAAGTGGAGGTTGCAGTGACCTGAGATCCGCCATTGCACTGCAGCTACTATAGTTGGTCTTGATGATCGTTTTGGTCGATGATTAAGTAGTATATCAACAGCTCCCACTACTTCAGAGTCGATTGCCACCAAAAGTGCA TCTGCAGACTGACAACCGTAGTCCAAAAGAAGCTGCAGTATATCCAAGTTTTCGTTTTCAATAGTTATGGTAACAGCATTTCCCAAGCACATCTACGCAATTTATGTTCAAGTCACCTGAACTGTTTTCCTCCAAAATCTTTTTAACCATATAATAGTCAC

[0016] The fourth object of the present invention is to provide the use of the aforementioned circRNA marker hsa-TRPC1_0001 or a reagent for detecting the aforementioned circRNA marker hsa-TRPC1_0001 in the preparation of a male infertility diagnostic reagent, wherein the reagent for detecting the aforementioned circRNA marker includes a PCR primer pair for detecting circular hsa-TRPC1_0001: hsa-TRPC1_0001-F: 5'-ACAACCGTAGTCCAAAAGAAGC-3' (SEQ ID NO.5); hsa-TRPC1_0001-R: 5'-TCCGGCATTCCAGGTGACTA-3' (SEQ ID NO.6).

[0017] The fifth object of the present invention is to provide a circRNA marker for diagnosing male infertility, the marker comprising circular RNA hsa-FBRS_0001, the sequence of the circular RNA hsa-FBRS_0001 being as shown in SEQ ID NO.7, and the male infertility being non-obstructive azoospermia.

[0018] SEQ ID NO.7

[0019] hsa-FBRS_0001 sequence (748bp):

[0020] CTCTTCACGGCCGCCCCCCAAGGCCCCGGCCCCTCCCGTGGCTCAGCCTCCCCCCTCATCATCCTCTTCGTCCTCCTCCTCCTCATCTGCCTCCTCCTCGTCCGCGCAGCTCACCCACCGGCCCCCGACGCCCTCACTGCCCCTGCCTTTGTCCACCCACAGCTTTCCCCCTCCCGGGCTGCGGCCCCCCCCACCACCCCACCACCCCTCCTTGTTCTCCCCTGGCCCCACCCTGCCCCCACCCCCACCCCTGCTGCAGGTGCCAGGGCACCCTGGGGCCTCAGCCGCTAACGCCCTTTCTGAGCAGGACCTGATCGGCCAGGACCTGAACTCTCGCTACCTGAATGCCCAGGGTGGCCCTGAGGTGGTGGGGGCAGGGGGCTCGGCCCGGCCCCTGGCCTTCCAGTTCCACCAGCACAACCACCAGCACCAGCACACCCACCAGCACACCCACCAGCACTTCACCCCTTATCCCCCGGGCCTGCTGCCACCCCACGGCCCCCACATGTTTGAGAAATATCCAGGAAAGATGGAAGGCCTTTTCCGACATAATCCGTACACGGCCTTCCCTCCCGCAGTGCCCGGGCTGCCTCCGGGCCTCCCGCCGGCCGTCTCCTTTGGCTCCCTGCAGGGGGCCTTCCAGCCCAAGAGCACGAACCCTGAGCTGCCACCACGACTGGGGCCGGTGCCGAGCGGGCTCTCCCAGAAGGGGACACAGATCCCCGACCATTTCCGGCCACCTTTGAGG

[0021] The sixth object of the present invention is to provide the use of the aforementioned circRNA marker hsa-FBRS_0001 or a reagent for detecting the aforementioned circRNA marker hsa-FBRS_0001 in the preparation of a male infertility diagnostic reagent, wherein the reagent for detecting the aforementioned circRNA marker includes a PCR primer pair for detecting circular RNA hsa-FBRS_0001: hsa-FBRS_0001-F: 5'-CGGCCACCTTTGAGGCTCTT-3' (SEQ ID NO.8); hsa-FBRS_0001-R: 5'-GGGAAAGCTGTGGGTGGACAA-3' (SEQ ID NO.9).

[0022] The seventh object of the present invention is to provide a circRNA marker for diagnosing male infertility, wherein the marker includes circular RNA hsa-ACACA_0025, the circular RNA hsa-ACACA_0025 sequence is shown in SEQ ID NO.10, and the male infertility is oligospermia and asthenospermia.

[0023] SEQ ID NO.10

[0024] hsa-ACACA_0025sequence(253bp)

[0025] CTGTAAGAGCTCATTTTGGAGGAATAATGGATGAACCATCTCCCTTGGCCCAACCTCTGGAGCTGAACCAGCACTCTCGATTCATAATAGGTTCTGTGTCTGAAGATAACTCAGAGGATGAGATCA GCAACCTGGTGAAGTTGGACCTACTGGAGGAGAAGGAGGGCTCCTTGTCACCTGCTTCTGTTGGCTCAGATACACTCTCTGATTTGGGGATCTCTAGCCTACAGGATGCTTGGCCTTGCACATAAG

[0026] The eighth object of the present invention is to provide the use of the aforementioned circRNA marker hsa-ACACA_0025 or a reagent for detecting the aforementioned circRNA marker hsa-ACACA_0025 in the preparation of a male infertility diagnostic reagent, wherein the reagent for detecting the aforementioned circRNA marker includes a PCR primer pair for detecting circular RNA hsa-ACACA_0025: hsa-ACACA_0025-F: 5'-GGCCTTGCACATAAGCTGT-3' (SEQ ID NO.11); hsa-ACACA_0025-R: 5'-GTCCAACTTCACCAGGTTGCT-3' (SEQ ID NO.12).

[0027] The ninth object of the present invention is to provide a circRNA marker for diagnosing male infertility, wherein the marker includes circular RNA hsa-UTRN_0042, the circular RNA hsa-UTRN_0042 sequence is shown in SEQ ID NO.13, and the male infertility is oligospermia and asthenospermia.

[0028] SEQ ID NO.13

[0029] hsa-UTRN_0042sequence(286bp)

[0030] GCTAAAGGAGAAAGTAAGCAGGTGATGAAGTACAGGCATCAGCTAGATGAGATTATCTGTTGGTTAACAAAGGCTGAGCATGCTATGCAAAAGAGATCAACCACCGAATTGGGAGAAAACCTGCAAGAATTAAGAGACTTAA CTCAAGAAATGGAAGTACATGCTGAAAAACTCAAATGGCTGAATAGAACTGAATTGGAGATGCTTTCAGATAAAAGTCTGAGTTTACCTGAAAGGGATAAAATTTCAGAAAGCTTAAGGACTGTAAATATGACATGGAATAAG

[0031] The tenth object of the present invention is to provide the use of the aforementioned circRNA marker hsa-UTRN_0042 or a reagent for detecting the aforementioned circRNA marker hsa-UTRN_0042 in the preparation of a male infertility diagnostic reagent, wherein the reagent for detecting the aforementioned circRNA marker includes a PCR primer pair for detecting circular RNA hsa-UTRN_0042: hsa-UTRN_0042-F: 5'-TGTAAATATGACATGGAATAAGGCT-3' (SEQ ID NO.14); hsa-UTRN_0042-R: 5'-TCTTAATTCTTGCAGGTTTTCTCC-3' (SEQ ID NO.15).

[0032] The eleventh object of the present invention is to provide a circRNA marker for diagnosing male infertility, wherein the marker comprises circular RNA hsa-ZNF532_0023, the sequence of the circular RNA hsa-ZNF532_0023 is as shown in SEQ ID NO.16, and the male infertility is oligospermia and asthenospermia.

[0033] SEQ ID NO.16

[0034] hsa-ZNF532_0023sequence(611bp)

[0035] AATGGAATGGAGCCAGCACGGTGGCTCACACCTGTAGTCCCAGCACTTTGAGAGGCCAAGGCAGGAGGATGGCTTGAGGCCAGGAGTTTGAGAGCAGCCTTGACAATATGGAACACTGTCTGCTTTTTAGATTTTCTTTCCATTTTCTACCG TTCTAAAGTAGTGCAATCACATTACTTTAGATAAAAGAGAAGCAGCAGGGGAGGGGACTCACCTCTACTCTGACATGCCGTGGTCATTGTTGGCATTCAGAAGACTTGCACTATCTGCCAGATGCTGCTTCCTAACCAGTGCAGTTATGCATC ACACCAGAGAATCCATCAGCACAAATCTCCTACACCTGCCCTGAGTGTGGGGCCATCTGCAGGTCGGTGCACTTCCAGACCCACGTCACCAAGAACTGTCTGCACTACACGAGGAGAGTTGGTTTTCGATGTGTGCATTGCAATGTTGTGTA CTCTGATGTGGCTGCTCTGAAGTCTCACATTCAAGGTTCTCACTGTGAAGTCTTCTACAAGTGTCCTATTTGTCCAATGGCGTTTAAGTCTGCCCCAAGCACACATTCCCACGCCTACACACAGCATCCTGGCATCAAGATAGGAGAACCAAA

[0036] The twelfth object of the present invention is to provide the use of the aforementioned circRNA marker hsa-ZNF532_0023 or a reagent for detecting the aforementioned circRNA marker hsa-ZNF532_0023 in the preparation of a male infertility diagnostic reagent, wherein the reagent for detecting the aforementioned circRNA marker includes a PCR primer pair for detecting circular RNA hsa-ZNF532_0023: hsa-ZNF532_0023-F: 5'-ATGTGGCTGCTCTGAAGTCTC-3' (SEQ ID NO.17); hsa-ZNF532_0023-R: 5'-TGCTGGCTCCATTCCATTTTTG-3' (SEQ ID NO.18).

[0037] The beneficial effect of the technical solution of the present invention is

[0038] The invention provides reproduction-related circRNA in seminal plasma, which has high specificity and sensitivity and can be used as a molecular marker for male reproductive dysfunction.

[0039] By using the circRNA of the present invention, seminal plasma can be directly detected. Seminal plasma material is easy to obtain and can reflect the patient's condition non-invasively, thus achieving non-invasive detection.

[0040] Direct circular RNA sequencing of seminal plasma can more realistically reflect the expression of circular RNA in seminal plasma and be more helpful in predicting spermatogenesis disorders.

[0041] The special structure of circular RNA is highly conserved in different species and cells, making it more stable and more suitable as a biological marker. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 Circular RNA species identified in the seminal plasma of the control group (n=16), oligoasthenospermia patients (n=15), and non-obstructive azoospermia patients (n=13) in the screening trial;

[0043] Figure 2 Scatter plot of differentially expressed circular RNA between male infertility and control group, including:

[0044] Figure 2 A Volcano plot of differential expression of circular RNA in oligoasthenospermia patients and normal group;

[0045] Figure 2 B Volcano plot of differential expression of circular RNA in patients with non-obstructive azoospermia versus normal control group;

[0046] Figure 3 Male infertility marker screening heat map; including:

[0047] Figure 3 A Heat map of down-regulated circular RNAs in male infertility and normal groups;

[0048] Figure 3 B Heat map of differentially down-regulated circular RNAs between oligoasthenospermia group and normal group;

[0049] Figure 4 Verification test qPCR results;

[0050] Figure 4 qPCR validation of differentially expressed circular RNA in seminal plasma of AD patients (19 cases in control group, 18 cases in oligoasthenospermia group, and 16 cases in non-obstructive azoospermia group);

[0051] Figure 4qPCR validation of differential circular RNA between EF oligoasthenospermia and normal group (17 cases in control group and 24 cases in oligoasthenospermia group) * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001;

[0052] Figure 5 Validation test ROC curve;

[0053] Figure 5 Diagnostic ability analysis of seminal plasma circular RNA in AE oligoasthenospermia and normal groups;

[0054] Figure 5 Diagram showing the diagnostic ability of seminal plasma circular RNA biomarkers in FH non-obstructive azoospermia and normal groups. DETAILED DESCRIPTION

[0055] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0056] Example 1 Selection of research subjects and basis for grouping

[0057] Before sample collection, the Bioethics Committee of Nanjing Medical University was approved, with the ethics number 2022 (776). Written informed consent was obtained from all participants, all of whom were Han Chinese. The subjects were screened according to the fifth edition of the World Health Organization Laboratory Manual for the Examination and Processing of Human Semen published by the World Health Organization in 2010:

[0058] The normal group of men had a normal sperm count in their semen ≥15.0x10 6 / mL, pH value (7.20-8.00), sperm forward motility higher than 32% and total motility higher than 40%.

[0059] The total number of sperm in the semen of patients with oligospermia (oligospermia and asthenospermia) is less than 39x10 6 / ml per ejaculation and / or sperm concentration less than 15x10 6 / ml and sperm progressive motility less than 32% and / or total motility less than 40%.

[0060] Patients with non-obstructive azoospermia are considered to have azoospermia if no sperm is detected in the semen after at least three semen analyses at 3000 rpm for 15 minutes and the sediment is examined under a microscopic microscope.

[0061] Inclusion criteria: ① exclude congenital abnormalities: Klinefelter syndrome, super male syndrome and Y chromosome microdeletion; ② exclude secondary diseases: mumps, reproductive system infection, testicular trauma and secondary surgery patients; ③ exclude obstructive azoospermia: patients with normal testicular volume and serum FSH level but obstruction found on reproductive system ultrasound.

[0062] Seminal plasma sample collection: After 2-7 days of abstinence, participants collected semen samples through masturbation, liquefied at 37°C for 30 minutes, and analyzed the semen. The test items included sperm concentration, sperm forward motility ratio, sperm motility, and total sperm count. Excess semen was centrifuged at 4°C, 3000rpm for 15 minutes, and the supernatant was frozen in a -80°C refrigerator for later use.

[0063] Example 2 Screening of male infertility markers

[0064] Step 1: Seminal plasma circular RNA library construction

[0065] The clinical characteristics of the seminal plasma samples used for library construction and sequencing in this study are as follows:

[0066] Table 1 Clinical characteristics of seminal plasma samples

[0067]

[0068] HC is the healthy control group (16 cases), OAZ is the oligospermia group (15 cases), NOA is the non-obstructive azoospermia group (13 cases), P-Value a is the significance level between the oligospermia group and the normal group, P-Value b Refers to the significance level between the non-obstructive azoospermia group and the normal group.

[0069] Total RNA of seminal plasma was extracted according to the instructions of Trizol LS reagent;

[0070] The construction of the seminal plasma sample circRNA library for sequencing includes the following steps: 1. RNA denaturation; 2. Removal of genomic DNA; 3. Reverse transcription; 4. tn5 enzyme digestion; 5. PCR amplification; 6. Magnetic bead purification; 7. Quality inspection; 8. Platform sequencing.

[0071] Step 2: Bioinformatics analysis and processing

[0072] Extract data: After the circular RNA-seq data is downloaded, extract the paired-end reads.

[0073] Removal of low-quality data: FASTp (v0.23.2) was used to remove adapters and low-quality reads, and SortMeRNA software (v4.3.4) was used to remove rRNA-containing reads.

[0074] Genome alignment: bowtie2 (v2.4.2) was used to align the processed clean data with the human reference genome (GRCh38).

[0075] Qualitative analysis: Circular RNA was identified by using CIRI2 (https: / / sourceforge.net / projects / ciri / files / CIRI2 / ), CIRCexplorer2 (https: / / github.com / YangLab / CIRCexplorer2) and find_circ (https: / / github.com / marvin-jens / find_circ) software for reverse splicing sites. Circular RNAs that were detected by more than two softwares and had a mean read count greater than 2 were identified as high-quality circular RNAs for further downstream analysis. Finally, we identified 20,644 circular RNAs in the seminal plasma samples of the normal group, 18,430 circular RNAs in the seminal plasma samples of the oligoasthenospermia group, and 14,208 circular RNAs in the seminal plasma samples of the non-obstructive azoospermia group ( Figure 1 ).

[0076] Annotation: The identified circular RNAs were annotated using the CircAltas 3.0 database (https: / / ngdc.cncb.ac.cn / circatlas / ).

[0077] Differential analysis: DEseq2 package (v1.36.0) was used to identify differentially expressed circular RNAs, where |log2(foldchange)|>2 and P<0.01 were considered to be significantly different. The differential results showed that there were 637 differential circular RNAs between the oligoasthenospermia group and the normal group, of which 514 circular RNAs were upregulated and 123 circular RNAs were downregulated; there were 272 differential circular RNAs between the seminal plasma of the non-obstructive azoospermia group and the normal group, of which 200 circular RNAs were upregulated and 72 circular RNAs were downregulated ( Figure 2 ).

[0078] Marker screening method: We found four human, monkey and mouse homologous conserved circular RNAs from the differentially downregulated circular RNAs in male infertility and control groups: hsa-SAP130_0002 (SEQ ID NO.1), hsa-FBRS_0001 (SEQ ID NO.7), hsa-ACACA_0025 (SEQ ID NO.10), and hsa-TRPC1_0001 (SEQ ID NO.4). We screened out the two circular RNAs with the largest differential expression levels from the seminal plasma differential circular RNAs in the oligoasthenospermia group and the normal group: hsa-UTRN_0042 (SEQ ID NO.13) and hsa-ZNF532_0023 (SEQ ID NO.16) ( Figure 3 ).

[0079] Example 3 Validation phase of male infertility markers

[0080] The sequences of the above six circRNAs (hsa-SAP130_0002, hsa-FBRS_0001, hsa-TRPC1_0001, hsa-ACACA_0025, hsa-ZNF532_0023 and hsa-UTRN_0042) were obtained from the Circatlas3.0 database, and NCBI was used to design RT-qPCR primers for the above six circRNAs, namely, primers shown in SEQ ID NO.2, 3, SEQ ID NO.5, 6, SEQ ID NO.8, 9, SEQ ID NO.11, 12, SEQ ID NO.14, 15, SEQ ID NO.17, 18.

[0081] The subjects of this validation test were different from those of the screening test described in Example 2 and were divided into two groups, namely:

[0082] Group 1, including: 19 cases in the control group, 18 cases in the oligospermia group, and 16 cases in the non-obstructive azoospermia group (used to verify the conservative differential circular RNAs that were down-regulated in the normal group and the male infertility group);

[0083] Group 2, including: 17 cases in the control group and 24 cases in the oligoasthenospermia group (used to verify the screening of the two circular RNAs with the largest differential expression levels from the seminal plasma differential circular RNAs between the oligoasthenospermia group and the normal group, and to find more circular RNAs related to male infertility).

[0084] The collection method described in Example 1 is used to obtain seminal plasma cDNA by RNA reverse transcription reaction of the collected samples;

[0085] 1) Genomic DNA removal

[0086]

[0087] Mix well by pipetting and place in PCR instrument at 42°C for 2 min.

[0088] 2) Single-strand cDNA synthesis

[0089]

[0090] Place in PCR instrument at 25℃ for 5 min, 55℃ for 60 min, and 85℃ for 5 min. Temporarily store the sample at -20℃.

[0091] qPCR

[0092]

[0093]

[0094] The qPCR primer sequences and amplification targets are:

[0095]

[0096] The amplification program was pre-denaturation at 95°C for 5 min, followed by 95°C for 10 s and 60°C for 30 s, a total of 40 cycles in the two-step method.

[0097] The melting program was 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s.

[0098] GAPDH was used as an internal reference. Samples with an internal reference CT value exceeding 25 were severely degraded. The relative expression of differentially expressed circular RNAs was calculated using the 2^-(ΔΔCt) method. The arithmetic mean of three technical replicates for each sample was calculated, and ΔCt = Ct 目的基因 -Ct GAPDH , ΔΔCt=ΔCt (OAZ or NOA) -ΔCt control Finally, 2^-(ΔΔCt) was calculated as the relative expression of each gene. Graphpad Prism 6 software was used for statistical analysis. qPCR data were described as mean ± standard deviation (mean ± SEM). The significance was tested using the non-parametric t-test Mann-Whitney test and a scatter plot was drawn.

[0099] A receiver operating characteristic curve (ROC) was drawn to evaluate the diagnostic efficacy of circular RNA in diagnosing male infertility. The cutoff value, sensitivity and specificity were determined by the Youden index, and the area under the curve (AUC) was calculated. When AUC < 0.5, it means that the diagnosis is meaningless; when AUC = 0.5-0.7, it means that the diagnostic efficacy is low; when AUC > 0.7, it means that the diagnostic efficacy is high.

[0100] Results: Through RT-qPCR validation and ROC curve, we found that hsa-UTRN_0042, hsa-ZNF532_0023, hsa-SAP130_0002, hsa-TRPC1_0001 and hsa-ACACA_0025 can be used as biological markers of oligoasthenozoospermia. hsa-SAP130_0002, hsa-FBRS_0001 and hsa-TRPC1_0001 were found to be biological markers of seminal plasma in non-obstructive azoospermia.

[0101] qPCR results showed:

[0102] The expression level of seminal plasma hsa-SAP130_0002 in the oligoasthenospermia group and the non-obstructive azoospermia group was lower than that in the control group, and the difference was statistically significant (P<0.01)( Figure 4A).

[0103] The expression level of seminal plasma hsa-TRPC1_0001 in the oligoasthenospermia group and the non-obstructive azoospermia group was lower than that in the control group, and the difference was statistically significant (P<0.05)( Figure 4 B).

[0104] The expression level of seminal plasma hsa-ACACA_0025 in the oligoasthenospermia group was lower than that in the control group, and the difference was statistically significant (P < 0.05). The expression level in the non-obstructive azoospermia group showed a downward trend, with no statistical difference ( Figure 4 C).

[0105] The expression level of seminal plasma hsa-FBRS_0001 in the non-obstructive azoospermia group was lower than that in the control group, and the difference was statistically significant (P < 0.05). The expression level in the oligoasthenospermia group showed a downward trend, with no statistical difference ( Figure 4 D).

[0106] The expression level of seminal plasma hsa-UTRN_0042 in the oligoasthenospermia group was higher than that in the control group, and the difference was statistically significant (P<0.001)( Figure 4 E).

[0107] The expression level of seminal plasma hsa-ZNF532_0023 in the oligoasthenospermia group was higher than that in the control group, and the difference was statistically significant (P<0.01)( Figure 4 F).

[0108] The ROC curve was used to detect the diagnostic efficacy of circular RNA in human seminal plasma for distinguishing oligoasthenospermia patients from the control group using the same qPCR test in group 1 and group 2.

[0109] The results show:

[0110] hsa-SAP130_0002, AUC = 0.8070 (P < 0.001), sensitivity and specificity were 88.89% and 68.42%, respectively, with diagnostic value ( Figure 5 A).

[0111] hsa-TRPC1_0001, AUC = 0.7222 (P < 0.05), sensitivity and specificity were 61.11% and 84.21%, respectively, with diagnostic value ( Figure 5 B).

[0112] hsa-ACACA_0025, AUC = 0.7251 (P < 0.05), the sensitivity and specificity were 77.78% and 63.16%, respectively, which has diagnostic value ( Figure 5 C).

[0113] hsa-UTRN_0042, AUC = 0.8652 (P < 0.001), sensitivity and specificity were 83.33% and 82.35%, respectively, with diagnostic value ( Figure 5 D).

[0114] hsa-ZNF532_0023, AUC = 0.7892 (P < 0.01), sensitivity and specificity were 75% and 76.47%, respectively, with diagnostic value ( Figure 5 E).

[0115] The above analysis showed that hsa-SAP130_0002, hsa-TRPC1_0001, hsa-ACACA_0025, hsa-UTRN_0042 and hsa-ZNF532_0023 had the potential to serve as biomarkers for patients with oligoasthenospermia.

[0116] The ROC curve was used to detect the diagnostic efficacy of circular RNA in human seminal plasma in distinguishing patients with non-obstructive azoospermia from the control group.

[0117] The results show:

[0118] hsa-SAP130_0002, AUC = 0.7566 (P < 0.01), sensitivity and specificity were 87.50% and 68.42%, respectively, with diagnostic value ( Figure 5 F).

[0119] hsa-TRPC1_0001, AUC = 0.7039 (P < 0.05), sensitivity and specificity were 56.25% and 89.47%, respectively, with diagnostic value ( Figure 5 G).

[0120] hsa-FBRS_0001, AUC = 0.7303 (P < 0.05), sensitivity and specificity were 50% and 94.74%, respectively, with diagnostic value ( Figure 5 H).

[0121] The above analysis showed that hsa-SAP130_0002, hsa-TRPC1_0001 and hsa-FBRS_0001 had the potential to be used as biomarkers for patients with non-obstructive azoospermia.

[0122] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A circRNA marker for diagnosing male infertility, characterized in that: The marker includes circular RNA hsa-SAP130_0002, the sequence of the circular RNA hsa-SAP130_0002 is shown in SEQ ID NO.1, and the male infertility is oligospermia and asthenospermia and / or non-obstructive azoospermia.

2. Use of the circRNA marker of claim 1 or a reagent for detecting the circRNA marker of claim 1 in the preparation of a male infertility diagnostic reagent, characterized in that: The reagent for detecting the circRNA marker in claim 1 comprises a PCR primer pair for detecting circular RNA hsa-SAP130_0002: hsa-SAP130_0002-F: 5'-ATCCGACAGTATCCAGCCAA-3' (SEQ ID NO. 2); hsa-SAP130_0002-R: 5'-CAGTGGGTATGCAGAAGGGG-3' (SEQ ID NO. 3).

3. A circRNA marker for diagnosing male infertility, characterized in that: The marker includes circular RNA hsa-TRPC1_0001, the sequence of the circular RNA hsa-TRPC1_0001 is shown in SEQ ID NO.4, and the male infertility is oligospermia and asthenospermia and / or non-obstructive azoospermia.

4. Use of the circRNA marker according to claim 3 or a reagent for detecting the circRNA marker according to claim 3 in the preparation of a male infertility diagnostic reagent, characterized in that: The reagent for detecting the circRNA marker in claim 3 includes a PCR primer pair for detecting circular hsa-TRPC1_0001: hsa-TRPC1_0001-F: 5'-ACAACCGTAGTCCAAAAGAAGC-3' (SEQ ID NO.5); hsa-TRPC1_0001-R: 5'-TCCGGCATTCCAGGTGACTA-3' (SEQ ID NO. 6).

5. A circRNA marker for diagnosing male infertility, characterized in that: The marker includes circular RNA hsa-FBRS_0001, the sequence of the circular RNA hsa-FBRS_0001 is shown as SEQ ID NO.7, and the male infertility is non-obstructive azoospermia.

6. Use of the circRNA marker of claim 5 or a reagent for detecting the circRNA marker of claim 5 in the preparation of a male infertility diagnostic reagent, characterized in that: The reagent for detecting the circRNA marker in claim 5 comprises a PCR primer pair for detecting circular RNA hsa-FBRS_0001: hsa-FBRS_0001-F: 5'-CGGCCACCTTTGAGGCTCTT-3' (SEQ ID NO.8); hsa-FBRS_0001-R: 5'-GGGAAAGCTGTGGGTGGACAA-3' (SEQ ID NO. 9).

7. A circRNA marker for diagnosing male infertility, characterized in that: The marker includes circular RNA hsa-ACACA_0025, the sequence of the circular RNA hsa-ACACA_0025 is shown in SEQ ID NO.10, and the male infertility is oligospermia and asthenospermia.

8. Use of the circRNA marker of claim 7 or a reagent for detecting the circRNA marker of claim 7 in the preparation of a male infertility diagnostic reagent, characterized in that: The reagent for detecting the circRNA marker in claim 7 comprises a PCR primer pair for detecting circular RNA hsa-ACACA_0025: hsa-ACACA_0025-F: 5'-GGCCTTGCACATAAGCTGT-3' (SEQ ID NO. 11); hsa-ACACA_0025-R: 5'-GTCCAACTTCACCAGGTGCT-3' (SEQ ID NO. 12).

9. A circRNA marker for diagnosing male infertility, characterized in that: The marker includes circular RNA hsa-UTRN_0042, the sequence of the circular RNA hsa-UTRN_0042 is shown in SEQ ID NO.13, and the male infertility is oligospermia and asthenospermia.

10. Use of the circRNA marker according to claim 9 or a reagent for detecting the circRNA marker according to claim 9 in the preparation of a male infertility diagnostic reagent, characterized in that: The reagent for detecting the circRNA marker in claim 9 includes a PCR primer pair for detecting circular RNA hsa-UTRN_0042: hsa-UTRN_0042-F: 5'-TGTAAATATGACATGGAATAAGGCT-3' (SEQ ID NO. 14); hsa-UTRN_0042-R: 5'-TCTTAATTCTTGCAGGTTTTCTCC-3' (SEQ ID NO. 15).

11. A circRNA marker for diagnosing male infertility, characterized in that: The marker includes circular RNA hsa-ZNF532_0023, the sequence of the circular RNA hsa-ZNF532_0023 is shown in SEQ ID NO.16, and the male infertility is oligospermia and asthenospermia.

12. Use of the circRNA marker of claim 11 or a reagent for detecting the circRNA marker of claim 11 in the preparation of a male infertility diagnostic reagent, characterized in that: The reagent for detecting the circRNA marker in claim 11 comprises a PCR primer pair for detecting circular RNA hsa-ZNF532_0023: hsa-ZNF532_0023-F: 5'-ATGTGGCTGCTCTGAAGTCTC-3' (SEQ ID NO. 17); hsa-ZNF532_0023-R: 5'-TGCTGGCTCCATTCCATTTTTG-3' (SEQ ID NO. 18).

Images