Application of detection product of SCTAG protein or nucleic acid encoding SCTAG protein in broad-spectrum tumor detection

Abstract

The invention relates to application of a detection product of SCTAG protein or nucleic acid encoding the SCTAG protein in broad-spectrum tumor detection. A detection agent is used for tumor risk assessment, tumor screening, tumor diagnosis or auxiliary diagnosis, tumor recurrence and metastasis dynamic monitoring, tumor medication guidance or tumor prognosis judgment. The broad-spectrum tumors comprise esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, kidney suspected cell cancer, prostate cancer, testis cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thoracic adenocarcinoma, lymphoma, leukemia, malignant melanoma, bladder cancer and osteosarcoma. The detection product of the SCTAG protein or the nucleic acid encoding the SCTAG protein can be used for broad-spectrum detection of various malignant tumors, and has specificity.

Description

Technical Field

[0001] The present application belongs to the field of broad-spectrum detection of tumors, and specifically relates to the application of detection products of SCTAG protein or nucleic acid encoding SCTAG protein in broad-spectrum tumor detection. Background Art

[0002] Cancer is a serious threat to human life and health worldwide. Malignant tumors are multifactorial diseases, including genetic and environmental factors, such as eating habits, obesity, smoking, etc. Common cancers worldwide include breast cancer, lung cancer, colorectal cancer, prostate cancer, gastric cancer and liver cancer. The incidence of malignant tumors has obvious gender and regional differences. Breast cancer in women has surpassed lung cancer to become the most common cancer.

[0003] Therefore, early diagnosis and early treatment are the key to improving the survival rate of patients with malignant tumors. By developing new diagnostic technologies, reliable early warning can be provided in the early stages of the disease, which will help screen high-risk groups, improve the level of early diagnosis of various tumors, and achieve effective prevention and control of tumors.

[0004] At present, the diagnosis of esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, bladder cancer, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymus cancer, lymphoma, leukemia, malignant melanoma and other tumors mainly relies on bronchoscopy, gastrointestinal endoscopy, imaging examination, tumor marker detection, etc. Among them, tumor marker detection has the advantages of low cost, less trauma and easy to repeat, and has a wider application space. Tumor markers refer to substances that are characteristically present in malignant tumor cells, or are produced by abnormal tumor cells, or are produced by the body's stimulation response to tumors. These tumor markers are generally present in the tissues, blood and secretions of tumor patients in the form of metabolites such as antigens, enzymes, hormones, etc., and can be detected by immunological and biochemical methods. The detection of tumor markers can help determine the occurrence of tumors and cancer types, and can better evaluate the staging and treatment effects of cancer, and monitor the recurrence and metastasis of tumors.

[0005] Carcinoembryonic antigen (CEA) was first discovered in 1965 and was first used in the diagnosis of digestive tract tumors, breast cancer and other tumors in 1981. It can effectively identify and screen high-risk populations. However, serum CEA concentration can be increased in chronic diseases such as colitis, so it is a tumor marker with poor specificity and low tumor localization ability. However, serum CEA concentration detection can monitor tumor recurrence and can also be combined with other indicators to evaluate the chemotherapy efficacy of tumors. Alpha-fetoprotein (AFP), carbohydrate antigen 153 (CA153), carbohydrate antigen 12-5 (CA12-5), carbohydrate antigen 72-4 (CA72-4), carbohydrate antigen 19-9 (CA19-9), carbohydrate antigen 24-2 (CA24-2), carbohydrate antigen 50 (CA50), carcinoembryonic antigen (CEA), etc. can be used for tumor diagnosis, but the sensitivity and specificity are not very ideal. SCTAG belongs to the cancer testis antigen (CTA) family. It is abnormally expressed only in male testicular tissue and malignant tumor tissue. It has high tissue specificity and is an ideal tumor diagnostic marker.

[0006] Although some tumor markers are highly specific, most can only detect one or several tumors, which can easily lead to missed diagnosis. In view of this, a tumor detection agent with a broader spectrum and wider clinical application is urgently needed. Summary of the invention

[0007] The primary purpose of this application is to provide a tumor marker suitable for broad-spectrum detection. Based on the research findings that SCTAG has abnormal expression levels in a variety of malignant tumor tissues, it can be used for broad-spectrum detection of a variety of malignant tumors. Based on the above purpose,

[0008] The present invention specifically provides the following technical solutions:

[0009] Use of a product for detecting SCTAG protein or nucleic acid encoding SCTAG protein in the preparation of a broad-spectrum tumor detection agent; the detection agent is used for tumor risk assessment, tumor screening, tumor diagnosis or auxiliary diagnosis, dynamic monitoring of tumor recurrence and metastasis, tumor medication guidance or tumor prognosis judgment; the broad-spectrum tumors include esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, breast cancer and special invasive breast cancer.

[0010] Furthermore, the detection agent is a reagent for detecting the content of SCTAG protein or a reagent for detecting the content of nucleic acid encoding SCTAG protein.

[0011] Furthermore, the detection agent is a reagent for detecting the content of SCTAG protein, and the detection agent is used to perform any of the following methods: biological mass spectrometry, amino acid sequencing, electrophoresis, and detection using antibodies designed specifically for mutation sites.

[0012] Furthermore, the detection agent is a reagent for the nucleic acid content encoding the SCTAG protein, and the detection agent is used to perform any of the following methods: polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid sequencing, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biological mass spectrometry and HRM method.

[0013] Furthermore, the detection agent is used for quantitative detection or qualitative detection. When the SCTAG protein content is detected to be positive and / or the nucleic acid content encoding the SCTAG protein is detected to be positive, it indicates a broad-spectrum tumor risk (higher risk) or a broad-spectrum tumor positivity; the broad-spectrum tumors include esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, breast cancer and special invasive breast cancer.

[0014] Furthermore, the sample used in the detection agent is one or more of the tissue or tissue lysate, lavage fluid, cell lysate, blood, serum and plasma of the subject.

[0015] Another object of the present invention is to provide a broad-spectrum tumor detection kit, which comprises one of the following detection agents: (1) a reagent for detecting the content of SCTAG protein; (2) a reagent for detecting the content of nucleic acid encoding SCTAG protein; the detection agent is used for tumor risk assessment, tumor screening, tumor diagnosis or auxiliary diagnosis, dynamic monitoring of tumor recurrence and metastasis, tumor medication guidance or tumor prognosis judgment; the broad-spectrum tumors include esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymus cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, breast cancer and special invasive breast cancer.

[0016] Furthermore, the kit also includes reagents for detecting other tumor markers, and the other tumor markers are one or more of the tumor markers of esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, breast cancer and special invasive breast cancer.

[0017] Furthermore, other tumor markers include but are not limited to AFP, CA153, CA12-5, CA72-4, CA19-9, CA24-2, CA50 and CEA.

[0018] Furthermore, the broad-spectrum tumor detection kit also includes a sample processing reagent, and the sample processing reagent includes at least one of a sample lysis reagent, a sample purification reagent, and a sample nucleic acid or protein extraction reagent.

[0019] Another object of the present invention is to provide a broad-spectrum tumor detection method, characterized in that it comprises:

[0020] In vivo or in vitro (1) detecting the content of SCTAG protein; (2) detecting the content of nucleic acid encoding SCTAG protein; the broad spectrum of tumors includes esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymus cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, breast cancer and special invasive breast cancer.

[0021] Furthermore, the detection of the SCTAG protein content is performed by any of the following methods: mass spectrometry, amino acid sequencing, electrophoresis, and detection using antibodies specifically designed for mutation sites.

[0022] Furthermore, the content of nucleic acid encoding SCTAG protein is detected by performing any of the following methods: polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid sequencing, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biomass spectrometry and HRM method.

[0023] Another object of the present invention is to provide a broad-spectrum tumor detection model or evaluation system, characterized in that the model or evaluation system comprises the following modules:

[0024] 1) Detection module: used to (1) detect the content of SCTAG protein in vivo or in vitro; (2) detect the content of nucleic acid encoding SCTAG protein;

[0025] 2) Analysis module: It is used to perform tumor risk assessment, tumor screening, tumor diagnosis or auxiliary diagnosis, dynamic monitoring of tumor recurrence and metastasis, tumor medication guidance or tumor prognosis judgment for a broad spectrum of tumors according to the results of the detection module; the broad spectrum of tumors includes esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, breast cancer and special invasive breast cancer.

[0026] Furthermore, the detection of the SCTAG protein content is performed by any of the following methods: mass spectrometry, amino acid sequencing, electrophoresis, and detection using antibodies specifically designed for mutation sites.

[0027] Furthermore, the content of nucleic acid encoding SCTAG protein is detected by performing any of the following methods: polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid sequencing, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biomass spectrometry and HRM method.

[0028] In the present invention, the esophageal cancer is esophageal squamous cell carcinoma, adenocarcinoma, adenosquamous carcinoma, adenoid cystic carcinoma, mucoepidermoid carcinoma, undifferentiated carcinoma or neuroendocrine carcinoma; the lung cancer is lung adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, neuroendocrine tumor or sarcomatoid carcinoma; the neuroendocrine tumor is carcinoid or small cell carcinoma; the liver cancer is hepatocellular carcinoma, intrahepatic bile duct carcinoma, mixed type; pancreatic duct adenocarcinoma, acinar cell carcinoma, mucinous cystadenocarcinoma or pancreatoblastic carcinoma; the kidney cancer is renal clear cell carcinoma, papillary cell carcinoma, renal chromophobe cell carcinoma, collecting duct carcinoma, undifferentiated carcinoma; the papillary cell carcinoma is chromophilic cell carcinoma; the bladder cancer is bladder urothelial carcinoma, squamous cell carcinoma, adenocarcinoma; the uterine cancer is ovarian serous carcinoma, endometrioid carcinoma , clear cell carcinoma or mucinous carcinoma; the cervical cancer is cervical squamous cell carcinoma, adenocarcinoma or adenosquamous carcinoma; the bladder urothelial carcinoma is transitional cell carcinoma; the breast cancer is breast non-invasive carcinoma, early invasive carcinoma, invasive special carcinoma, invasive non-special carcinoma; the breast non-invasive carcinoma is intraductal carcinoma, lobular carcinoma in situ or nipple eczematoid carcinoma; the early invasive carcinoma is early invasive ductal carcinoma or early invasive lobular carcinoma; the invasive special carcinoma is papillary carcinoma, medullary carcinoma, tubular carcinoma, adenoid cystic carcinoma, mucinous adenocarcinoma or squamous cell carcinoma, and the invasive non-special carcinoma is invasive lobular carcinoma, invasive ductal carcinoma, scirrhous carcinoma, simple carcinoma or adenocarcinoma; the thyroid cancer is thyroid papillary carcinoma, follicular carcinoma, undifferentiated carcinoma, medullary carcinoma.

[0029] The present invention confirms that SCTAG is suitable for a broad-spectrum tumor marker detection, and can be used for risk assessment, screening, diagnosis or auxiliary diagnosis, dynamic monitoring of recurrence and metastasis, medication guidance or prognosis judgment of esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, breast cancer and special invasive breast cancer, and has a broad spectrum, sensitivity and specificity, and is widely used in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0031] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, the techniques or conditions described in the literature in the art or in the product instructions are used, such as biomass spectrometry, amino acid sequencing, electrophoresis, and detection using antibodies specifically designed for mutation sites, and also for example polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid sequencing, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biomass spectrometry, and HRM methods.

[0032] The reagents and instruments used in the following examples without indicating the manufacturer are all conventional products that can be obtained commercially.

[0033] Figure 1 This is a graph showing the results of real-time fluorescence quantitative PCR detection of the expression level of SCTAG in the fresh frozen tumor tissue sample involved in Example 1.

[0034] Figure 2 This is a graph showing the results of a Western blot experiment on fresh frozen tumor tissue samples involved in Example 2 to examine the expression level of SCTAG protein in various tumor tissues.

[0035] Figure 3 The result diagram of the immunohistochemical method for detecting the expression of SCTAG in tissues involved in Example 3, wherein 1 is esophageal cancer, 2 is gastric cancer, 3 is intestinal cancer, 4 is liver cancer, 5 is pancreatic cancer, 6 is gallbladder cancer, 7 is bile duct cancer, 8 is kidney cancer, 9 is renal chromophobe cell carcinoma, 10 is prostate cancer, 11 is testicular cancer, and 12 is ovarian cancer;

[0036] Figure 4 This is a graph showing the expression of SCTAG in tissues detected by the immunohistochemistry method involved in Example 3, wherein 13 is cervical cancer, 14 is endometrial cancer, 15 is glioma, 16 is tongue cancer, 17 is laryngeal cancer, 18 is nasopharyngeal cancer, 19 is thyroid cancer, 20 is lung cancer, 21 is thymic cancer, 22 is lymphoma, 23 is leukemia, 24 is malignant melanoma, 25 is bladder cancer, 26 is breast cancer, and 27 is special invasive breast cancer.

[0037] Figure 5 This is the result of enzyme-linked immunosorbent assay (ELISA) to detect the concentration of SCTAG protein in patient serum.

[0038] Figure 6 The figure is a test result showing that SCTAG is closely related to the prognosis and survival period of esophageal cancer, where a is the recurrence rate of esophageal cancer, b is the SCTAG protein content in the serum before and after esophageal cancer surgery, and c is the relationship between the survival period of esophageal cancer and the SCTAG content.

[0039] Figure 7 This is a test result chart showing that SCTAG is closely related to the prognosis and survival of gastric cancer, where a is the recurrence rate of gastric cancer, and b is the SCTAG protein content in the serum before and after gastric cancer surgery. DETAILED DESCRIPTION

[0040] The technical solution of the present application will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present application, rather than all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present application.

[0041] The following terms or definitions are provided only to help understand the present application. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0042] Unless otherwise defined below, the meaning of all technical terms and scientific terms used in the specific embodiments of the present application is intended to be the same as those generally understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present application.

[0043] As used in this application, the terms "comprises", "comprising", "having", "containing" or "involving" are inclusive or open-ended and do not exclude other unrecited elements or method steps. The term "consisting of" is considered a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only these embodiments.

[0044] When referring to a singular noun an indefinite or definite article e.g. "a" or "an", "the" or "an" is used, this includes a plural of that noun.

[0045] The terms "approximately" and "substantially" in this application represent the accuracy range that can be understood by those skilled in the art to still ensure the technical effect of the feature in question. The term usually represents ±10% deviation from the indicated value, preferably ±5%.

[0046] The tumor markers in this application are substances that are synthesized and released by tumor cells, or produced by the body under the action of tumor cells, and can reflect the existence and growth of tumors. Usually, its content in tumor patients is much higher than that in healthy people. It has important practical value in tumor screening, diagnosis, prognosis, efficacy evaluation and follow-up of high-risk populations. Tumor marker examination is simple and easy, with little harm to the body. Only a small amount of blood or other body fluids is needed to detect traces of early cancer. It has become an important tool widely used in clinical practice. Broad-spectrum tumor markers refer to tumor markers that can cause elevation in a variety of tumors.

[0047] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily required to describe a sequential or chronological order. It should be understood that the terms so used are interchangeable under appropriate circumstances, and the embodiments described in this application can be implemented in other sequences than those described or illustrated in this application.

[0048] The diagnosis of the present invention is based on the fact that SCTAG, as an oncogene, is abnormally expressed in the process of various tumor formation and has important biological functions, indicating that SCTAG can be used for various tumor diagnosis and prognosis evaluation research. Therefore, the broad-spectrum tumor detection method provided by the present invention in some aspects is such a method: any method for detecting various tumors that includes the step of analyzing the content of SCTAG in a subject is within the scope of the present invention.

[0049] The broad-spectrum tumor detection described in the present invention includes, but is not limited to, tumor screening, diagnosis, monitoring, medication guidance and / or prognosis judgment, etc.

[0050] The SCTAG described in the present invention belongs to the cancer testis antigen family (CTA), is abnormally expressed only in male testicular tissue and malignant tumor tissue, has high tissue specificity, and is an ideal tumor diagnostic marker.

[0051] Without limitation, the amino acid sequence of SCTAG described in the present invention is as in the prior art, such as shown in SEQ ID NO.1: Met Ala Arg Tyr Arg Cys Cys Arg Ser Gln Ser Arg Ser Arg Tyr Tyr Arg Gln ArgGln Arg Ser Arg Arg Arg Arg Arg Arg Ser Cys Gln Thr Arg Arg Arg Ala Met ArgCys Cys Arg Pro Arg Tyr Arg Pro Arg Cys Arg Arg His;

[0052] The corresponding coding nucleic acid sequence is also as shown in the prior art, such as SEQ ID NO. 2: aggctggcccctgactcac agcccacaga gttccacctg ctcacaggtt ggctggctca gccaaggtggtgccctgctctgagcattca ggccaagccc atcctgcacc atggccaggt acagatgctg tcgcagccagagccggagcagatattaccg ccagagacaa agaagtcgca gacgaaggag gcggagctgc cagacacggagggagagccatgagtaagtgg gcccagctga gggtgggctg gggctgaggc tgggagctct cagggcccagccttcctctcaccacttttc ttggtctcac cagggtgctg ccgccccagg tacagaccgc gatgtagaagacactaattgcacaaaatag cacatccacc aaactcctgc ctgagaatgt taccagactt caagatcctcttgccacatcttgaaaatgc caccatccaa taaaaatcag gagcctgcta aggaacaatg ccgcctgtcaataaatgttgaaaagtcatc.

[0053] The analysis steps of the present invention are not limited to sample type, sample state, sample processing, or detection means. For example, in some embodiments of the present invention, the sample type can be at least one selected from the subject's blood, serum, plasma, urine, lavage fluid, tissue or tissue lysate, and cell culture supernatant.

[0054] In some embodiments of the present invention, the sample state can be in vivo or in vitro; no matter what kind of pretreatment the sample undergoes, as long as the ultimate purpose is to detect the SCTAG content of the sample, it is within the scope of the present invention. Of course, the sample detection means of the present invention can be diverse, and any currently known means for quantitative or qualitative analysis of proteins or genes are theoretically applicable to the present invention. Therefore, in some embodiments, the SCTAG level is nucleic acid content or protein content.

[0055] In some embodiments of the present invention, the detection agent performs detection at the nucleic acid level.

[0056] The detection agent at the nucleic acid level (DNA or RNA level) can be selected from reagents known to those skilled in the art, such as nucleic acids (usually probes or primers) that can hybridize with the DNA or RNA and are labeled with fluorescent markers, etc. It is also easy for those skilled in the art to detect the cDNA after reverse transcription of mRNA into cDNA, and the conventional replacement of these technical means does not exceed the protection scope of the present invention.

[0057] In some embodiments of the present invention, the detection agent is used to perform any of the following methods:

[0058] Polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid sequencing, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biological mass spectrometry and HRM method.

[0059] In some embodiments of the present invention, the polymerase chain reaction is selected from the group consisting of restriction fragment length polymorphism, single-strand conformation polymorphism, Taqman probe method, competitive allele-specific PCR and allele-specific PCR.

[0060] In some embodiments of the present invention, the nucleic acid sequencing method can be transcriptome sequencing or genome sequencing. In some other embodiments of the present invention, the nucleic acid sequencing method is high-throughput sequencing, also known as second-generation sequencing ("NGS"). NGS is different from "Sanger sequencing" (first-generation sequencing), which is based on the electrophoretic separation of chain termination products in a single sequencing reaction. NGS is a revolutionary change in traditional Sanger sequencing technology, and can sequence hundreds of thousands to millions of nucleic acid molecules at a time. The sequencing platform of the available NGS of the present invention is commercially available, including but not limited to Roche / 454FLX, Illumina / Solexa Genome Analyzer and Applied Biosystems SOLID system, etc. Transcriptome sequencing can also quickly and comprehensively obtain almost all transcripts and gene sequences of a certain species' specific cells or tissues in a certain state through the second-generation sequencing platform, which can be used to study gene expression, gene function, structure, alternative splicing and new transcript prediction, etc. In some other embodiments of the present invention, the nucleic acid sequencing method can be single-molecule real-time sequencing. Single-molecule DNA sequencing technology is a new generation of sequencing technology developed in the past 10 years, also known as the third-generation sequencing technology, including single-molecule real-time sequencing, true single-molecule sequencing, single-molecule nanopore sequencing and other technologies.

[0061] In some embodiments of the present invention, the detection agent is detected at the protein level.

[0062] In some embodiments of the present invention, the detection agent is used to perform any of the following methods: biological mass spectrometry, amino acid sequencing, electrophoresis, and detection using antibodies specifically designed for mutation sites. The method of detection using antibodies specifically designed for mutation sites can further be immunoprecipitation, immunocoprecipitation, immunohistochemistry, ELISA, and Western Blot.

[0063] It can be understood that with regard to the specific evaluation criteria of the present invention, when SCTAG is positively expressed, it indicates that the probability of the subject being diagnosed with the various tumors involved in the present invention is higher, and the higher the expression level, the worse the prognosis; when SCTAG is negatively expressed, it indicates that the probability of the subject being diagnosed with the tumor type involved in the present invention is low. The SCTAG provided by the present invention is a broad-spectrum tumor marker.

[0064] Of course, the evaluation application of the present invention can not only be a single test for SCTAG. In order to detect comprehensiveness or more accurate results, the present invention can also be combined with other currently known markers for detection, such as AFP, CA153, CA12-5, CA72-4, CA19-9, CA24-2, CA50 and CEA.

[0065] Similarly, the use of the reagent for detecting the SCTAG content of the present invention in the various types of tumor detection kits involved in the present invention is also not limited to sample type, sample state, sample processing, or detection methods, etc.; the various tumor detections involved in the present invention include tumor screening, diagnosis or auxiliary diagnosis, monitoring, medication guidance and / or prognosis judgment, etc.

[0066] In some embodiments of the present invention, the detection is performed on at least one of the subject's blood, serum, plasma, tissue or tissue lysate, and cell culture supernatant.

[0067] In some embodiments of the present invention, the SCTAG content is nucleic acid content or protein content. Further, when the reagent is at the nucleic acid level, the detection agent is used to perform any of the following methods: polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid sequencing, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biological mass spectrometry and HRM method. Further, when the reagent is at the protein level, the detection agent is used to perform any of the following methods: biological mass spectrometry, amino acid sequencing, electrophoresis and detection with antibodies designed specifically for mutation sites.

[0068] The broad-spectrum tumor detection kit of the present invention is generally a kit comprising a reagent for detecting the content of SCTAG protein or nucleic acid in a subject's sample; the broad-spectrum tumor detection includes tumor screening, tumor diagnosis or auxiliary diagnosis, tumor monitoring, tumor medication guidance and / or tumor prognosis judgment, etc.

[0069] In some embodiments of the present invention, the kit includes a nucleic acid level detection reagent or a protein level detection reagent:

[0070] When the kit is for nucleic acid level detection, the detection agent therein is used to perform any of the following methods: polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid sequencing, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biological mass spectrometry and HRM method.

[0071] When the kit is for protein level detection, the detection agent therein is used to perform any of the following methods: biological mass spectrometry, amino acid sequencing, electrophoresis, and detection using antibodies specifically designed for mutation sites.

[0072] In some embodiments of the present invention, the kit further comprises reagents for detecting other components for combined detection, and the other components include but are not limited to other tumor markers AFP, CA153, CA12-5, CA72-4, CA19-9, CA24-2, CA50 and CEA.

[0073] In some embodiments of the present invention, the kit further comprises a sample processing reagent, and the sample processing reagent comprises at least one of a sample lysis reagent, a sample purification reagent, and a sample nucleic acid or protein extraction reagent.

[0074] The following is a detailed description of the technical content of this application with specific embodiments.

[0075] Example 1. Expression of SCTAG mRNA in various tumor tissues.

[0076] The results of real-time fluorescence quantitative PCR detection of the expression level of SCTAG in the fresh frozen tumor tissue samples involved in this embodiment are as follows Figure 1 shown.

[0077] The fresh frozen tumor tissue samples specifically include tumor tissue samples of esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymus cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, breast cancer and special invasive breast cancer.

[0078] The results showed that SCTAG was positively expressed in all tumor tissues, indicating that SCTAG has a certain correlation with the occurrence and development of the above tumors, and has a certain tissue specificity, and can become a specific marker for the diagnosis of the above tumors with a broad spectrum.

[0079] Example 2: Western blot experiments were performed to examine the expression level of SCTAG protein in various tumor tissues.

[0080] In this example, fresh frozen tumor tissue samples were collected, including esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymus cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, breast cancer and breast invasive special cancer tumor tissue samples, and western blot experiments were performed to detect the expression level of SCTAG protein in the tissues. The results are shown in FIG. Figure 2 As shown, it is proved that SCTAG is expressed in all tumor tissues, SCTAG has a certain correlation with the occurrence and development of various malignant tumors, and has a certain tissue specificity. It can become a specific marker for the diagnosis of various tumors with a broad spectrum.

[0081] Example 3: Expression of SCTAG protein in various tumor tissues

[0082] This example collects paraffin tissue sections of tumor patients who visited the China-Japan Friendship Hospital of Jilin University between June 2014 and June 2023, including paraffin tissue sections of esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymus cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, breast cancer and breast invasive special cancer. Immunohistochemistry was used to detect the expression of SCTAG in the tissue.

[0083] The immunohistochemical results of this example show that SCTAG protein is widely expressed in the above-mentioned malignant tumor tissues. SCTAG protein is mainly expressed in the cytoplasm of tumor cells, while SCTAG protein content is not found in normal tissues. The immunohistochemical results are as follows: Figure 3 and 4 As shown, it indicates that the expression of SCTAG in various tumor tissues has high specificity and is a reliable diagnostic marker with a broad spectrum.

[0084] Example 4: Enzyme-linked immunosorbent assay (ELISA) was used to examine the elevated levels of SCTAG in the serum of patients with various tumors.

[0085] In this example, serum samples of healthy controls and serum samples of patients suffering from one or more of a variety of tumors are collected. The various tumors are specifically esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, bladder cancer, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymus cancer, lymphoma, leukemia, osteosarcoma, breast cancer and special invasive breast cancer. ELISA is performed to detect the concentration of SCTAG protein in the patient's serum. The results are as follows: Figure 5 As shown, the content of SCTAG in the serum of all the above tumor patients was significantly higher than that in the healthy controls, proving that serum SCTAG can be a specific marker for diagnosing a variety of tumors with a broad spectrum.

[0086] Example 5

[0087] In this example, serum samples were collected from patients with esophageal cancer before surgery and 3 to 7 days after surgery, and ELISA was performed to detect the concentration of SCTAG protein in the serum of the patients. The results are as follows: Figure 6 The results show that the five-year survival rate of the group with high expression of serum SCTAG before surgery was significantly lower than that of the group with low expression. The recurrence rate within one year was 44% for patients with elevated serum SCTAG after esophageal cancer surgery compared with that before surgery; the recurrence rate was 6% for patients with decreased serum SCTAG after surgery. The dynamic changes of tumor markers have an early warning effect on tumor recurrence, proving that serum SCTAG is closely related to the prognosis and survival of esophageal cancer.

[0088] Example 6

[0089] In this example, serum samples of patients with gastric cancer were collected before surgery and 3 to 7 days after surgery, and ELISA was performed to detect the concentration of SCTAG protein in the serum of the patients. The results are as follows: Figure 7 Results show that the five-year survival rate of the group with high preoperative serum SCTAG expression was significantly lower than that of the group with low preoperative expression. The serum level of patients whose tumors were too large to be completely removed increased significantly after surgery, which proves that serum SCTAG is closely related to the prognosis and survival of gastric cancer.

[0090] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. The scope of the present invention is intended to be limited by the claims and their equivalents.

Claims

1. Application of detection products of SCTAG protein or nucleic acid encoding SCTAG protein in the preparation of broad-spectrum tumor detection agents; The detection agent is used for tumor risk assessment, tumor screening, tumor diagnosis or auxiliary diagnosis, dynamic monitoring of tumor recurrence and metastasis, tumor medication guidance or tumor prognosis judgment; The broad spectrum of tumors includes esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, breast cancer and special invasive breast cancer.

2. The use according to claim 1, characterized in that: The detection agent is a reagent for detecting the content of SCTAG protein or a reagent for detecting the content of nucleic acid encoding SCTAG protein.

3. The use according to claim 2, characterized in that: The detection agent is a reagent for detecting the content of SCTAG protein, and the detection agent is used to perform any of the following methods: biological mass spectrometry, amino acid sequencing, electrophoresis, and detection using antibodies specifically designed for mutation sites.

4. The use according to claim 2, characterized in that: The detection agent is a reagent for the nucleic acid content encoding the SCTAG protein, and the detection agent is used to perform any of the following methods: polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid sequencing, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biological mass spectrometry and HRM method.

5. The use according to any one of claims 2 to 4, characterized in that: The detection agent is used for quantitative detection or qualitative detection. When the SCTAG protein content is detected to be positive and / or the nucleic acid content encoding the SCTAG protein is detected to be positive, it indicates a broad-spectrum tumor risk (higher risk) or a broad-spectrum tumor positive; The broad spectrum of tumors includes esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, breast cancer and special invasive breast cancer.

6. The use according to any one of claims 1 to 5, characterized in that: The sample used in the detection agent is one or more of the tissue or tissue lysate, lavage fluid, cell lysate, blood, serum and plasma of the object to be tested.

7. A broad-spectrum tumor detection kit, characterized in that: The detection kit comprises one of the following detection agents: (1) a reagent for detecting the content of SCTAG protein; (2) a reagent for detecting the content of nucleic acid encoding SCTAG protein; The detection agent is used for tumor risk assessment, tumor screening, tumor diagnosis or auxiliary diagnosis, dynamic monitoring of tumor recurrence and metastasis, tumor medication guidance or tumor prognosis judgment; The broad spectrum of tumors includes esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymus cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, malignant melanoma, breast cancer and special invasive breast cancer.

8. The broad-spectrum tumor detection kit according to claim 7, characterized in that: The kit also includes reagents for detecting other tumor markers. Other tumor markers are one or more of the tumor markers for esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, bladder cancer, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, osteosarcoma, malignant melanoma, breast cancer and special invasive breast cancer.

9. The broad-spectrum tumor detection kit according to claim 8, characterized in that: Other tumor markers include, but are not limited to, AFP, CA153, CA12-5, CA72-4, CA19-9, CA24-2, CA50, and CEA.

10. The broad-spectrum tumor detection kit according to claims 7 to 9, characterized in that: The kit also includes a sample processing reagent, and the sample processing reagent includes at least one of a sample lysis reagent, a sample purification reagent, and a sample nucleic acid or protein extraction reagent.

11. A broad-spectrum tumor detection method, characterized in that: It includes: In vivo or in vitro: (1) detecting the content of SCTAG protein; (2) detecting the content of nucleic acid encoding SCTAG protein; The broad spectrum of tumors includes esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, breast cancer and special invasive breast cancer.

12. A broad-spectrum tumor detection model or evaluation system, characterized in that: The model or evaluation system includes the following modules: 1) Detection module: used for (1) detecting the content of SCTAG protein in vivo or in vitro; (2) detecting the content of nucleic acid encoding SCTAG protein; 2) Analysis module: It is used to perform tumor risk assessment, tumor screening, tumor diagnosis or auxiliary diagnosis, dynamic monitoring of tumor recurrence and metastasis, tumor medication guidance or tumor prognosis judgment for a wide spectrum of tumors based on the results of the detection module; The broad spectrum of tumors includes esophageal cancer, gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, kidney cancer, renal chromophobe cell carcinoma, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, brain glioma, tongue cancer, laryngeal cancer, nasopharyngeal cancer, thyroid cancer, lung cancer, thymic cancer, lymphoma, leukemia, malignant melanoma, bladder cancer, osteosarcoma, breast cancer and special invasive breast cancer.

13. A method according to any preceding claim, characterized in that: The esophageal cancer is esophageal squamous cell carcinoma, adenocarcinoma, adenosquamous carcinoma, adenoid cystic carcinoma, mucoepidermoid carcinoma, undifferentiated carcinoma or neuroendocrine carcinoma; The lung cancer is lung adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, neuroendocrine tumor or sarcomatoid carcinoma; the neuroendocrine tumor is carcinoid or small cell carcinoma; The liver cancer is hepatocellular carcinoma, intrahepatic bile duct carcinoma, mixed type; pancreatic duct adenocarcinoma, acinar cell carcinoma, mucinous cystadenocarcinoma or pancreatoblastic carcinoma; The renal cancer is renal clear cell carcinoma, papillary cell carcinoma, renal chromophobe cell carcinoma, collecting duct carcinoma, and undifferentiated carcinoma; the papillary cell carcinoma is chromophilic cell carcinoma; The bladder cancer is bladder urothelial carcinoma, squamous cell carcinoma, adenocarcinoma; The uterine cancer is ovarian serous carcinoma, endometrioid carcinoma, clear cell carcinoma or mucinous carcinoma; The cervical cancer is cervical squamous cell carcinoma, adenocarcinoma or adenosquamous carcinoma; the bladder urothelial cell carcinoma is transitional cell carcinoma; The breast cancer is non-invasive breast cancer, early invasive cancer, invasive special cancer, invasive non-special cancer; the non-invasive breast cancer is intraductal carcinoma, lobular carcinoma in situ or nipple eczematoid carcinoma; the early invasive cancer is early invasive ductal carcinoma or early invasive lobular carcinoma; the invasive special cancer is papillary carcinoma, medullary carcinoma, tubular carcinoma, adenoid cystic carcinoma, mucinous adenocarcinoma or squamous cell carcinoma; the invasive non-special cancer is invasive lobular carcinoma, invasive ductal carcinoma, scirrhous carcinoma, simple carcinoma or adenocarcinoma; The thyroid cancer is papillary thyroid carcinoma, follicular carcinoma, undifferentiated carcinoma, and medullary carcinoma.

Images