Application of circular RNA CIRC07475 in the diagnosis and targeted therapy of MLL fusion gene leukemia
By detecting and inhibiting the circular RNA CIRC07475, which is specifically highly expressed in MLL-R leukemia, we have achieved precise diagnosis and targeted therapy for this disease, solving the problems of diagnostic difficulties and treatment effectiveness in existing technologies, and significantly improving survival rate and treatment outcomes.
Patent Information
- Application Number
- CN202510098518.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-01-22
AI Technical Summary
Current technologies lack effective methods for the diagnosis and treatment of MLL fusion gene leukemia, resulting in a low five-year survival rate, difficult treatment, high relapse rate, and a lack of early diagnosis and targeted therapy.
We discovered and validated the circular RNA CIRC07475, which is specifically highly expressed in MLL-R leukemia. We used its expression level for diagnosis and knocked down its expression with siRNA or shRNA to inhibit the proliferation of leukemia cells and DNA damage repair, thus developing targeted therapeutic drugs.
It significantly improved the diagnostic accuracy and prognosis of MLL-R leukemia, prolonged the survival of model mice, inhibited the proliferation of leukemia cells and DNA damage repair, and provided a new targeted therapy strategy.
Smart Images

Figure CN119932191B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of circular RNA CIRC07475 in the diagnosis and targeted treatment of MLL fusion gene leukemia. Background Technology
[0002] MLL fusion gene leukemia, also known as MLL (mixed-lineage leukemia) rearranged leukemia (MLL-R leukemia), has a five-year survival rate of less than 30% with current treatment methods. The low cure rate, poor prognosis, and high relapse rate in early treatment make the treatment of this type of leukemia a serious challenge, thus attracting widespread attention in recent years. Because the five-year survival rate of MLL-R leukemia patients is significantly lower than that of other leukemia patients, many patients give up the opportunity for treatment. Therefore, it is necessary to explore the biological characteristics of this type of leukemia using new methods, conduct in-depth research on the pathogenesis of childhood MLL-R leukemia, and thus find new early diagnosis and treatment methods to effectively improve the survival rate of MLL-R leukemia patients.
[0003] In recent years, a class of single-stranded non-coding RNAs (circRNAs) with closed circular structures have been found to participate in biological development and the pathogenesis of various cancers. Although the mechanisms by which most circRNAs function are not yet fully understood, they have been found to participate in cancer development and progression through multiple mechanisms, including interacting with RNA-binding proteins, regulating m6A modification, and translation into proteins. Due to the relatively low conservation of circRNAs in evolution, many of their regulated molecular targets exhibit high specificity, suggesting that circRNAs have the potential to serve as excellent cancer-specific therapeutic targets. Currently, research on circRNAs has become a frontier and important field in life sciences and molecular medicine, and significant progress has been made in the treatment of tumors such as breast cancer, liver cancer, colon cancer, and lung cancer. Meanwhile, the important regulatory role of circRNAs in leukemia is gradually being discovered. In acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML), circRNAs exhibit specific expression patterns, suggesting that circRNAs may play an important regulatory role in different subtypes of leukemia. Therefore, identifying therapeutic targets for MLL-R leukemia from circRNAs has significant theoretical and practical implications and can also provide positive guidance for the application of circRNAs in cancers of other leukemia patients. Summary of the Invention
[0004] To overcome the shortcomings of the prior art, this invention provides a novel circRNA gene specifically highly expressed in MLL-R leukemia, named CIRC07475. Further research revealed that knocking down CIRC07475 expression significantly affects the efficiency of non-homologous end junction repair in MLL-R leukemia cells and improves the survival rate of the disease. This suggests that CIRC07475 holds promise for indicating the occurrence and prognosis of MLL-R leukemia, as well as for targeted therapy of MLL-R leukemia, which has significant application value for the diagnosis and gene-targeted therapy of MLL-R leukemia.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0006] The first aspect of this invention provides the application of a reagent for detecting the expression level of the circular RNA gene CIRC07475, as shown in SEQ ID NO:1, in the preparation of diagnostic products for MLL fusion gene leukemia.
[0007] This invention discovers a lncRNA that is specifically highly expressed in MLL-R leukemia but lowly expressed under normal physiological conditions and in other types of leukemia, named CIRC07475. This lncRNA can be used to indicate the diagnosis and prognosis of this disease. The gene locus of CIRC07475 is located on the positive strand of human chromosome 17, covering a range from 30,788,269 bp to 30,788,663 bp. Identification shows that CIRC07475 is a 394 nt intronic circular RNA, with its nucleotide sequence shown in SEQ ID:1 and its back-splicing junction site (BSJ) shown in SEQ ID:2.
[0008] Preferably, the reagent for detecting the expression level of the circular RNA gene CIRC07475 is a primer for detecting the expression level of CIRC07475, the sequence of which is shown in SEQ ID NO:3-4.
[0009] Preferably, the diagnostic product includes a diagnostic chip or a reagent kit.
[0010] The second aspect of this invention provides the use of a reagent for inhibiting or reducing the expression level of the circular RNA gene CIRC07475, as shown in SEQ ID NO:1, in any of the following aspects 1)-4):
[0011] 1) To prepare products for the treatment of MLL fusion gene leukemia;
[0012] 2) Prepare products that inhibit the development and progression of MLL fusion gene leukemia.
[0013] 3) Prepare products that inhibit the proliferation of MLL fusion gene leukemia cells;
[0014] 4) Prepare products that promote apoptosis and differentiation of MLL fusion gene leukemia cells.
[0015] Preferably, the inhibition of MLL fusion gene leukemia development is described as inhibiting the DNA damage repair ability of MLL fusion gene leukemia cells.
[0016] More preferably, the ability to inhibit DNA damage repair in MLL fusion gene leukemia cells is the efficiency of inhibiting non-homologous end binding (NHEJ).
[0017] This invention has revealed that CIRC07475 is highly expressed in MLL-R leukemia patients, and confirmed that knocking down CIRC07475 using siRNA technology weakens the proliferation and increases apoptosis in MLL-R leukemia cell lines. Furthermore, NOD-SCID mouse model experiments showed that knocking down CIRC07475 using shRNA inhibits tumor growth in the corresponding MLL-R leukemia cells. These results indicate that knocking down CIRC07475 in MLL-R leukemia cell lines significantly alters cellular DNA damage, confirming that CIRC07475 promotes DNA damage repair. Simultaneously, this invention has found that CIRC07475 directly affects the non-homologous end-joining (NHEJ) process in cells. Further molecular biology experiments confirmed that CIRC07475 influences cellular DNA damage repair by affecting the DNA-PK complex. Therefore, this invention, through genetic engineering to regulate circular RNA and directly induce DNA damage by utilizing the expression level of CIRC07475, has significant value for the precision treatment of MLL-R leukemia. Furthermore, this invention also demonstrates the potential clinical value of CIRC07475 in indicative of the classification and prognosis of MLL-R leukemia.
[0018] Preferably, the MLL fusion gene leukemia cells include MOLM-13.
[0019] Preferably, the reagent used to inhibit or reduce the expression level of the circular RNA gene CIRC07475 is siRNA or shRNA that inhibits or reduces the expression of CIRC07475.
[0020] More preferably, the siRNA is selected from one or more of siRNA-1 or siRNA-2, wherein the siRNA-1 sequence is shown in SEQ ID NO:5-6 and the siRNA-2 sequence is shown in SEQ ID NO:7-8.
[0021] More preferably, the sequence of the shRNA is shown in SEQ ID NO:9-10.
[0022] Preferably, the product for treating MLL fusion gene leukemia is a drug for treating MLL fusion gene leukemia.
[0023] A third aspect of the present invention provides a therapeutic agent for MLL fusion gene leukemia, the agent comprising a reagent that inhibits or reduces the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO:1.
[0024] Preferably, the drug further includes pharmaceutically acceptable excipients.
[0025] More preferably, the excipients are functional pharmaceutical excipients available in the pharmaceutical field, including (but not limited to) surfactants, suspending agents, emulsifiers, and some novel pharmaceutical polymers, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid-polylactic acid copolymer (PLGA), hyaluronic acid, etc.
[0026] Preferably, the dosage form of the drug includes injection, powder, granules, capsules, and tablets.
[0027] Preferably, the method of administration of the drug includes injection or oral administration.
[0028] Compared with the prior art, the beneficial effects of the present invention are:
[0029] Early diagnosis and treatment of MLL-R leukemia still face severe challenges both domestically and internationally, and research on circRNA and NHEJ is currently lacking. This invention is the first to discover and confirm that circRNA CIRC07475 is highly expressed in MLL-R leukemia, indicating its diagnostic and prognostic potential, and holds promise for targeted therapy of MLL fusion gene leukemia. This invention first used qRT-PCR technology to detect a large number of leukemia patient samples, finding that the circular RNA CIRC07475 was significantly highly expressed in MLL-R leukemia patients, while its expression was low under normal physiological conditions and in other types of leukemia, suggesting its potential for diagnostic and prognostic purposes. Simultaneously, in vivo and in vitro experiments confirmed that knocking down CIRC07475 expression significantly inhibited the survival of MLL-R leukemia cells and significantly prolonged the lifespan of model mice. Further investigation into the biological molecular mechanism of CIRC07475 revealed that knocking down CIRC07475 significantly inhibits the efficiency of non-homologous end binding (NHEJ), leading to the accumulation of DNA damage in cancer cells and thus suppressing the development and progression of MLL-R leukemia. This invention holds significant potential for application in the treatment of MLL-R leukemia. Therefore, this invention provides a novel precision treatment strategy and genetic resource for the diagnosis and prognosis of MLL-R leukemia, as well as for targeted therapy of MLL-R leukemia, possessing significant theoretical and practical value. Attached Figure Description
[0030] Figure 1 The purpose of this study was to identify the circular RNA CIRC07475. Specifically, (A) discrete primers were designed, and qRT-PCR and first-generation sequencing were used to accurately identify the BSJ site of CIRC07475; (B) the stability of CIRC07475 was assessed using the Rase R assay; (C) qRT-PCR was used to detect the specific high expression of CIRC07475 in MLL-R leukemia samples (**P<0.01; ***P<0.001); (D) Receiver Operating Characteristic Curve (ROC) was used to differentiate between MLL-R leukemia based on the expression level of CIRC07475; and (E) Log-rank (Mantel-Cox) test analysis showed that high expression of LAMP5-AS1 was associated with a lower leukemia-free survival rate.
[0031] Figure 2To investigate the cellular function of CIRC07475 in MLL-R leukemia cells, the following assays were performed: (A) qRT-PCR was used to detect the knockdown effect of CIRC07475 in the MLL-R leukemia cell line MOLM-13; (B) CCK-8 assay showed that knockdown of CIRC07475 significantly reduced the proliferation level of MLL-R leukemia cells; (C) Flow cytometry showed that knockdown of CIRC07475 significantly enhanced the apoptosis level of MLL-R leukemia cells; (D) Flow cytometry showed that knockdown of CIRC07475 significantly enhanced the differentiation level of MLL-R leukemia cells. All results in this figure are expressed as mean ± standard deviation of three replicates. An asterisk indicates that the difference between the two groups was statistically significant (**P<0.01; ***P<0.001).
[0032] Figure 3 This study established an animal model of MLL-R leukemia regulated by CIRC07475. (A) Flow cytometry was used to detect leukemia cell infiltration; CIRC07475 knockdown significantly reduced infiltration. (B) Survival curves were used to statistically analyze the survival time of mice inoculated with CIRC07475-knocked MOLM-13. All figures use the mean ± standard deviation of three replicates. An asterisk indicates that the difference between the two groups was statistically significant using a t-test (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
[0033] Figure 4 CIRC07475 regulates DNA damage; (A) Western blot analysis showed that knocking down CIRC07475 in MOLM13 cells with siRNA increased the expression of γH2AX, an indicator of DNA damage; (B) Immunofluorescence experiments showed that the number of γH2AX clusters in the three knockdown groups was significantly increased after no ionizing radiation or after 4 h and 24 h of ionizing radiation; (C) Immunofluorescence showed that the number of γH2AX clusters in the overexpression group was significantly reduced. All figures in this figure use the mean ± standard deviation of three replicates. An asterisk indicates that the difference between the two groups was statistically significant (NS, no significant difference) when compared by t-test.
[0034] Figure 5CIRC07475 regulates non-homologous end linkages; (A) proteins binding to CIRC07475 were identified using tRSA pull-down assays, silver staining, and mass spectrometry; (B) Western blot analysis verified the interaction between CIRC07475 and NHEJ-related proteins; (C) RIP assays were used to reversely verify the interaction between CIRC07475 and NHEJ-related proteins; (D) Western blot analysis showed that knockdown of CIRC07475 weakened NHEJ complex interactions; (E) Western blot analysis showed that overexpression of CIRC07475 enhanced NHEJ complex interactions. Detailed Implementation
[0035] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the experimental materials used in the following examples are all available through conventional commercial channels; the primer sequences used were all synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd.
[0037] Example 1: Identification, expression analysis and clinical value assessment of CIRC07475
[0038] This invention discovered a lncRNA that is specifically highly expressed in MLL-R leukemia but lowly expressed under normal physiological conditions and in other types of leukemia, and named it CIRC07475. Figure 1 The gene locus of CIRC07475 is located on the positive strand of human chromosome 17, covering a range from 30,788,269 bp to 30,788,663 bp. CIRC07475 is identified as a 394 nt intronic circular RNA, and its nucleotide sequence and back-splicing junction site (BSJ) are shown below:
[0039] CIRC07475 gene sequence (394bp, SEQ ID NO: 1):
[0040] >CIRC07475 17:30788264-30788663
[0041] GTGAGCCGATTGTGCCATTGCATTCCAGCCTGGGCAACAGAATGAGACTTTGTCTCAAAAAAAAAAAAAGAAAAGAAAAGAAAAGAAAGAAGGAAACCTTAAAAAAAAATCAGAAAATCTTAGAAGCAAGGAAAGAGCAGGAATGTTCACATAGGAAGTGAGGGAGACCTGGAAGGAGGGGGTTGCTAGCAGACCTGG GCATCTAATGAGAGTGGGTCTAGAGACTGTTAAAATCCAGCCAGTATCACAGGTTTCTCTGGCTTCAGCAGCTCCAAGCCTTCCAGAAGCTTCAGCAGGGACTGACTGGGATAAATAACAAAGTAGTGCCTTCTTTTTTTTTTTTTTTTTTTTTTTTGAGACAGCATCTCACTCTGTTGCCCCGGCTAGAGTACA.
[0042] The trans-splicing site of CIRC07475 (SEQ ID NO: 2):
[0043] TAGAGTACA GTGAGC (The underlined part is the reverse linking of circular RNA).
[0044] To further determine the expression specificity of CIRC07475 in MLL-R leukemia, this embodiment re-collected a batch of bone marrow samples from patients at the First Affiliated Hospital of Sun Yat-sen University for analysis. These included 97 samples from MLL wild-type (MLL-wt) leukemia and 45 samples from MLL-R leukemia. All sample collection was approved by the Ethics Committee of Sun Yat-sen University and informed consent was obtained from the patients. RNA was extracted and qRT-PCR was used to specifically detect CIRC07475. The qRT-PCR primers used in this process are as follows:
[0045] qRT-PCR forward primer sequence: 5'CCCCGGCTAGAGTACAGTGAG 3' (SEQ ID NO: 3);
[0046] qRT-PCR reverse primer sequence: 5'CAGGTCTCCCTCACTTCCTATG 3' (SEQ ID NO: 4).
[0047] First, the accuracy of the circular RNA CIRC07475 was determined. Discrete primers (SEQ ID NO: 3-4) were designed, and the BSJ site of CIRC07475 was accurately identified using qRT-PCR and first-generation sequencing (see [link to qRT-PCR]). Figure 1 A); In addition, the stability of CIRC07475 was identified using the Rase R assay; qRT-PCR was used to detect the stability of CIRC07475 under Rase R treatment. Figure 1 B). ROC curve analysis revealed that CIRC07475 was significantly highly expressed in MLL-R leukemia compared to MLL wild-type leukemia samples (p<0.001). Figure 1 C). This indicates that CIRC07475 has the potential to differentiate between MLL-R leukemia and MLL-wt leukemia. Figure 1 D); Simultaneously, Log-rank (Mantel-Cox) test analysis revealed that high expression of CIRC07475 is a risk factor for leukemia and a potential target for leukemia treatment. Figure 1 E).
[0048] Example 2: Functional identification of CIRC07475 in MLL-R leukemia
[0049] To address the core issue of CIRC07475's role in the regulation of MLL-R leukemia, this study aims to further investigate the function of CIRC07475 in MLL-R leukemia. Therefore, the MLL-R leukemia cell line MOLM13 was selected as the research subject. Two different siRNA sequences were designed for CIRC07475 using siRNA interference technology, as shown below:
[0050] The forward sequence of siRNA-1: 5'AGAGUACAGUGAGCCGAU dTdT 3' (SEQ ID NO:5);
[0051] The reverse sequence of siRNA-1: 3'dTdT AUCGGCUCACUGUACUCU 5' (SEQ ID NO:6);
[0052] The forward sequence of siRNA-2: 5'AGUACAGUGAGCCGAUGU dTdT 3' (SEQ ID NO:7);
[0053] The reverse sequence of siRNA-2: 3'dTdT ACAUCGGCUCACUGUACU 5' (SEQ ID NO:8).
[0054] In the MLL-R leukemia cell line, knocking out CIRC07475 ( Figure 2 A) Cell proliferation was detected using the CCK-8 assay. The experimental results are as follows: Figure 2 As shown in Figure B, cell proliferation was significantly reduced upon knockdown of CIRC07475. This indicates that CIRC07475 also plays an important role in maintaining the proliferation of MLL-R leukemia cells. Simultaneously, CIRC07475 was knocked down using siRNA interference technology, and then apoptosis and differentiation were detected by flow cytometry. The experimental results are as follows... Figure 2 As shown in C and 2D, knockdown of CIRC07475 significantly increased the apoptosis rate and enhanced differentiation. Therefore, based on cell proliferation, apoptosis, and differentiation experiments, we hypothesize that CIRC07475 has a potential regulatory role in the development and progression of MLL-R leukemia.
[0055] Next, the regulatory role of CIRC07475 in MLL-R leukemia was further verified at the adult level. Using the same siRNA sequence described above, the shRNA sequence for CIRC07475 was designed as follows:
[0056] Forward sequence of shRNA: 5'GATCCAGAGTACAGTGAGCCGATTCTTCCTGTCAGAAATCGGCTCACTGTACTCTTTTTTG 3' (SEQ ID NO:9);
[0057] The reverse sequence of shRNA is: 5'AATTCAAAAAAGAGTACAGTGAGCCGATTTCTGACAGGAAGAATCGGCTCACTGTACTCTG 3' (SEQ ID NO:10).
[0058] Using the expression vector pGreenPuro from System Biosciences TM A stable expression line knocking out CIRC07475 was constructed using the shRNA Cloning and Expression Vector lentiviral expression system, and the MOLM13 CIRC07475 knockout cell line was obtained through puromycin selection. Subsequently, the validated stable MOLM13 CIRC07475 cell line was expanded and cultured, and then injected into 5-week-old NOD-SCID mice via tail vein injection: 20 mice in each of the two groups (sh-NC and sh-CIRC07475), with 10 mice in each group (each mouse was injected with 1×10⁻⁶ cells). 6Cells were resuspended in 150 μL of PBS and inoculated for 3 weeks to explore the infiltration ability of CIRC07475 into mouse organs. Log-rank (Mantel-Cox) survival curve analysis revealed that the survival rate of mice with CIRC07475 knockdown was higher than that of the control group. Figure 3 B). Flow cytometry analysis revealed that knockdown of CIRC07475 significantly reduced cell infiltration in peripheral blood, spleen, liver, and bone marrow. Figure 3 A); Furthermore, knockdown of CIRC07475 in mice enhanced MOLM13 cell differentiation. This suggests that specifically targeting the highly expressed CIRC07475 may be a potential strategy for treating MLL-R leukemia.
[0059] Example 3: CIRC07475 regulates DNA damage
[0060] Both cellular and in vitro mouse experiments have confirmed that CIRC07475 significantly affects the function of MLL fusion gene leukemia cells. So, how does this circRNA regulate MLL-R leukemia? To investigate this question, this study used CIRC07475 to pull down MOLM13 cells, followed by silver staining in a Western blot experiment, and then proteomic analysis of specific bands. Mass spectrometry results revealed numerous proteins related to DNA damage repair, suggesting that CIRC07475 plays a role in regulating DNA damage. Furthermore, knockdown of CIRC07475 using siRNA (siRNA-1 and siRNA-2) sequences showed a significant accumulation of intracellular DNA damage using confocal microscopy and Western blot analysis. Figure 4 A and B); after overexpressing the CIRC07475 sequence using the pCDH-CMV-MCS-EF1-Puro(CD510B-1) vector, confocal microscopy revealed a significant reduction in intracellular DNA damage levels. Figure 4 C). The above results indicate that CIRC07475 plays an important role in the DNA damage repair process in MLL-R leukemia.
[0061] Example 4: CIRC07475 regulation of non-homologous end connections
[0062] To further investigate the mechanism by which CIRC07475 regulates MLL-R leukemia, this embodiment utilizes RNA pull-down combined with proteomic proteomic analysis to identify that CIRC07475 can bind closely to members of the NHEJ complex. Figure 5A, B, and C). Knockdown of CIRC07475 using siRNA (siRNA-1 and siRNA-2) or overexpression of CIRC07475 using the pCDH-CMV-MCS-EF1-Puro (CD510B-1) vector significantly affected the binding ability between members of the NHEJ complex. Figure 5 (D and E). The above results indicate that CIRC07475 maintains the stability of MLL-R leukemia by regulating the formation of the NHEJ complex and affecting the DNA damage repair process. These results also demonstrate that the circular RNA CIRC07475 is an important target in MLL-R leukemia. Targeting CIRC07475 can significantly inhibit the DNA damage repair capacity of MLL-R leukemia cells, thereby suppressing its occurrence and development, and has significant application value in the treatment of MLL-R leukemia.
[0063] In summary, this invention is the first to discover and demonstrate that circRNA CIRC07475 is highly expressed in MLL-R leukemia, and can be used to indicate the diagnosis and prognosis of this disease. It also demonstrates that knocking down CIRC07475 expression significantly affects the efficiency of non-homologous end (NHEJ) repair in MLL-R leukemia cells and improves the survival rate of this disease. Furthermore, this invention elucidates that CIRC07475 can regulate the NHEJ repair process in cells; knocking down CIRC07475 significantly inhibits the efficiency of NHEJ binding, leading to the accumulation of DNA damage in cancer cells, thereby inhibiting the occurrence and development of MLL-R leukemia. These findings provide a new theoretical basis for developing drug targets for MLL-R leukemia.
[0064] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.
Claims
1. Application of reagents for detecting the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO:1 in the preparation of diagnostic products for MLL fusion gene leukemia.
2. The application according to claim 1, characterized in that, The reagents for detecting the expression level of the circular RNA gene CIRC07475 are primers for detecting the expression level of CIRC07475, and their sequences are shown in SEQ ID NO:3-4.
3. The use of a reagent that inhibits or reduces the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO:1 in the preparation of a product for treating MLL fusion gene leukemia, characterized in that, The reagent used to inhibit or reduce the expression level of the circular RNA gene CIRC07475 is an siRNA or shRNA that inhibits or reduces the expression of CIRC07475; the siRNA is selected from one or more of siRNA-1 or siRNA-2, the siRNA-1 sequence is shown in SEQ ID NO:5-6, the siRNA-2 sequence is shown in SEQ ID NO:7-8, and the shRNA sequence is shown in SEQ ID NO:9-10.
4. The application according to claim 3, characterized in that, The inhibition or reduction of the expression level of the circular RNA gene CIRC07475 shown in SEQ ID NO:1 is to inhibit the occurrence and development of MLL fusion gene leukemia, or to inhibit the proliferation of MLL fusion gene leukemia cells.
5. The application according to claim 4, characterized in that, The inhibition of MLL fusion gene leukemia development is described as inhibiting the DNA damage repair ability of MLL fusion gene leukemia cells.
6. The application according to claim 5, characterized in that, The ability to inhibit DNA damage repair in MLL fusion gene leukemia cells is defined as the efficiency of inhibiting non-homologous end-joining NHEJ.
7. The application according to claim 4, characterized in that, The MLL fusion gene leukemia cells include MOLM-13.
8. A therapeutic agent for MLL fusion gene leukemia, characterized in that, The drug comprises a reagent that inhibits or reduces the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO:1; the reagent that inhibits or reduces the expression level of the circular RNA gene CIRC07475 is an siRNA or shRNA that inhibits or reduces the expression of CIRC07475; the siRNA is selected from one or more of siRNA-1 or siRNA-2, the siRNA-1 sequence is shown in SEQ ID NO:5-6, the siRNA-2 sequence is shown in SEQ ID NO:7-8; the shRNA sequence is shown in SEQ ID NO:9-10.
Citation Information
Patent Citations
Application of long-chain non-coding RNA LAMP5-AS1 to MLL-R leukemia
CN111733237A
NOVEL FUSION-CIRCULAR RNAs AND USES THEREOF
US20170298347A1