Molecular marker for identifying corn with improved resistance to stalk rot and method of identification

Abstract

The present application relates to the field of corn molecular breeding and biotechnology, and in particular to a molecular marker for identifying corn with improved resistance to stalk rot and a method for identification. The present application uses a high-generation RIL population to identify resistance to stalk rot in multiple environments, combined with a high-density genetic linkage map and fine mapping, to excavate two SNP sites on chromosome 8 of corn. Using the molecular marker information provided by the present application, the disease-resistant site can be efficiently and quickly introduced into other susceptible materials to produce corn germplasm resistant to stalk rot, and the genotype of the corn material to be tested can also be accurately identified at high throughput to screen out materials resistant to stalk rot.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular breeding and biotechnology of corn, and specifically relates to a molecular marker for identifying corn with improved resistance to stalk rot and a method for identifying the same. BACKGROUND

[0002] Due to the fact that corn stalk rot is greatly affected by pathogenic bacteria, environment and genotype, and it is difficult to find a high and multi-resistant resistance source, corn stalk rot is becoming more and more serious. At present, most of the resistance loci located have low effects, and few disease resistance genes have been cloned. Further mining of corn stalk rot resistance QTL and disease resistance genes and development of molecular markers closely linked to the QTL will provide strong support for the molecular breeding of stalk rot resistance and the aggregation of multiple resistance genes, and it is expected to improve the resistance of corn to stalk rot. KASP markers do not need to be typed according to the size of DNA fragments, and can get rid of the traditional gel electrophoresis which is relatively cumbersome, low-throughput and expensive, and is more suitable for the high-throughput molecular detection platform currently rapidly developed. Therefore, the development of low-cost KASP molecular markers linked to corn resistance to Fusarium graminearum stalk rot QTL suitable for high-throughput molecular detection platform has important significance for popularizing the application of molecular marker technology and improving the breeding efficiency and level of corn resistance to stalk rot. SUMMARY

[0003] The technical problem to be solved by the present application is how to provide a molecular marker for identifying corn with improved resistance to stalk rot and a method for identifying the same. The technical problem to be solved is not limited to the technical subject described, and other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.

[0004] To solve the above technical problems, the present application provides the following technical solutions:

[0005] The present application provides a method for identifying or assisting in identifying the resistance of corn to stalk rot, which is any of the following:

[0006] M1, the method comprises detecting the genotypes of SNP1 site and SNP2 site in the genome of the corn to be tested, and identifying or assisting in identifying the resistance of corn to stalk rot according to the genotypes, the SNP1 site is a site on chromosome 8 of corn, the nucleotide species of which is C or T, which is the 50th nucleotide of SEQ ID No. 9 in the sequence listing; the SNP2 is a site on chromosome 8 of corn, the nucleotide species of which is A or G, which is the 50th nucleotide of SEQ ID No. 16 in the sequence listing;

[0007] M2, the method comprises detecting the genotype of the SNP1 site in the genome of the corn to be tested, and identifying or assisting in identifying the resistance of corn to stalk rot according to the genotype;

[0008] M3, the method comprises detecting the genotype of the SNP2 site in the genome of the corn to be tested, and identifying or assisting in identifying the resistance of corn stalk rot according to the genotype.

[0009] The SNP1 is located on chromosome 8 of corn, that is, the 169887059th position of B73 RefGen_V3 (https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3). The SNP2 is located on chromosome 8 of corn, that is, the 172364072th position of B73 RefGen_V3 (https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3).

[0010] Further, the molecular marker Ksll is a nucleotide sequence containing a polymorphism of C / T at position 60 of the sequence shown in SEQ ID No. 10; the molecular marker Ksl3 is a nucleotide sequence containing a polymorphism of A / G at position 60 of the sequence shown in SEQ ID No. 17. Further, the molecular marker Ksll is a nucleotide sequence containing a polymorphism of C / T at position 70 of the sequence shown in SEQ ID No. 11; the molecular marker Ksl3 is a nucleotide sequence containing a polymorphism of A / G at position 70 of the sequence shown in SEQ ID No. 18. Further, the molecular marker Ksll is a nucleotide sequence containing a polymorphism of C / T at position 80 of the sequence shown in SEQ ID No. 12; the molecular marker Ksl3 is a nucleotide sequence containing a polymorphism of A / G at position 80 of the sequence shown in SEQ ID No. 19. Further, the molecular marker Ksll is a nucleotide sequence containing a polymorphism of C / T at position 90 of the sequence shown in SEQ ID No. 13; the molecular marker Ksl3 is a nucleotide sequence containing a polymorphism of A / G at position 90 of the sequence shown in SEQ ID No. 20. Further, the molecular marker Ksll is a nucleotide sequence containing a polymorphism of C / T at position 100 of the sequence shown in SEQ ID No. 14; the molecular marker Ksl3 is a nucleotide sequence containing a polymorphism of A / G at position 100 of the sequence shown in SEQ ID No. 21. Further, the molecular marker Ksll is a nucleotide sequence containing a polymorphism of C / T at position 150 of the sequence shown in SEQ ID No. 15; the molecular marker Ksl3 is a nucleotide sequence containing a polymorphism of A / G at position 150 of the sequence shown in SEQ ID No. 22. Further, the molecular marker Ksll is a nucleotide sequence containing a polymorphism of C / T at position 200 of the sequence shown in SEQ ID No. 7; the molecular marker Ksl3 is a nucleotide sequence containing a polymorphism of A / G at position 202 of the sequence shown in SEQ ID No. 8.

[0011] The skilled in the art knows that SEQ ID No. 7 is the nucleotide sequence of SNP1 site (200th nucleotide) and its vicinity, and the number of nucleotide sequences in the vicinity of the SNP site shall not be regarded as a limiting factor of the protection scope of the present application, which can be 50bp, 60bp, 70bp, 80bp, 90bp, 100bp, 120bp, 150bp, 180bp, 250bp, 300bp, 500bp, 1000bp before and after the SNP site, or other arbitrary values, which functions to assist in locating the position of the SNP on chromosome 8 of the corn genome. The same applies to SEQ ID No. 8 or SNP2.

[0012] As used herein, the terms "front" and "back" shall be defined as front or back in the direction recognized by those skilled in the art, such as 5'-3' direction.

[0013] In the above M1 method, according to the genotyping or assisted genotyping of the corn stalk rot resistance, the corn to be tested with the genotype CCAA of the SNP site has higher stalk rot resistance than the corn to be tested with the genotype CCGG or TTGG of the SNP site, the corn to be tested with the genotype CCGG of the SNP site has higher stalk rot resistance than the corn to be tested with the genotype TTGG of the SNP site; the genotype CCAA of the SNP site is the homozygous type of C at the SNP1 site and the homozygous type of A at the SNP2 site, the genotype CCGG of the SNP site is the homozygous type of C at the SNP1 site and the homozygous type of G at the SNP2 site, and the genotype TTGG of the SNP site is the homozygous type of T at the SNP1 site and the homozygous type of G at the SNP2 site.

[0014] In the above method, the chromosome of the corn to be tested comprises a DNA fragment which is a nucleic acid sequence identical to the sequence shown in SEQ ID No. 9 at least 85%, at least 90% or at least 95%, or / and comprises a sequence identical to the sequence shown in SEQ ID No. 16 at least 85%, at least 90% or at least 95%.

[0015] The present application also provides a method for breeding corn, which is any one of the following:

[0016] H1, the method comprises detecting the genotype of corn, and selecting corn with the genotype CCAA as a parent for breeding, wherein the CCAA is the homozygous type of C at the aforementioned SNP1 site and the homozygous type of A at the aforementioned SNP2 site;

[0017] H2, the method comprises detecting the genotype of corn, and selecting corn with the genotype CC as a parent for breeding, wherein the CC is the homozygous type of C at the aforementioned SNP1 site;

[0018] H3, the method comprises detecting the genotype of corn, and selecting corn with the genotype AA as a parent for breeding, wherein the AA is the homozygous type of A at the aforementioned SNP2 site.

[0019] The breeding purpose of the method includes breeding corn with stalk rot resistance.

[0020] In the above application and method, the substance for detecting the polymorphism or genotype of the SNP1 and SNP2 can be determined by at least one of the following methods: DNA sequencing, restriction enzyme digestion fragment length polymorphism, single strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. The SNP chip includes chip based on nucleic acid hybridization reaction, chip based on single base extension reaction, chip based on allele specific primer extension reaction, chip based on "one-step" reaction, chip based on primer ligation reaction, chip based on restriction enzyme reaction, chip based on protein DNA binding reaction, and chip based on fluorescence molecule DNA binding reaction.

[0021] The present application also provides any one of the following applications of the substance for detecting the polymorphism or genotype of the SNP site in the corn genome:

[0022] A1) identifying or assisting in identifying the resistance to corn stalk rot;

[0023] A2) screening or selecting corn lines or strains or varieties resistant to stalk rot;

[0024] A3) screening or selecting corn lines or strains or varieties susceptible to stalk rot;

[0025] A4) corn breeding;

[0026] A5) preparing a product for identifying or assisting in identifying the resistance to corn stalk rot;

[0027] A6) preparing a product for screening or selecting corn lines or strains or varieties resistant to stalk rot;

[0028] A7) preparing a product for screening or selecting corn lines or strains or varieties susceptible to stalk rot;

[0029] A8) preparing a product for corn breeding.

[0030] The SNP site is any one of the following:

[0031] P1, the SNP site is the SNP1 site and the SNP2 site, the SNP1 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No. 9 in the sequence listing, which is C or T; the SNP2 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No. 16 in the sequence listing, which is A or G;

[0032] P2, the SNP site is the SNP1 site;

[0033] P3, the SNP site is the SNP2 site.

[0034] The present application also provides use of the aforementioned substance or the aforementioned method in corn breeding.

[0035] The present application also provides a product for detecting polymorphism or genotype of SNP site in corn genome, which is the aforementioned substance, and which is any one of:

[0036] C1) a product for detecting SNP site polymorphism or genotype related to corn stalk rot resistance;

[0037] C2) a product for identifying or assisting in identifying corn stalk rot resistance;

[0038] C3) a product for corn breeding;

[0039] C4) a product for screening or selecting corn lines or strains or varieties resistant to corn stalk rot;

[0040] C5) a product for screening or selecting corn lines or strains or varieties susceptible to corn stalk rot.

[0041] In the above products, the substance is as follows D1), D2) or D3):

[0042] D1) the substance is a primer composition for amplifying a corn genomic DNA fragment comprising the SNP site;

[0043] D2) the substance is a PCR reagent containing the primer composition of D1);

[0044] D3) the substance is a kit containing the primer composition of D1) or the PCR reagent of D2).

[0045] In the above applications and methods, the PCR primers can or can not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as32P; binding moieties such as biotin; haptens such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with nucleic acid or protein sequences, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is detected directly without a label (e.g., the sequence is read directly). In the above applications and methods, the product can be a reagent or kit or system, which can include a combination of reagents or kits, instruments, and analysis software, such as a product consisting of PCR primers, a PARMS master mix reagent, a microplate reader, and an online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), a combination product consisting of PCR primers, a PARMS master mix reagent, an online software SNP decoder, and a real-time PCR instrument. The product can include the above-described materials for detecting the polymorphism or genotype of SNP1, SNP2, and / or SNP3 sites in the maize genome.

[0046] In the foregoing applications or products, the primer composition is F1-1, F1-2, F2-1, and / or F2-2:

[0047] F1-1, a primer set consisting of a single-stranded DNA represented by SEQ ID No. 1 in the sequence listing, a single-stranded DNA represented by SEQ ID No. 2 in the sequence listing, and a single-stranded DNA represented by SEQ ID No. 3 in the sequence listing;

[0048] F1-2, a primer set consisting of a single-stranded DNA in which the nucleotide sequence is from the 176th to 200th position of SEQ ID No. 7 in the sequence listing and the 200th position is T, a single-stranded DNA in which the nucleotide sequence is from the 178th to 200th position of SEQ ID No. 7 in the sequence listing and the 200th position is C, and a single-stranded DNA represented by the bases from the 219th to 244th position of SEQ ID No. 7 in the sequence listing;

[0049] F2-1, a primer set consisting of a single-stranded DNA represented by SEQ ID No. 4 in the sequence listing, a single-stranded DNA represented by SEQ ID No. 5 in the sequence listing, and a single-stranded DNA represented by SEQ ID No. 6 in the sequence listing;

[0050] F2-2, a primer set consisting of a single-stranded DNA whose nucleotide sequence is from position 181 to position 202 of SEQ ID No. 8 in the sequence listing and the position 202 is A, a single-stranded DNA whose nucleotide sequence is from position 182 to position 202 of SEQ ID No. 8 in the sequence listing and the position 202 is G, and a single-stranded DNA represented by bases from position 278 to position 305 of SEQ ID No. 8 in the sequence listing.

[0051] The present application provides the aforementioned product for use in corn breeding.

[0052] The aforementioned DNA molecule is any one of the following:

[0053] B1) a DNA molecule whose nucleotide sequence is SEQ ID No. 7 in the sequence listing or from position 176 to position 244 of SEQ ID No. 7 or from position 178 to position 244 of SEQ ID No. 7;

[0054] B2) a DNA molecule whose nucleotide sequence is SEQ ID No. 8 in the sequence listing or from position 181 to position 305 of SEQ ID No. 8 or from position 182 to position 305 of SEQ ID No. 8;

[0055] B3) a composition consisting of D1) and D2).

[0056] The aforementioned DNA molecule is for use in any one of the following:

[0057] A1) identifying or assisting in identifying corn resistance to stalk rot;

[0058] A2) screening or breeding corn lines or strains or varieties resistant to stalk rot;

[0059] A3) screening or breeding corn lines or strains or varieties susceptible to stalk rot;

[0060] A4) corn breeding;

[0061] A5) preparing a product for identifying or assisting in identifying corn resistance to stalk rot;

[0062] A6) preparing a product for screening or breeding corn lines or strains or varieties resistant to corn stalk rot;

[0063] A7) preparing a product for screening or breeding corn lines or strains or varieties susceptible to corn stalk rot;

[0064] A8) preparing a product of corn breeding.

[0065] The SNP sites provided by the present application can be used for identifying or assisting in identifying the resistance to corn stalk rot or for corn breeding. In breeding of corns resistant to stalk rot, corns with the genotype CC at the SNP1 site and AA at the SNP2 site, or corns with the genotype CC at the SNP1 site or AA at the SNP2 site are preferably selected as parents for breeding. BRIEF DESCRIPTION OF DRAWINGS

[0066] Figure 1 Fig. 1 is the stalk rot disease performance of the parental inbred lines KA105 and KB204; (A) the field phenotype of the parental inbred lines for stalk rot disease; (B) the disease rating of the parental inbred lines in four environments. “***” indicates significant at the level of 0.001.

[0067] Figure 2 Fig. 2 is a diagram of the QTL mapping results of the stalk rot disease rating under the conditions of single environment and multiple environments combined analysis. The lines represent the QTL mapping results of the 8th chromosome of corn for the stalk rot disease rating in different environments; the X axis represents the genetic map position, in cM; the Y axis represents the LOD value. In the analysis of the additive effect of the QTL, the lines represent the additive effect values exhibited by different QTLs; the X axis represents the genetic map position, in cM; the Y axis represents the additive effect value, with positive and negative values representing the direction of action.

[0068] Figure 3 Fig. 3 is the effect verification and fine mapping of the target QTL; (A) QTL effect verification; (B) QTL fine mapping; (C) DSI distribution of the offspring after segregation of the heterozygous single plant. If there is a significant difference (P < 0.05) in DSI between the two genotypes, it is inferred that the parental recombinant individual carries the disease resistance gene, represented by R; on the contrary, if there is no significant difference (P > 0.05) between the two genotypes, it is inferred that the parental recombinant individual does not carry the disease resistance gene, represented by S. The black rectangle represents a segment of pure homozygous disease-resistant allele; the white rectangle represents a segment of pure homozygous disease-susceptible allele; the gray rectangle represents a segment of heterozygous allele. The column chart represents the DSI distribution of plants of different genotypes. “**” indicates P < 0.01, and “***” indicates P < 0.001. DETAILED DESCRIPTION

[0069] The present application will be further described in detail below in conjunction with the specific embodiments. The examples given are only for the purpose of illustrating the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application.

[0070] Fusarium graminearum: recorded in the non-patent literature "Li Yaling, Long Shusheng, Ma Bingyuan. Comparison of culture characteristics of Fusarium graminearum [J]. Shaanxi Agricultural Science. 1989(4): 36-37", which can be obtained from Northwest A&F University, and the biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes. Disease-resistant parent inbred line KA105 (abbreviated as KA105): recorded in the non-patent literature "Wang Boxin, Wang Yahui, Chen Pengfei, Liu Xudongyu, Feng Zhiquan, Hao Yinchuan, Zhang Renhe, Zhang Xinghua, Xue Jiquan. Combining ability analysis of maize inbred lines derived from Shaan A group and Shaan B group under different density conditions [J]. Crop Science. 2017, 43(9): 1328-1336", which can be obtained from Northwest A&F University, and the biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes. Disease-susceptible parent inbred line KB204 (abbreviated as KB204): recorded in the non-patent literature "Tian Xiaokang. Evaluation and correlation analysis of disease resistance of maize inbred lines from Shaan A group and Shaan B group [D]. Northwest A&F University. 2020", which can be obtained from Northwest A&F University, and the biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes. RIL family: the recombinant inbred line is derived from the cross of the disease-resistant inbred line KA105 and the disease-susceptible inbred line KB204 to produce a F2 population, which is continuously selfed to F7-8 generation by single-seed descent to form a F 7:8 Recombinant inbred line (RIL) population, a total of 240 copies.

[0071] Population 1 (Pop. 1): including disease-resistant inbred line KA105, disease-susceptible inbred line KB204 and RIL family. The specific information is as follows:

[0072] Table 1 RIL family (240 copies)

[0073]

[0074]

[0075] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0076] The following examples use Statistics Analysis System (SAS) 9.2 statistical software to process data, and the experimental results are expressed by BLUP values. One-way ANOVA test is used, P < 0.05 (*) indicates significant difference, P < 0.01 (**) and P < 0.001 (***) indicate extremely significant difference.

[0077] Example 1, Mining of SNP for detecting corn stalk rot

[0078] 1. QTL mapping of Fusarium graminearum stalk rot resistance in maize

[0079] Method:

[0080] (1) Trait investigation

[0081] After inoculation of Fusarium graminearum for 50-55 days, the occurrence of corn stalk rot in the field was identified by the split stem method. The stem was split longitudinally, and the pathogen infection and the degree of pith tissue necrosis at the root and stem base were observed. Disease rating scale (DRS) was used for stalk rot phenotype identification, which was divided into 5 grades:

[0082] Grade 1: highly resistant, normal plant, no obvious disease;

[0083] Grade 3: resistant, normal stem surface, brown lesions at the tip of the stem;

[0084] Grade 5: moderately resistant, soft and faded stem base, obvious water spots; the first and second internodes of the stem base were shriveled and decomposed, with brown lesions;

[0085] Grade 7: susceptible, the lower stem nodes gradually changed from green to brown, the stem was soft and severely dehydrated, the internal pith tissue was decomposed into filaments, severely atrophied, and the stem nodes appeared white or pinkish-red mycelium; the root system was soft, dry and sparse, but not lodging; the ear began to droop;

[0086] Grade 9: highly susceptible, hollow and constricted stem, only necrotic vascular bundle tissue remained in the stem, the stem nodes and internodes were black with pink marks; the root system was sparse, rotten and hollow, the plant was lodged or lodged; the female ear bract was dry and loose, and the female ear was drooping.

[0087] Ten plants with uniform growth vigor were selected from each family, and the stem rot disease grade was observed and recorded one by one. The average value was taken as the phenotype value of each family. The average value of the disease grade of a single family was used to calculate the BLUP value representing the multi-environment combined analysis phenotype value of the family. Among them, the BLUP value of the disease grade between 1-2 is highly resistant; 2.01-3 is resistant; 3.01-5 is moderately resistant; 5.01-7 is susceptible; 7.01-9 is highly susceptible. The number of days from sowing to 50% of the plants shedding pollen was investigated and recorded.

[0088] (2) Phenotype data analysis

[0089] In order to evaluate the significance of genotype, environmental variance and the interaction between the two, the variance components were calculated using the "PROC MIXED" program in SAS (V9.2) software, and the mixed linear model was: y = μ + gi + ej + ε, where μ represents the total mean of the phenotype, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype as a fixed effect, flowering period as a covariate, environment, intra-environment repetition, genotype and environment interaction as random effects. The variance analysis result value is used to calculate the broad-sense heritability (H 2 ) of stem rot resistance: where, is the genetic variance, represents the genotype and environment interaction variance, is the error term, n is the number of environments; r is the number of repetitions. In order to eliminate the influence of environmental variation on the phenotype, the best linear unbiased prediction (BLUP) of each family is estimated using the SAS (V9.2) mixed linear model, and the BLUP value is used as the multi-environment combined analysis data to draw the phenotype distribution histogram of each trait, calculate the phenotypic correlation coefficient, and perform multi-environment combined QTL positioning.

[0090] (3) Construction of linkage map

[0091] At the 5-6 leaf stage of maize, 5 uniform and tender leaves from each family were mixed, and genomic DNA was extracted using the conventional CTAB method. Genotyping analysis was performed using the Maize6H-60K chip independently developed by the Maize Research Center of Beijing Academy of Agriculture and Forestry Sciences. The linkage map was constructed using QTL ICImapping 4.2 software. Finally, 48087 polymorphic SNP markers were obtained, and redundant markers were removed and combined into 7200 bin markers.

[0092] (4) QTL positioning

[0093] Based on the constructed high-density genetic linkage map, combined with the phenotypic values of four stem rot evaluation indexes in RIL population in single environment and multi-environment joint analysis, the QTL of stem rot resistance was detected. The composite interval mapping method (CIM) of Windows QTL Cartographer V2.5 software was used for primary positioning, and LOD = 3 was used as the threshold line. According to the peak value of LOD on both sides, the confidence interval of the target QTL was determined.

[0094] Results: The parental materials were identified for stem rot resistance of F. graminearum in four environments (2019YL, 2019SY, 2020YL and 2020SY) Figure 1 ), and the statistical analysis results showed that the stem rot resistance of the resistant parent KA105 and the susceptible parent KB204 was significantly different (Table 2). The RIL population showed extensive continuous variation among different environments, indicating that the stem rot resistance was a quantitative trait controlled by multiple genes.

[0095] Table 2 Phenotypic distribution of parents and recombinant inbred lines population in multiple environments

[0096]

[0097] Note: 2019YL: Yangling in 2019; 2019SY: Sanyuan in 2019; 2020YL: Yangling in 2020; 2020SY: Sanyuan in 2020; BLUP: joint analysis of multiple environments.

[0098] In the RIL population, the variation range of disease classification was 1–9, the mean was between 2.91–5.43, and the coefficient of variation was 33%–65%. The results of joint variance analysis showed (Table 3) that the difference between genotypes in the RIL population was extremely significant, and the difference between environments and the interaction of genotypes and environments was extremely significant. The genetic variance estimate was greater than the variance estimate of environment and genotype and environment interaction, indicating that the genetic factor was the main source of variation. The heritability of stem rot resistance in Pop.1 population was 81%.

[0099] Table 3 Variance and heritability analysis of stem rot phenotype index in multiple environments

[0100]

[0101] Note: *** represents P<0.001.

[0102] Using the phenotypic data of disease classification in single environment and multi-environment BLUP value joint analysis, the QTL of stem rot resistance of F. graminearum was located. A QTL of corn F. graminearum stem rot resistance was detected on chromosome 8 bin8.08 Figure 2), located between physical positions 168,681,373bp - 173,552,374bp (B73 RefGen_V3), with a confidence interval of about 4.87Mb. The QTL was co-located to (Table 4) with 2020YL and BLUP values. The phenotypic variation explained was 4.42% - 9.24%, and the resistance allele originated from the resistant parent KA105.

[0103] Table 4 QTL analysis of Fusarium virgulforme stem rot disease severity rating under single and multi-environment combined conditions

[0104] Traits Environment Chromosome Left flanking marker Right flanking marker LOD Contribution rate R2 (%) DRS BLUP 8 AX-107940009 AX-107952274 5.80 9.24 DRS 2020YL 8 AX-107940009 AX-107952274 3.13 4.42

[0105] 2. Validation and fine mapping of QTL effect of corn stem rot resistance

[0106] Methods: QTL effect validation and fine mapping were performed by recombination progeny verification. According to the initial QTL mapping results, the remaining heterozygous lines with fixed other background genotypes in the target segment were screened in the RIL population, and KASP markers were developed to screen individuals with exchanges in the target segment. Key recombinant individuals were verified for effect and fine mapping by genotyping and stem rot phenotype of their offspring. The genotypes and stem rot disease severity of the offspring of single recombinant plant were identified, and the disease severity index (DSI) of each genotype was calculated. The difference in corn stem rot resistance between the three genotypes was tested by one-tailed t test. If the difference between different genotypes was significant (P<0.05), it indicated that the heterozygous region carried a resistance site, and vice versa.

[0107] DSI (%) =∑(disease severity rating x number of corresponding rating) x 100 / (maximum value of disease severity rating x total number of plants)

[0108] Results:

[0109] (1) The remaining heterozygous line material 638RIL-31 was screened in Pop.1 population for effect verification and fine mapping of the target QTL. Molecular markers were developed in the target interval (Table 5), and recombinant individuals with exchanges only in the candidate segment of the QTL were screened. Effect verification of the resistance QTL showed that the homozygous allele from the resistant parent could significantly improve the field resistance to stem rot (P<0.001) Figure 3The average DSI of plants with homozygous resistant KA105 / KA105 genotype was 23.15% in 2021, and the average DSI of plants with homozygous susceptible KB204 / KB204 genotype was 44.73%. In 2022, the average DSI of plants with homozygous KA105 genotype in Yangling was 49.88%, and the average DSI of plants with homozygous KB204 genotype was 65.08%. The t-test results showed that there was a very significant difference in DSI between the two genotypes (P<0.001). In summary, the QTL effect of resistance was detected by using the segregation population generated by the remaining heterozygous line 638RIL-31, and the results of two years of experiments reached a very significant difference, indicating that the genetic effect of the QTL exists stably, and the allele derived from KA105 can stably reduce the DSI by 15.2-21.58%, significantly improving the field resistance of plants to F. graminearum stem rot.

[0110] (2) In the candidate interval of the target QTL, molecular markers were added to design molecular marker primers with the maize B73 reference genome V3 version sequence as the reference, and the molecular markers Ks11 and Ks13 at both ends of the candidate interval. Ks11 is located at position 169887059 of chromosome 8 of maize, which is named SNP1. The SNP site and the total nucleotide sequence of 401 bp of the 201 bp bases before and 199 bp bases after (i.e. the 169886857-169887257 bases of chromosome 8 of maize) are as follows, and the reverse complement sequence thereof is shown in SEQ ID No. 7 in the sequence table. The 200th base in SEQ ID No. 7 is the SNP site, which is the 169887059th base of B73 RefGen_V3 (https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3), which is a C / T polymorphism. In SEQ ID No. 7, Y is C or T, and the genotype of the SNP site has the following three types: CC, TC or TT. The CC is the homozygous type of the SNP site as C, the TT is the homozygous type of the SNP site as T, and the TC is the heterozygous type of the SNP site as C and T. The stem rot resistance of corn varieties with the SNP site genotype CC is significantly higher than that of corn varieties with the SNP site genotype TT or TC.

[0111] Ks13, located at the 172364072th position of the 8th chromosome of maize, is named SNP2, the nucleotide of the SNP site and its vicinity is shown in SEQ ID No. 8 of the sequence table, wherein the base at the 202th position is the SNP site, that is, the 172364072th base of B73RefGen_V3 (https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3), is A / G polymorphism. In SEQ ID No. 8, R is A or G, and the genotype of the SNP site has the following three types: AA, AG or GG. The AA is the homozygous type of the SNP site as A, the GG is the homozygous type of the SNP site as G, and the AG is the heterozygous type of the SNP site as A and G. The stem rot resistance of the corn variety with the SNP site genotype AA is significantly higher than that of the corn variety with the SNP site genotype GG or AG.

[0112] (3) The 638RIL-31 hybrid offspring is divided into three recombination types by using Ks11 and Ks13. The fine mapping results show that the DSI difference between the KA105 / KA105 homozygous genotype plants and the KB204 / KB204 genotype plants in type II is not significant (P>0.05) Figure 3 B), and the DSI difference between the KA105 homozygous genotype plants and the KB204 homozygous genotype plants in types I, III and IV is significant (P<0.01), so it is judged that the KA105 donor fragment in the type I, III and IV hybrid segments carries the stem rot resistance QTL of Fusarium graminearum, and according to the hybrid segment of the two types of overlap, it can be judged that the target QTL is mainly located between markers Ks11 and Ks13, with a physical distance of about 2.48 Mb (B73 RefGen_V3). Among them, the DSI difference between the homozygous resistant genotype plants and the homozygous susceptible genotype plants in type III is extremely significant (P<0.01) Figure 3 C).

[0113] The 169886857th-169887257th base of the 8th chromosome of maize:

[0114] TTCAAGGCCGATGACAAGTTGATAACAATTAGTGGCACTGTGATTTGTTCCTATTCGTCTATTATAATGTGATAACAATTAGAGAACGGATGTAGTAGTACATTCGTTCTCGATCATTTATAAACTAAACAACGACAAATAAAGACAAATAGAAAATAACGGAGAGGGTAATATTTTAGGCGACCTGCTAAAGTACATAATRGGGAAGAAAGTACGTCACCTTGTTCCTTTGCTCCGCTCCATTTTCTAATGGGGAAGAAAGTACTGAAGTTTTTTTTTTCTTCCAAAAAATAAAAAACACATTCCTCATTTTTAGAACGCGATACCTTTGTTTTGTTCTGATCCCTCTGGCATCTGCCTGAAACATGATAGTAATACTATTACTAGTGTGATCTACGGCA

[0115] SEQ ID No. 7 Ksll : (Chr. 8 169887059, B73 RefGen_V3)

[0116] TGCCGTAGATCACACTAGTAATAGTATTACTATCATGTTTCAGGCAGATGCCAGAGGGATCAGAACAAAACAAAGGTATCGCGTTCTAAAAATGAGGAATGTGTTTTTTATTTTTTGGAAGAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTTTATAAATGATCGAGAACGAATGTACTACTACATCCGTTCTCTAATTGTTATCACATTATAATAGACGAATAGGAACAAATCACAGTGCCACTAATTGTTATCAACTTGTCATCGGCCTTGAA

[0117] SEQ ID No. 8 Ks13 : (Chr. 8 172364072, B73 RefGen_V3)

[0118] CTTCTGGAGGGAGCTCCTTATCCAAAGATATATCGTCGAGATCTGATCTAGCAATCCTTTGAATACATTTGTCGATCACTTGAGTCAGCCCTGAGTGGGAAGCAACTTCCAGAATAGGAATAACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTGAGCAGCCTAATGAATAATGATTCCATTTCAATTCATAGACTTCAAGCCACCAGGTTCGCTTGAATCAACTAAAAAAGCAATAGCCAACAATTTTAGTAGTTCAACTATTAATAGTTTTTT

[0119] SEQ ID No. 9 Ks11 : (Chr. 8 169887059, B73 RefGen_V3)

[0120] ATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTAT GTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTT

[0121] SEQ ID No. 10 Ks11 : (Chr. 8 169887059, B73 RefGen_V3)

[0122] TTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCT

[0123] SEQ ID No. 11 Ks11 : (Chr. 8 169887059, B73 RefGen_V3)

[0124] ACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCG

[0125] SEQ ID No.12 Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0126] GAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTT

[0127] SEQ ID No.13 Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0128] TTTTTTGGAAGAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTTTATAAATGAT

[0129] SEQ ID No.14 Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0130] GTGTTTTTTATTTTTTGGAAGAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTTTATAAATGATCGAGAACGAA

[0131] SEQ ID No. 15 Ks11 : (Chr. 8 169887059, B73 RefGen_V3)

[0132] CCAGAGGGATCAGAACAAAACAAAGGTATCGCGTTCTAAAAATGAGGAATGTGTTTTTTATTTTTTGGAAGAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCC ATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTTTATAAATGATCGAGAACGAATGTACTACTACATCCGTTCTCTAATTGTTATCACATTATAATAGACGAAT

[0133] SEQ ID No. 16 Ks13 : (Chr. 8 172364072, B73 RefGen_V3)

[0134] TTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTA

[0135] SEQ ID No. 17 Ks13 : (Chr. 8 172364072, B73 RefGen_V3)

[0136] GTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATA

[0137] SEQ ID No. 18 Ks13 : (Chr. 8 172364072, B73 RefGen_V3)

[0138] CTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATAT

[0139] SEQ ID No. 19 Ks13: (Chr. 8_172364072, B73 RefGen_V3)

[0140] ACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTG

[0141] SEQ ID No. 20 Ks13: (Chr. 8_172364072, B73 RefGen_V3)

[0142] AATAGGAATAACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTGAGCAGCCTAA

[0143] SEQ ID No. 21 Ks13: (Chr. 8_172364072, B73 RefGen_V3)

[0144] CAACTTCCAGAATAGGAATAACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTGAGCAGCCTAATGAATAATGA

[0145] SEQ ID No. 22 Ks13: (Chr. 8_172364072, B73 RefGen_V3)

[0146] AATCCTTTGAATACATTTGTCGATCACTTGAGTCAGCCCTGAGTGGGAAGCAACTTCCAGAATAGGAATAACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTGAGCAGCCTAATGAATAATGATTCCATTTCAATTCATAGACTTCAAGCCACCAGGTTCGCTTGAATCAACT

[0147] Ks11 is named as SNP1, and Ks13 is named as SNP2.

[0148] Example 2, Establishment of a method for detecting resistance to corn stalk rot

[0149] I. Conversion of SNP markers to KASP markers and design of primer sets for detecting the markers

[0150] The two SNP markers identified in Example 1 were converted to KASP markers for use in molecular marker-assisted selection breeding. The primer sets for detecting the KASP markers based on the KASP technology are KASP primer sets, including the KASP primer pair for SNP1 and the KASP primer pair for SNP2.

[0151] Since the GC content of the base from 169886857 to 169887257 of chromosome 8 of maize cannot be designed KASP primer pair, the inventors designed KASP primer pair of SNP1 using its reverse complementary sequence, i.e. SEQ ID No. 7. The KASP primer pair of SNP1 comprises two upstream primers (primer Ks11-X and primer Ks11-Y) and one downstream primer (primer Ks11-R) of SNP. SNP1 is located at the 200th nucleotide of the DNA molecule shown in SEQ ID No. 7 of the sequence table in the genome of maize. Primer Ks11-X is a primer with FAM fluorescent tag sequence (5'-gaaggtgaccaagttcatgct-3') at the 5' end, and primer Ks11-R amplifies the fragment of SNP1 as T (corresponding to 176-244 of SEQ ID No. 7, and the 200th nucleotide is T), and the fluorescence signal of FAM group can be read by enzyme marker or fluorescence quantitative PCR instrument; primer Ks11-Y is a primer with HEX fluorescent tag sequence (5'-gaaggtcggagtcaacggatt-3') at the 5' end, and primer Ks11-R amplifies the fragment of SNP1 as C (corresponding to 178-244 of SEQ ID No. 7, and the 200th nucleotide is C), and the fluorescence signal of HEX group can be read by enzyme marker or fluorescence quantitative PCR instrument.

[0152] The KASP primer pair of SNP2 comprises two upstream primers (primer Ks13-X and primer Ks13-Y) and one downstream primer (primer Ks13-R) of SNP. SNP2 is located at the 202nd base of the DNA molecule shown in SEQ ID No. 8 of the sequence table in the genome of maize. Primer Ks13-X is a primer with FAM fluorescent tag sequence (5'-gaaggtgaccaagttcatgct-3') at the 5' end, and primer Ks13-R amplifies the fragment of SNP2 as A (corresponding to 181-305 of SEQ ID No. 8, and the 202nd nucleotide is A), and the fluorescence signal of FAM group can be read by enzyme marker or fluorescence quantitative PCR instrument; primer Ks13-Y is a primer with HEX fluorescent tag sequence (5'-gaaggtcggagtcaacggatt-3') at the 5' end, and primer Ks13-R amplifies the fragment of SNP2 as G (corresponding to 182-305 of SEQ ID No. 8, and the 202nd nucleotide is G), and the fluorescence signal of HEX group can be read by enzyme marker or fluorescence quantitative PCR instrument.

[0153] Table 5 KASP marker primers for QTL effect verification

[0154]

[0155] Note: Lowercase gaaggtgaccaagttcatgct is specific fluorescent tag sequence FAM; Lowercase gaaggtcggagtcaacggatt is specific fluorescent tag sequence HEX.

[0156] II. Detection method

[0157] 1. DNA extraction

[0158] Genomic DNA of leaves of the corn to be tested was extracted, and a template solution was obtained by dilution. The DNA concentration in the template solution was 30-40 ng / μL.

[0159] 2. KASP molecular marker detection

[0160] First, 6 primers were diluted to 100 μM with ddH2O, and then primer working solutions were prepared according to the following formulations. The primer working solutions included primer working solution 1 and primer working solution 2, which were used in the KASP reaction system as follows. Primer working solution 1: primer Ks11-X 12 μL, primer Ks11-Y 12 μL, primer Ks11-R 30 μL, ddH2O 46 μL. Primer working solution 2: primer Ks13-X 12 μL, primer Ks13-Y 12 μL, primer Ks13-R 30 μL, ddH2O 46 μL. The KASP reaction system included 2 μL HiGeno 2x Probe Mix, 1 μL DNA template (20-50 ng / μL), 0.944 μL ddH2O, and 0.056 μL primer working solution. KASP was performed on a Bio-Rad T100 Thermal Cycler PCR amplifier, and a Touch down PCR amplification program was used. The KASP reaction program was as follows: 94°C pre-denaturation for 15 min, first amplification reaction, 94°C denaturation for 20 s, 65°C annealing for 60 s, 10 cycles, second amplification reaction, 94°C denaturation for 20 s, 55°C annealing and extension for 60 s, 38 cycles. An NTC (no template control) was set in the reaction system, and 1 or more NTCs were set for each plate.

[0161] 3. Fluorescence scanning

[0162] PCR reaction products were scanned and fluorescence data were read using a FLUOstar Omega microplate reader (BMG Labtech, Offenburg, Germany). Genotype data were read and cluster analysis was performed using the SNP typing software KclusterCaller (V 3.4.1.36; LGC Hoddesdon, UK). Genotype of FAM allele was X:X, genotype of HEX allele was Y:Y, and genotype of heterozygote was X:Y. FAM excitation wavelength was 485 nm and emission wavelength was 520 nm. HEX excitation wavelength was 535 nm and emission wavelength was 556 nm. System reference fluorescence ROX excitation wavelength was 575 nm and emission wavelength was 610 nm.

[0163] If the fluorescence using primer working solution 1 shows only the fluorescence signal of FAM group, the Ks11 (i.e. SNP1) genotype of the corn to be tested is TT (i.e. homozygous type of Ks11 as T in the corn genome); if it shows only the fluorescence signal of HEX group, the Ks11 genotype of the corn to be tested is CC (i.e. homozygous type of Ks11 as C in the corn genome); if it shows both the fluorescence signal of FAM group and the fluorescence signal of HEX group, the Ks11 genotype of the corn to be tested is TC (i.e. heterozygous type of Ks11 as C and T in the corn genome). If the fluorescence using primer working solution 2 shows only the fluorescence signal of FAM group, the Ks13 (i.e. SNP2) genotype of the corn to be tested is AA (i.e. homozygous type of Ks13 as A in the corn genome); if it shows only the fluorescence signal of HEX group, the Ks13 genotype of the corn to be tested is GG (i.e. homozygous type of Ks13 as G in the corn genome); if it shows both the fluorescence signal of FAM group and the fluorescence signal of HEX group, the Ks13 genotype of the corn to be tested is AG (i.e. heterozygous type of Ks13 as A and G in the corn genome).

[0164] Therefore, the genotype of the corn plant to be tested can be defined according to the following rules:

[0165] CCAA genotype: if the fluorescence using primer working solution 1 shows only the fluorescence signal of HEX group and the fluorescence using primer working solution 2 shows only the fluorescence signal of FAM group, the Ks11 (i.e. SNP1) genotype of the corn to be tested is CC and the Ks13 (i.e. SNP2) genotype of the corn to be tested is AA. CCAA identification accuracy = CCAA genotype plants resistant to stem rot / CCAA genotype plants x 100%.

[0166] CCGG genotype: if the fluorescence using primer working solution 1 shows only the fluorescence signal of the HEX group and the fluorescence using primer working solution 2 shows only the fluorescence signal of the HEX group, then the Ks11 (i.e. SNP1) genotype of the corn to be tested is CC and the Ks13 (i.e. SNP2) genotype of the corn to be tested is GG. The CCGG identification accuracy = the number of CCGG genotype plants resistant to stalk rot / the number of CCGG genotype plants x 100%.

[0167] TTAA genotype: if the fluorescence using primer working solution 1 shows only the fluorescence signal of the FAM group and the fluorescence using primer working solution 2 shows only the fluorescence signal of the FAM group, then the Ks11 (i.e. SNP1) genotype of the corn to be tested is TT and the Ks13 (i.e. SNP2) genotype of the corn to be tested is AA. The TTAA identification accuracy = the number of TTAA genotype plants resistant to stalk rot / the number of TTAA genotype plants x 100%.

[0168] TTGG genotype: if the fluorescence using primer working solution 1 shows only the fluorescence signal of the FAM group and the fluorescence using primer working solution 2 shows only the fluorescence signal of the HEX group, then the Ks11 (i.e. SNP1) genotype of the corn to be tested is TT and the Ks13 (i.e. SNP2) genotype of the corn to be tested is GG. The TTGG identification accuracy = the number of TTGG genotype plants susceptible to stalk rot / the number of TTGG genotype plants x 100%.

[0169] Example 3, detecting corn stalk rot resistance using the method of Example 2

[0170] I. Actual determination of corn stalk rot resistance

[0171] 1. Field design

[0172] The 240 RIL (RIL family) of the parents KA105 and KB204 and their combinations were identified for stalk rot resistance in Yangling, Shaanxi and Sanyuan, Shaanxi in 2019-2020. The site and year were defined as an environment, abbreviated as "year + first letter of the site", such as 2019YL. The field test adopted an incomplete randomized block design, 2 replicates were set in each environment, single row planting, row length 4m, row spacing 0.6m, density 5500 plants / acre. The field management measures were the same as the management of local field corn.

[0173] 2. Pathogen culture

[0174] Fusarium graminearum strain culture: single spore isolated pathogen strains were inoculated on PDA (Potato Dextrose Agar) medium, and dark culture was carried out in a constant temperature incubator at 25°C for 5-7 days. When the mycelium grew on the surface of the medium, it was cut into equal parts together with the medium and inoculated on sterilized corn kernel medium to propagate the Fusarium graminearum inoculum. Fusarium graminearum inoculum propagation: healthy and full corn kernels were soaked for 20-22 hours, boiled in boiling water for 100 minutes, and then spread out to dry. Each 500g was packed into a high-temperature resistant seed bag and autoclaved at 121°C for 50 minutes. After cooling, the Fusarium graminearum grown on the PDA medium was inoculated, and a breathable sealing film was used for sealing. Dark culture was carried out at 25°C for 15-20 days until the mycelium covered the surface of the kernels. The bag was kneaded every two days to ensure that the kernels and mycelium were in contact. The grown inoculum was dried for 3-4 days and then packed into a sack and stored in a cold storage for use. PDA solid medium preparation: fresh potatoes were washed, peeled, and cut into pieces. 200g of the potatoes were boiled in boiling water for 30 minutes, filtered through 8 layers of gauze, and the filtrate was collected. 20g of glucose was weighed and dissolved, and 15g of agar powder was heated and dissolved before being poured into the filtrate. The solution was stirred evenly, made up to 1L, autoclaved at 121°C / 20min, and then cooled and stored in a 4°C refrigerator.

[0175] 3. Field inoculation

[0176] The soil burial wounded root method was used for field inoculation during the tasseling stage of corn. The inoculated kernels were mixed well before inoculation. At the time of inoculation, a pit was dug 5-10 cm away from the root of the plant, and part of the root was cut to create a wound. 75-85g of the inoculated corn kernels were placed in the pit, and the soil was covered and compacted. After the inoculation was completed, the soil was irrigated to keep it moist, which promoted the reproduction and infection of the pathogen.

[0177] 4. Trait investigation

[0178] The split stem method was used to identify the occurrence of corn stalk rot in the field. After 50-55 days of inoculation, the plant was cut at the fruiting position and split longitudinally along the stem to observe the infection of the pathogen at the root and stem base and the degree of pith tissue necrosis. The disease rating scale (DRS) was used to identify the phenotypes of stalk rot, which was divided into 5 grades:

[0179] 1: highly resistant, normal plant, no obvious disease symptoms; 3: resistant, normal stem surface, brown lesions on the stem tip; 5: moderately resistant, soft and faded stem base, obvious water-stained; the first and second internodes of the stem base have shriveled and decomposed pith tissue, with brown lesions; 7: susceptible, the lower stem nodes gradually turn brown from green, the stem is soft and severely dehydrated, the internal stem pith tissue decomposes into a filamentous state, with severe atrophy, the stem nodes have white or pinkish fungal hyphae; the root system is soft, dry, sparse, but not collapsed; the fruit clusters begin to droop; 9: highly susceptible, hollow and constricted stem, only necrotic vascular bundle tissue remains in the stem, the stem nodes and internodes are black with pink marks; the root system is sparse, rotten and hollow, the plant is collapsed or collapsed; the female ear bracts are dry and loose, and the female ear is drooping.

[0180] Ten plants with consistent growth vigor were selected from each family, and the stem rot disease grade was observed and recorded one by one. The average value was taken as the phenotype value of each family. The average value of the disease grade of a single family was used to calculate the BLUP value representing the multi-environment combined analysis phenotype value of the family. Among them, the BLUP value of the disease grade is between 1 and 2, which is highly resistant; between 2.01 and 3, which is resistant; between 3.01 and 5, which is moderately resistant; between 5.01 and 7, which is susceptible; between 7.01 and 9, which is highly susceptible. The number of days from sowing to 50% of the plants shedding pollen was investigated and recorded for each family.

[0181] 5. Phenotype data analysis

[0182] In order to evaluate the significance of genotype, environment variance and the interaction between the two, the variance components were calculated using the "PROC MIXED" program in SAS (V9.2) software, and the mixed linear model was: y = μ + gi + ej + ε, where μ represents the total mean of the phenotype, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype is a fixed effect, flowering period is a covariate, and environment, intra-environment repetition, and genotype-environment interaction are random effects. The variance analysis result value is used to calculate the broad-sense heritability (H 2 ) of stem rot resistance: where, is the genetic variance, represents the genotype-environment interaction variance, Error term, n is the number of environments, r is the number of replicates. In order to eliminate the influence of environmental variation on phenotype, the best linear unbiased prediction (BLUP) of each family was estimated by using SAS (V9.2) mixed linear model, and the BLUP value was used as the data of joint analysis of multiple environments to draw the phenotype distribution histogram of each trait, calculate the correlation coefficient of phenotype, and carry out joint QTL positioning of multiple environments.

[0183] 6. Identification of corn stalk rot resistance using Ks11 and Ks13

[0184] The genotypes of Ksll and Ks13 of the corn to be tested shown in Table 1 were detected according to the method of Example 2.

[0185] The disease grading and genotype results of the corn to be tested shown in Table 1 are shown in Table 6, and the heterozygous genotype is not included in Table 6. Among the 239 recombinant inbred lines in Pop.1 population except the target QTL fine mapping family 638RIL-31, a total of 122 recombinant inbred lines are homozygous genotypes at the molecular markers of Ks11 and Ks13.

[0186] The phenotype identification of RIL family is based on the following: under single environment, 10 plants with consistent growth vigor are selected for each family, and the occurrence of stalk rot is observed and recorded one by one, and finally the average value of the 10 materials is taken as the phenotype value of the family; the disease grading of a single family is expressed by using the BLUP value of joint analysis of multiple environments.

[0187] Table 6 Allelic genotypes and phenotypes of molecular markers Ks11 and Ks13

[0188]

[0189]

[0190]

[0191]

[0192] Note: Ks11: CC (disease-resistant allele), TT (disease-susceptible allele); Ks13: AA (disease-resistant allele), GG (disease-susceptible allele)

[0193] Table 7 Significant analysis of disease grading of stalk rot by molecular markers Ks11 and Ks13

[0194] ks11 ks13 Phenotype RIL family number (individuals) BLUP value CC AA Disease resistance 36 3.29±0.30c CC GG Disease resistance 18 3.70 ± 0.27 b ]] TT GG Disease susceptibility 35 5.21 ± 0.39 a ]]

[0195] Note: Ksll: CC (resistant allele), TT (susceptible allele); Ksl3: AA (resistant allele), GG (susceptible allele); different lower case letters indicate significant difference (P < 0.05).

[0196] The results of the single statistics of molecular marker Ksll and molecular marker Ksl3 are shown in Table 8 and Table 9. The BLUP value of the recombinant inbred lines with genotype CC at SNP1 (i.e. Ksll) site was significantly lower than that of the recombinant inbred lines with genotype TT (P < 0.001). The BLUP value of the recombinant inbred lines with genotype AA at SNP2 (i.e. Ksl3) site was significantly lower than that of the recombinant inbred lines with genotype GG (P < 0.05).

[0197] Table 8 Significant analysis of disease grade of different genotypes of molecular marker Ksll

[0198]

[0199] Note: t-test was used for significant analysis of stem rot phenotype, * indicates significant at 0.05 level, ** indicates significant at 0.01 level, and *** indicates significant at 0.001 level.

[0200] Table 9 Significant analysis of disease grade of different genotypes of molecular marker Ksl3

[0201]

[0202] Note: t-test was used for significant analysis of stem rot phenotype, * indicates significant at 0.05 level, ** indicates significant at 0.01 level, and *** indicates significant at 0.001 level.

[0203] The above results show that the SNP molecular markers Ksll and Ksl3 closely linked to the F. graminearum stem rot resistance QTL can be used for identification of corn stem rot resistance. In the breeding of corn with stem rot resistance, it is best to select corn with genotype CC at SNP site Ksll and genotype AA at SNP site Ksl3 or genotype CC at SNP site Ksll or genotype AA at SNP site Ksl3 as the parent for breeding.

[0204] Supplementary Table 6

[0205]

[0206] Note: "638RIL-9-1", "638RIL-9-2" represent different single plants of 638RIL-9 family, and other families are the same.

[0207] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the application.

Claims

1. A method for identifying or assisting in identifying corn stalk rot resistance, characterized in that: The method is any of the following: M1. The method includes detecting the genotypes of SNP1 and SNP2 sites in the maize genome to be tested, and identifying or assisting in identifying maize stalk rot resistance based on the genotypes, wherein the SNP1 site is a site on maize chromosome 8, the nucleotide type of which is C or T, and is the 50th nucleotide of SEQ ID No. 9 in the sequence listing; the SNP2 site is a site on maize chromosome 8, the nucleotide type of which is A or G, and is the 50th nucleotide of SEQ ID No. 16 in the sequence listing; M2. The method includes detecting the genotype of the SNP1 site in the maize genome to be tested, and identifying or assisting in identifying maize stalk rot resistance based on the genotype, wherein the SNP1 site is a site on maize chromosome 8, the nucleotide type of which is C or T, and is the 50th nucleotide of SEQ ID No. 9 in the sequence listing; M3. The method includes detecting the genotype of the SNP2 site in the maize genome to be tested, and identifying or assisting in identifying maize stalk rot resistance based on the genotype, wherein the SNP2 is a site on maize chromosome 8, the nucleotide type of which is A or G, and is the 50th nucleotide of SEQ ID No. 16 in the sequence listing; In the method described in M1, M2 or M3 above, the corn with the CC genotype at the SNP1 site has a higher resistance to stalk rot than the corn with the TT or TC genotype, and the corn with the AA genotype at the SNP2 site has a significantly higher resistance to stalk rot than the corn with the GG or AG genotype.

2. The method according to claim 1, characterized in that The chromosome of the corn to be tested contains a DNA fragment, which is a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID No. 9, or / and contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID No.

16.

3. A method for breeding corn resistant to stalk rot, characterized in that: The method is any of the following: H1. The method comprises detecting the genotype of corn, and selecting corn with a genotype of CCAA as a parent for breeding, wherein the CCAA is a homozygous type with a SNP1 site of C and a homozygous type with a SNP2 site of A; H2. The method comprises detecting the genotype of corn, and selecting corn with a genotype of CC as a parent for breeding, wherein CC is a homozygous type at the SNP1 locus of C; H3. The method comprises detecting the genotype of corn, and selecting corn with a genotype of AA as a parent for breeding, wherein the AA is a homozygous type at SNP2 site A; In the method described in any one of items H1 to H3 above, the SNP1 site is a site on corn chromosome 8, the nucleotide type of which is C or T, and is the 50th nucleotide of SEQ ID No. 9 in the sequence list; the SNP2 is a site on corn chromosome 8, the nucleotide type of which is A or G, and is the 50th nucleotide of SEQ ID No. 16 in the sequence list.

4. Any of the following applications of a substance for detecting polymorphism or genotype of a SNP site in a corn genome, A1) Identify or assist in identifying resistance to corn stalk rot; A2) Screening or breeding maize lines, strains or varieties that are resistant to stalk rot; A3) Screening or breeding corn lines, strains or varieties susceptible to stalk rot; A4) Preparation of products for identifying or assisting in identifying resistance to corn stalk rot; A5) preparing products for screening or breeding maize lines, strains or varieties resistant to stalk rot; A6) preparing products for screening or breeding maize lines, varieties or varieties susceptible to stalk rot; The SNP site is any of the following: P1, the SNP sites are SNP1 and SNP2, the SNP1 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No. 9 in the sequence list, which is C or T; the SNP2 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No. 16 in the sequence list, which is A or G; P2, the SNP site is SNP1 site, the SNP1 site is a SNP in the maize genome, which is the 50th nucleotide of SEQ ID No.9 in the sequence list, which is C or T; P3. The SNP site is SNP2, which is a SNP in the corn genome and is the 50th nucleotide of SEQ ID No. 16 in the sequence list, which is A or G.

5. The use according to claim 4, characterized in that The substance is as follows D1), D2) or D3): D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site; D2) the substance is a PCR reagent containing the primer combination described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

6. The use according to claim 5, characterized in that The primer composition is F1 and / or F2: F1, a primer set consisting of the single-stranded DNA shown in SEQ ID No. 1 in the sequence listing, the single-stranded DNA shown in SEQ ID No. 2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 3 in the sequence listing; F2. A primer set consisting of the single-stranded DNA shown in SEQ ID No. 4 in the sequence listing, the single-stranded DNA shown in SEQ ID No. 5 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 6 in the sequence listing.

7. Use of DNA molecules in any of the following: A1) Identify or assist in identifying resistance to corn stalk rot; A2) Screening or breeding maize lines, strains or varieties that are resistant to stalk rot; A3) Screening or breeding corn lines, strains or varieties susceptible to stalk rot; A4) Preparation of products for identifying or assisting in identifying resistance to corn stalk rot; A5) preparing products for screening or breeding maize lines, strains or varieties resistant to maize stalk rot; A6) preparing products for screening or breeding maize lines, varieties or varieties susceptible to maize stalk rot; The DNA molecule is any one of the following: B1) The nucleotide sequence is SEQ ID No. 7 or positions 176-244 of SEQ ID No. 7 or the DNA molecule of positions 178-244 of SEQ ID No. 7 in the sequence listing; B2) the nucleotide sequence is SEQ ID No. 8 in the sequence listing, or the DNA molecule at positions 181 to 305 of SEQ ID No. 8, or the DNA molecule at positions 182 to 305 of SEQ ID No. 8; B3) A combination of B1) and B2).

Images