Qtl for regulating resistance to corn stalk rot, its closely linked snp molecular marker and application thereof
By locating QTLs on maize chromosome 2 and developing closely linked SNP molecular markers Ks1 and Ks3, the problem of low resistance to maize stalk rot in existing technologies has been solved, enabling efficient resistance identification and breeding, and improving the resistance and selection efficiency of maize breeding.
Patent Information
- Application Number
- CN202311450111.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-02
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2043-11-02
AI Technical Summary
In existing technologies, maize stalk rot resistance is affected by multiple factors, and the resistance site effect is low, making it difficult to find highly resistant and multi-resistant resistance sources, which leads to the increasing severity of stalk rot occurrence year by year. Existing QTL mapping is limited and has low effect, making it difficult to improve maize resistance through molecular breeding.
By locating QTLs that regulate stalk rot resistance on maize chromosome 2 and developing closely linked SNP molecular markers Ks1 and Ks3, high-density genetic mapping and fine mapping, combined with KASP technology, high-throughput molecular detection was performed to achieve rapid identification and screening of stalk rot resistant materials.
It improves the accuracy of identification and breeding efficiency of maize stalk rot resistance, enables efficient introduction of resistance genes into susceptible materials, achieves early prediction and efficient screening, and enhances the selection efficiency and resistance level of maize breeding.
Smart Images

Figure SMS_5 
Figure SMS_6 
Figure SMS_7
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular markers, and in particular to QTLs for regulating corn stalk rot resistance, tightly linked SNP molecular markers thereof, and applications thereof. Background Art
[0002] corn( Zea mays Fusarium graminearum (F. graminearum) is a major food and feed crop, as well as an important industrial raw material and energy plant. It plays a vital role in the national economy and agricultural production. Corn stalk rot is a global soil-borne disease that seriously harms corn production. It mainly causes premature plant aging, stalk lodging, and insufficient grain filling, resulting in reduced yields and restricting mechanized corn harvesting. Fusarium graminearum ) and Pythium spp. ( Pythium inflatum ) is the main dominant pathogen causing corn stalk rot.
[0003] Corn resistance to stalk rot is a complex quantitative trait controlled by multiple quantitative trait loci (QTLs). Because stalk rot is significantly affected by pathogens, the environment, and genotype, and because it is difficult to identify sources of high or multi-resistance, corn stalk rot incidence has become increasingly severe year by year. Currently, most identified stalk rot resistance loci have low efficacy, and relatively few stalk rot resistance genes have been cloned. Therefore, further research is needed to identify QTLs and genes for stalk rot resistance in corn, as well as to develop molecular markers tightly linked to QTLs. This will provide strong support for molecular breeding for stalk rot resistance, aggregating multiple resistance genes, and ultimately improving corn stalk rot resistance. Summary of the Invention
[0004] The present invention provides a QTL for regulating corn stalk rot resistance, a tightly linked SNP molecular marker thereof and applications thereof.
[0005] The present invention utilizes a population of recombinant inbred lines of maize to identify resistance to stalk rot in multiple environments, and combines high-density genetic mapping with fine mapping to locate a stable QTL controlling maize stalk rot resistance on maize chromosome 2, bin 2.02. Based on this, the present invention provides a maize genomic region and its corresponding DNA fragment that can improve maize stalk rot resistance. In addition, the present invention also provides nucleotide sequence polymorphisms and SNP molecular markers that are tightly linked to the above-mentioned QTL sites. Utilizing the SNP molecular markers provided by the present invention, stalk rot resistance sites can be efficiently and quickly introduced into other susceptible materials to produce maize stalk rot-resistant germplasm, and the genotype of the maize material to be tested can also be accurately identified with high throughput to screen for stalk rot-resistant materials.
[0006] Specifically, the present invention provides the following technical solutions:
[0007] The application provides a QTL for regulating corn stalk rot resistance, which is a DNA fragment located on chromosome 2 of corn, and comprises a nucleotide sequence from 12360576 to 14116694 of chromosome 2 of corn according to the B73 AGP_V3 genome.
[0008] In some embodiments of the application, the QTL for regulating corn stalk rot resistance is located between molecular markers Ks1 and Ks3, with a physical distance of 1.75 Mb; wherein the polymorphic site of the molecular marker Ks1 is located at 12360576 of chromosome 2 of corn, with a polymorphism of A / G; and the polymorphic site of the molecular marker Ks3 is located at 14116694 of chromosome 2 of corn, with a polymorphism of A / C.
[0009] The application provides an application of the above-mentioned QTL for regulating corn stalk rot resistance in improving corn stalk rot resistance or breeding corn resistant to stalk rot.
[0010] In the application, the stalk rot is preferably Fusarium graminearum stalk rot.
[0011] The application provides a method for breeding corn resistant to stalk rot, which comprises the step of introducing the QTL for regulating corn stalk rot resistance into corn chromosomes.
[0012] Preferably, the method comprises the step of crossing corn containing the QTL with corn not containing the QTL.
[0013] In some embodiments of the application, the method comprises the following steps:
[0014] 1) crossing corn plants containing the QTL with corn plants not containing the QTL to obtain an F1 population;
[0015] 2) selfing the F1 population for one or more rounds, and / or crossing plants from the F1 population to obtain a next generation population;
[0016] 3) selecting corn plants containing the QTL using molecular markers closely linked to the QTL.
[0017] The application provides a SNP molecular marker related to corn stalk rot resistance, which comprises molecular marker Ks1 and / or molecular marker Ks3; the polymorphic site of the molecular marker Ks1 is located at 12360576 of chromosome 2 of corn according to the B73 AGP_V3 genome, with a polymorphism of A / G; and the polymorphic site of the molecular marker Ks3 is located at 14116694 of chromosome 2 of corn, with a polymorphism of A / C.
[0018] The skilled in the art can understand that based on the polymorphic sites of the above SNP molecular markers and the upstream and downstream sequences thereof on the genome, sequence fragments of different lengths can be developed as molecular markers for amplification and detection of the polymorphic sites, and thus the present application does not have special limitations on the length of the sequence fragments of the SNP molecular markers, and all SNP molecular markers containing the above polymorphic sites and the upstream and / or downstream sequences of the polymorphic sites are within the protection scope of the present application.
[0019] The present application provides a SNP molecular marker related to the resistance of corn stalk rot, which comprises a molecular marker Ks1 and / or a molecular marker Ks3; wherein the molecular marker Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 50 of the sequence shown in SEQ ID NO. 1, and the molecular marker Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 50 of the sequence shown in SEQ ID NO. 2.
[0020] Further, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 60 of the sequence shown in SEQ ID NO. 13;
[0021] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 60 of the sequence shown in SEQ ID NO. 14.
[0022] Further, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 70 of the sequence shown in SEQ ID NO. 15;
[0023] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 70 of the sequence shown in SEQ ID NO. 16.
[0024] Further, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 80 of the sequence shown in SEQ ID NO. 17;
[0025] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 80 of the sequence shown in SEQ ID NO. 18.
[0026] Further, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 90 of the sequence shown in SEQ ID NO. 19;
[0027] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 90 of the sequence shown in SEQ ID NO. 20.
[0028] Further, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 100 of the sequence shown in SEQ ID NO. 21;
[0029] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 100 of the sequence shown in SEQ ID NO. 22.
[0030] Further, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 150 of the sequence shown in SEQ ID NO. 23;
[0031] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 150 of the sequence shown in SEQ ID NO. 24.
[0032] Further, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 200 of the sequence shown in SEQ ID NO. 25;
[0033] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 200 of the sequence shown in SEQ ID NO. 26.
[0034] The above SNP molecular marker is closely linked to the QTL site of corn resistance to stalk rot.
[0035] Specifically, the molecular marker Ks1 is obtained by PCR amplification with a primer set shown in SEQ ID NO. 3-5 as a template of corn genomic DNA;
[0036] The molecular marker Ks3 is obtained by PCR amplification with a primer set shown in SEQ ID NO. 6-8 as a template of corn genomic DNA.
[0037] SEQ ID NO. 3: CAGCTTATAGACAGGGGTTTGGG;
[0038] SEQ ID NO. 4: CAGCTTATAGACAGGGGTTTGGA;
[0039] SEQ ID NO. 5: GGCACCACAACCATTATTTTAGTTTCC;
[0040] SEQ ID NO. 6: AGTTGGTCATCAGCTTGTCAAAAA;
[0041] SEQ ID NO. 7: AGTTGGTCATCAGCTTGTCAAAAC;
[0042] SEQ ID NO. 8: GGTAAAGACTAGTTTCGCAAGCCG.
[0043] In some embodiments of the present application, the SNP molecular marker related to the resistance to Goss' Wilt is Ks1 or Ks3.
[0044] In some embodiments of the present application, the SNP molecular marker related to the resistance to Goss' Wilt is a combination of Ks1 and Ks3.
[0045] The present application has been verified by a large sample of corn materials, and it is found that the use of molecular markers Ks1 and Ks3 alone can realize the identification of the resistance to Goss' Wilt, and the combined use of molecular markers Ks1 and Ks3 can significantly improve the accuracy of the identification of the resistance to Goss' Wilt.
[0046] In the above-mentioned molecular marker Ks1, the genotype of the polymorphic site is AA, which corresponds to the resistance to Goss' Wilt, and the genotype of the polymorphic site is GG, which corresponds to the susceptibility to Goss' Wilt.
[0047] In the above-mentioned molecular marker Ks3, the genotype of the polymorphic site is AA, which corresponds to the resistance to Goss' Wilt, and the genotype of the polymorphic site is CC, which corresponds to the susceptibility to Goss' Wilt.
[0048] The present application provides a primer set for amplifying the SNP molecular marker related to the resistance to Goss' Wilt.
[0049] According to the position of the polymorphic site of the SNP molecular marker provided above and the upstream and downstream sequences thereof, those skilled in the art can develop various types of primer sets for amplifying the SNP molecular marker.
[0050] The above-mentioned primer set can comprise any primer that can be used to detect the genotype of the SNP molecular marker.
[0051] Preferably, the primer set comprises primers having sequences as shown in SEQ ID NO. 3-5, and / or primers having sequences as shown in SEQ ID NO. 6-8.
[0052] Among them, the primers having sequences as shown in SEQ ID NO. 3-4 are forward primers, and the primer having a sequence as shown in SEQ ID NO. 5 is a reverse universal primer; the primers having sequences as shown in SEQ ID NO. 6-7 are forward primers, and the primer having a sequence as shown in SEQ ID NO. 8 is a reverse universal primer.
[0053] The KASP (Competitive Allele Specific PCR) technology does not need to be typed according to the size of a DNA fragment, does not need to rely on a relatively complicated, low-throughput and high-price detection method such as traditional gel electrophoresis, and is more suitable for the high-throughput molecular detection platform rapidly developed at present. Therefore, the KASP primer set for corn stalk rot resistance detection suitable for the high-throughput molecular detection platform is developed at low cost.
[0054] The KASP primer set for amplifying the Ks1 includes a first forward primer, a second forward primer and a reverse universal primer, wherein the sequence of the first forward primer is a specific fluorescent tag sequence and the sequence shown in SEQ ID NO. 3 connected in sequence, the sequence of the second forward primer is a specific fluorescent tag sequence and the sequence shown in SEQ ID NO. 4 connected in sequence, and the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO. 5.
[0055] The KASP primer set for amplifying the Ks3 includes a third forward primer, a fourth forward primer and a reverse universal primer, wherein the sequence of the third forward primer is a specific fluorescent tag sequence and the sequence shown in SEQ ID NO. 6 connected in sequence, the sequence of the fourth forward primer is a specific fluorescent tag sequence and the sequence shown in SEQ ID NO. 7 connected in sequence, and the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO. 8.
[0056] The fluorescent tags of the first forward primer and the second forward primer are different, and the fluorescent tags of the third forward primer and the fourth forward primer are different, and the fluorescent tag is not limited, and a common fluorescent tag can be selected.
[0057] In some embodiments of the present application, the KASP primer set for amplifying the Ks1 includes primers with sequences shown in SEQ ID NO. 9-10, 5, wherein the primers with sequences shown in SEQ ID NO. 9-10 are forward primers, and the primer with a sequence shown in SEQ ID NO. 5 is a reverse universal primer.
[0058] In some embodiments of the present application, the KASP primer set for amplifying the Ks3 includes primers with sequences shown in SEQ ID NO. 11-12, 8, wherein the primers with sequences shown in SEQ ID NO. 11-12 are forward primers, and the primer with a sequence shown in SEQ ID NO. 8 is a reverse universal primer.
[0059] The present application also includes a kit of the primer set described above.
[0060] For the convenience of detection, the kit can further comprise other reagents for PCR amplification, including but not limited to DNA polymerase, PCR reaction buffer, probe, dNTP, Mg 2+ , water, etc.
[0061] The above reagents can be packaged separately or provided as a premix after mixing.
[0062] The present application provides the following any one of the application of the above-mentioned QTL for regulating the resistance of corn stalk rot, or the SNP molecular marker related to the resistance of corn stalk rot, or the primer set, or the kit:
[0063] (1) Application in identifying or assisting in identifying the resistance of corn stalk rot;
[0064] (2) Application in preparing a product for identifying or assisting in identifying the resistance of corn stalk rot;
[0065] (3) Application in early prediction of the resistance of corn stalk rot;
[0066] (4) Application in screening corn resistant to stalk rot;
[0067] (5) Application in corn stalk rot resistance molecular marker assisted breeding;
[0068] (6) Application in preparing a product for corn stalk rot resistance molecular marker assisted breeding;
[0069] (7) Application in improving corn stalk rot resistance germplasm resources;
[0070] The SNP molecular marker related to the resistance of corn stalk rot includes Ks1 and / or Ks3, the polymorphic site of Ks1 is located at 12360576 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of Ks3 is located at 14116694 of corn chromosome 2, and the polymorphism is A / C.
[0071] In Ks1, the genotype of the polymorphic site is AA, which corresponds to the resistance of corn stalk rot, and the genotype of the polymorphic site is GG, which corresponds to the susceptibility of corn stalk rot; in Ks3, the genotype of the polymorphic site is AA, which corresponds to the resistance of corn stalk rot, and the genotype of the polymorphic site is CC, which corresponds to the susceptibility of corn stalk rot.
[0072] In some embodiments of the present application, Ks1 contains a nucleotide sequence with A / G polymorphism at position 50 of the sequence shown in SEQ ID NO. 1, and Ks3 contains a nucleotide sequence with A / C polymorphism at position 50 of the sequence shown in SEQ ID NO. 2.
[0073] The application provides a method for identifying the resistance of corn stalk rot, which comprises the following steps:
[0074] PCR amplification is performed on the SNP molecular marker related to the resistance of corn stalk rot by taking the genomic DNA of corn to be identified as a template;
[0075] The genotype of the SNP molecular marker related to the resistance of corn stalk rot in the PCR amplification product is analyzed, and the resistance of the corn to be identified to stalk rot is determined according to the genotype;
[0076] The SNP molecular marker related to the resistance of corn stalk rot comprises Ks1 and / or Ks3, the polymorphic site of the Ks1 is located at the 12360576th position of the 2nd chromosome of corn, and the polymorphism is A / G; the polymorphic site of the Ks3 is located at the 14116694th position of the 2nd chromosome of corn, and the polymorphism is A / C.
[0077] In some embodiments of the application, the Ks1 contains a nucleotide sequence with a polymorphism of A / G at the 50th position of the sequence shown in SEQ ID NO. 1, and the Ks3 contains a nucleotide sequence with a polymorphism of A / C at the 50th position of the sequence shown in SEQ ID NO. 2.
[0078] Specifically, in the Ks1, the genotype of the polymorphic site is AA, which corresponds to the resistance of corn stalk rot, and the genotype of the polymorphic site is GG, which corresponds to the susceptibility of corn stalk rot; in the Ks3, the genotype of the polymorphic site is AA, which corresponds to the resistance of corn stalk rot, and the genotype of the polymorphic site is CC, which corresponds to the susceptibility of corn stalk rot.
[0079] In some embodiments of the application, the SNP molecular marker related to the resistance of corn stalk rot is amplified by using a primer group with the sequence shown in SEQ ID NO. 3-5 and / or a primer group with the sequence shown in SEQ ID NO. 6-7.
[0080] In some embodiments of the application, the SNP molecular marker related to the resistance of corn stalk rot is amplified by using a primer group with the sequence shown in SEQ ID NO. 9-10, 5 and / or a primer group with the sequence shown in SEQ ID NO. 11-12, 8.
[0081] The application provides a method for obtaining a corn plant with increased resistance to stalk rot, which comprises the following steps:
[0082] (1) providing a first maize plant comprising in its genome any of the following chromosomal intervals: a nucleotide sequence in which the base at position 50 of the sequence set forth in SEQ ID NO. 1 is A, or a nucleotide sequence in which the base at position 60 of the sequence set forth in SEQ ID NO. 13 is A, or a nucleotide sequence in which the base at position 70 of the sequence set forth in SEQ ID NO. 15 is A, or a nucleotide sequence in which the base at position 80 of the sequence set forth in SEQ ID NO. 17 is A, or a nucleotide sequence in which the base at position 90 of the sequence set forth in SEQ ID NO. 19 is A, or a nucleotide sequence in which the base at position 100 of the sequence set forth in SEQ ID NO. 21 is A, or a nucleotide sequence in which the base at position 150 of the sequence set forth in SEQ ID NO. 23 is A, or a nucleotide sequence in which the base at position 200 of the sequence set forth in SEQ ID NO. 25 is A, and / or
[0083] a nucleotide sequence in which the base at position 50 of the sequence set forth in SEQ ID NO. 2 is A, or a nucleotide sequence in which the base at position 60 of the sequence set forth in SEQ ID NO. 14 is A, or a nucleotide sequence in which the base at position 70 of the sequence set forth in SEQ ID NO. 16 is A, or a nucleotide sequence in which the base at position 80 of the sequence set forth in SEQ ID NO. 18 is A, or a nucleotide sequence in which the base at position 90 of the sequence set forth in SEQ ID NO. 20 is A, or a nucleotide sequence in which the base at position 100 of the sequence set forth in SEQ ID NO. 22 is A, or a nucleotide sequence in which the base at position 150 of the sequence set forth in SEQ ID NO. 24 is A, or a nucleotide sequence in which the base at position 200 of the sequence set forth in SEQ ID NO. 26 is A;
[0084] wherein the first maize plant has resistance to stalk rot;
[0085] (2) crossing the first maize plant with a second maize plant to obtain progeny plants; the second maize plant does not comprise or comprises the chromosomal interval of step (1);
[0086] (3) selecting a progeny plant that comprises the chromosomal interval of step (1) in the progeny plant by isolating nucleic acid from the progeny plant and detecting within the nucleic acid, thereby obtaining a maize plant having increased resistance to stalk rot.
[0087] The present application provides a method of producing a maize plant having resistance to stalk rot, the method comprising the steps of:
[0088] (1) isolating nucleic acid from a maize plant;
[0089] (2) detecting the SNP molecular marker in the nucleic acid;
[0090] (3) selecting a corn plant with resistance to stalk rot based on the presence of the SNP molecular marker detected in step (2);
[0091] The selection refers to that when the genotype of the SNP molecular marker Ksl at the site with the polymorphism in the isolated nucleic acid is AA, the corn plant is selected; and / or
[0092] when the genotype of the SNP molecular marker Ks3 at the site with the polymorphism in the isolated nucleic acid is AA, the corn plant is selected.
[0093] The present application provides a method for conferring resistance to stalk rot in corn, the method comprising: 1) providing a nucleic acid molecule from a corn chromosome with resistance to stalk rot, and 2) inserting the nucleic acid molecule into a chromosome of a recipient corn, thereby producing a corn plant with increased resistance to stalk rot compared to the recipient corn; the nucleic acid molecule comprises a nucleotide sequence of corn chromosome 2 from 12360576-14116694 or any part thereof, which can confer resistance to stalk rot in corn.
[0094] The present application provides a corn plant obtained by the above method.
[0095] The present application provides a corn plant obtained by crossing a first corn plant and a second corn plant, wherein the first corn plant comprises any of the following chromosomal intervals in the genome:
[0096] a nucleotide sequence corresponding to the base at position 50 of the sequence shown in SEQ ID NO. 1 being A, or a nucleotide sequence corresponding to the base at position 60 of the sequence shown in SEQ ID NO. 13 being A, or a nucleotide sequence corresponding to the base at position 70 of the sequence shown in SEQ ID NO. 15 being A, or a nucleotide sequence corresponding to the base at position 80 of the sequence shown in SEQ ID NO. 17 being A, or a nucleotide sequence corresponding to the base at position 90 of the sequence shown in SEQ ID NO. 19 being A, or a nucleotide sequence corresponding to the base at position 100 of the sequence shown in SEQ ID NO. 21 being A, or a nucleotide sequence corresponding to the base at position 150 of the sequence shown in SEQ ID NO. 23 being A, or a nucleotide sequence corresponding to the base at position 200 of the sequence shown in SEQ ID NO. 25 being A, and / or
[0097] which comprises any one of the following chromosomal intervals in the genome: a nucleotide sequence in which the base at position 50 of the sequence shown in SEQ ID NO. 2 is A, or a nucleotide sequence in which the base at position 60 of the sequence shown in SEQ ID NO. 14 is A, or a nucleotide sequence in which the base at position 70 of the sequence shown in SEQ ID NO. 16 is A, or a nucleotide sequence in which the base at position 80 of the sequence shown in SEQ ID NO. 18 is A, or a nucleotide sequence in which the base at position 90 of the sequence shown in SEQ ID NO. 20 is A, or a nucleotide sequence in which the base at position 100 of the sequence shown in SEQ ID NO. 22 is A, or a nucleotide sequence in which the base at position 150 of the sequence shown in SEQ ID NO. 24 is A, or a nucleotide sequence in which the base at position 200 of the sequence shown in SEQ ID NO. 26 is A;
[0098] the first corn plant has resistance to stalk rot;
[0099] the second corn plant does not comprise or comprises any one of the above-mentioned chromosomal intervals.
[0100] Preferably, the chromosomal interval of the above-mentioned corn plant comprises a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO. 1, and / or comprises a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO. 2.
[0101] The present application has at least the following beneficial effects: the QTL for regulating corn stalk rot resistance provided by the present application has a LOD value of 3.67-8.79, and can explain a phenotypic variation of 5.40%-15.60%, and can be used to improve the resistance of corn to stalk rot and to breed corn resistant to stalk rot.
[0102] The SNP molecular marker provided by the present application that is closely linked to the QTL for corn stalk rot resistance can be used to identify the resistance of corn to stalk rot, has a high accuracy, and can also be used for assisted breeding and germplasm improvement of corn resistance to stalk rot. The SNP molecular marker provided by the present application can be used to identify and assist in screening the resistance of corn to stalk rot at the seedling stage, and in corn breeding, the SNP molecular marker provided by the present application can improve the selection efficiency of corn breeding and accelerate the breeding process, which has important significance for improving the breeding efficiency and breeding level of corn resistance to stalk rot. BRIEF DESCRIPTION OF DRAWINGS
[0103] In order to more clearly illustrate the technical solutions of the present application or the prior art, the drawings needed to be used in the following embodiments or prior art description will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative effort.
[0104] Figure 1 Disease performance of Fusarium graminearum stem rot of the parent inbred line in Example 1 of the present application; wherein A is the field phenotype of the parent inbred line stem rot (HR: resistant, S: susceptible); B is the split stem observation of the parent inbred line stem rot; C is the stem rot disease grading standard (HR: resistant, HS: susceptible); D is the disease grading of the parent inbred line under four environments; Indicates significant at the 0.001 level.
[0105] Figure 2 Disease performance of Fusarium graminearum stem rot of the parent inbred line in Example 1 of the present application; wherein A is the field phenotype of the parent inbred line stem rot (HR: resistant, S: susceptible); B is the split stem observation of the parent inbred line stem rot; C is the stem rot disease grading standard (HR: resistant, HS: susceptible); D is the disease grading of the parent inbred line under four environments;
[0106] Figure 3 Disease performance of Fusarium graminearum stem rot of the parent inbred line in Example 1 of the present application; wherein A is the field phenotype of the parent inbred line stem rot (HR: resistant, S: susceptible); B is the split stem observation of the parent inbred line stem rot; C is the stem rot disease grading standard (HR: resistant, HS: susceptible); D is the disease grading of the parent inbred line under four environments;
[0107] Figure 4 Disease performance of Fusarium graminearum stem rot of the parent inbred line in Example 1 of the present application; wherein A is the field phenotype of the parent inbred line stem rot (HR: resistant, S: susceptible); B is the split stem observation of the parent inbred line stem rot; C is the stem rot disease grading standard (HR: resistant, HS: susceptible); D is the disease grading of the parent inbred line under four environments; P <0.05), it is inferred that the parent recombinant individual carries the disease resistance gene, represented by R; on the contrary, if there is no significant difference between the two genotypes P >0.05), it is inferred that the parent recombinant individual does not carry the disease resistance gene, represented by S. Black rectangle, indicating homozygous disease resistance allele segment; gray rectangle, indicating heterozygous allele segment. Molecular markers are the markers used in the analysis results. The bar chart represents the DSI distribution of plants of different genotypes. Indicates P<0.05, indicates P <0.01, indicates P <0.001. DETAILED DESCRIPTION
[0108] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be described clearly and completely below in combination with the drawings in the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the protection scope of the present application.
[0109] Example 1: Positioning of Goss' Wilt Resistance QTL and Development of Its Closely Linked Molecular Markers
[0110] 1. Materials and methods
[0111] 1.1 Test materials
[0112] Tested corn materials:
[0113] Disease-resistant inbred line KA105 and disease-susceptible inbred line Huangzaosi (HZ4) and 215 F 7:8 Recombinant inbred line (RIL) population.
[0114] The specific information of the RIL family is shown in Table 1.
[0115] Table 1. RIL family (215)
[0116]
[0117] KA105 is an inbred line independently bred by the corn genetic breeding team of Northwest A&F University (Wang Bx, Wang Yh, Chen Pf, et al. Combining ability analysis of inbred lines derived from Shaan' A and Shaan' B groups under different densities [J]. Crop Science, 2017, 43(9): 1328-1336.). HZ4 is a Chinese corn backbone inbred line, which was co-bred by Beijing Academy of Agriculture and Forestry Sciences and Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (Zhao Jr, Li Ch, Zhang Ry, et al. Exploration of the origin of corn backbone inbred line Huangzaosi [J]. Plant Genetic Resources, 2021, 22(1): 6.). The seeds of the parent inbred lines of the tested materials were provided by the corn breeding team of the College of Agriculture, Northwest A&F University.
[0118] Fusarium graminearum (Schwein.) S. Ito Fusarium graminearum The strain was provided by Dr. Long Shusheng, College of Plant Protection, Northwest A&F University, and it is the dominant pathogen of stalk rot in northern China (Wang X M, Jin Q M, Li X, et al. Corn Field Manual of Diseases and Insect Pests [M]. China Agricultural Science and Technology Press, 2010).
[0119] 1.2 Test method
[0120] 1.2.1 Field design
[0121] The 215 RIL populations of parents KA105 and HZ4 and their combinations were inoculated and identified in Yangling and Sanyuan in 2020-2021. The site and year were defined as the environment, and was abbreviated as "year + first letter of site", such as 2020YL. The field test adopted an incomplete random block design, with 2 replicates in each environment, single row planting, row length 4m, row spacing 0.6m, and density 5500 plants / mu. The field management measures were the same as the production management of local corn.
[0122] 1.2.2 Pathogen culture
[0123] Fusarium graminearum propagation culture: The single-spore isolated pathogen strain was inoculated on PDA (Potato Dextrose Agar) medium and dark cultured in a 25°C constant temperature incubator for 5-7 days. When the mycelium covered the surface of the medium, it was cut into equal parts together with the medium and inoculated on sterilized corn kernel medium for the preparation of Fusarium graminearum inoculum.
[0124] PDA solid medium preparation: Fresh potatoes were washed and peeled, cut into about 1cm x 1cm pieces, weighed 200g and added to a pot with appropriate amount of pure water and boiled for 30min. The filtrate was collected in a 1L beaker after filtering with 8 layers of gauze. 20g of glucose was added and stirred to dissolve. 15g of agar powder was weighed, heated and dissolved, then poured into the filtrate, stirred evenly, and made up to 1L. It was sterilized at 121°C for 20min, then dispensed into culture dishes on a clean bench, and cooled and solidified for use. It can also be stored in a 4°C refrigerator for standby use.
[0125] Preparation of Fusarium graminearum inoculum: Healthy and full corn kernels were soaked in water for 20-22h, boiled in boiling water for 100min, and the cooked corn kernels were spread out to dry. Each 500g was packed into a high-temperature resistant seed bag and autoclaved at 121°C for 50min. After cooling, F. graminearum grown on PDA medium was inoculated, and a breathable sealing film was used for sealing. Dark culture at 25°C for 15-20 days until the mycelium covered the surface of the corn kernels. Every two days, the bag was kneaded to ensure that the corn kernels and the fungus were in close contact. The well-grown inoculum was dried for 3-4 days, packed into a burlap bag and stored in a cold storage for standby use.
[0126] 1.2.3 Field inoculation
[0127] The soil-burial method was used to inoculate the corn in the field at the tasseling stage. The inoculated seeds were mixed well before use. The inoculation was performed by digging a hole near the root of the plant, cutting off part of the root to create a wound, and placing 75-85 inoculated corn seeds in the hole, covering the soil and tamping it down. After inoculation, the field was irrigated to keep the soil moist and promote the growth and infection of the pathogen.
[0128] 1.2.4 Trait investigation
[0129] After 50-55 days of inoculation, the stem rot disease of corn in the field was identified using the split stem method. The plant was cut at the fruiting site and split longitudinally along the stem, and the infection of the pathogen and the degree of pith tissue necrosis at the root and stem base were observed. The disease rating scale (DRS) was used to identify the phenotypes of stem rot disease, which was divided into 5 levels:
[0130] Level 1: highly resistant, normal plant, no obvious disease;
[0131] Level 3: resistant, normal stem surface, brown lesions at the tip of the stem;
[0132] Level 5: moderately resistant, soft and faded stem base, with obvious water spots; the first and second internodes of the stem base have shriveled and decomposed pith tissue, with brown lesions;
[0133] Level 7: susceptible, lower stem nodes gradually turn brown from green, with severe stem softening and dehydration, internal stem pith tissue decomposes into a filamentous state, with severe atrophy, and white or pinkish-red mycelium on the stem nodes; the root system is soft, dry, and sparse, but not collapsed; the fruiting ear begins to droop;
[0134] Level 9: highly susceptible, hollow and constricted stem, with only necrotic vascular bundle tissue remaining inside the stem, blackened stem nodes and internodes with pinkish-red markings; the root system is sparse, rotten, and hollow, with the plant collapsed or collapsed; the bract of the female ear is dry and loose, and the female ear is drooping.
[0135] Ten plants with consistent growth were selected from each family, and the stem rot disease rating was observed and recorded one by one, with the average value as the phenotype value of each family. The number of days from sowing to 50% of the plants shedding pollen was investigated and recorded.
[0136] 1.2.5 Phenotype data analysis
[0137] In order to evaluate the significance of genotype, environmental variance and the interaction between the two, the variance components were calculated using the "PROC MIXED" program in SAS (V9.2) software, and the mixed linear model was: wherein the total mean of the phenotypes, the genotype effect of the 'i'th family, the effect of the 'j'th environment, is a random residual term. Genotype is a fixed effect, flowering date is a covariate, and environment, intra-environment replicate, and genotype-by-environment interaction are random effects. Broad-sense heritability (h2) of stalk rot resistance was calculated using the results of the variance analysis, H 2 ): wherein, is the genetic variance, represents the genotype-by-environment interaction variance, is the error term, n is the number of environments, and r is the number of replicates. To eliminate the influence of environmental variation on the phenotype, the Best Linear Unbiased Prediction (BLUP) of each family (all families included in the mapping population) was estimated using SAS (V9.2) mixed linear models, and the BLUP values were used as the data for joint analysis of multiple environments to draw a histogram of the phenotype distribution and for joint QTL mapping of multiple environments.
[0138] 1.2.6 Construction of linkage map
[0139] At the 5-6 leaf stage of maize, 5 tender leaves with uniform growth from each family (all families included in the mapping population) were mixed, and genomic DNA was extracted using the conventional CTAB method. Genotype data were generated by Liaoning Dongya Crop Seed Quality Inspection and Testing Co., Ltd., and genotyping analysis was performed using the Maize6H-60K chip independently developed by the Beijing Academy of Agriculture and Forestry Sciences Maize Research Center. Linkage map construction was completed using QTL ICImapping 4.2 software. The markers were filtered and screened using the ".snp" function, and markers with the same parents (P1=P2), missing or heterozygous parents, and no polymorphism in the offspring were deleted. Redundant markers were deleted to obtain Bin markers using the ".bin" function (threshold set to missing rate greater than 15% and P value of segregation less than 0.001); the ".map" function was used to construct a linkage map, and the Kosambi function was used to estimate genetic distance. Finally, a total of 40812 polymorphic SNP markers were screened, and redundant markers were removed and combined into 8257 bin markers. 1.2.7 QTL mapping
[0140] 1.2.7 QTL mapping
[0141] Based on the constructed high-density linkage map, combined with the disease grading phenotype values of the recombinant inbred line population in single environment and multi-environment joint analysis, QTL detection of Fusarium stem rot resistance of F. graminearum was carried out. The composite interval mapping method (CIM) of Windows QTL Cartographer V2.5 software was used for initial positioning and genetic effect analysis, the LOD threshold was set to 1000 times of simulation operation (Permutation), the significant level P value was less than 0.05, and finally the threshold line was set to LOD = 3, and the confidence interval of the target QTL was determined according to the peak value of LOD value on both sides, which decreased by 2 LOD values. Select QTL identified in multiple environments or QTL explaining more than 10% of the phenotypic variation in a single environment for effect verification and fine mapping.
[0142] In the QTL positioning of corn stem rot resistance, the phenotype identification of the RIL family of the positioning population was based on: selecting 10 plants with consistent growth vigor in each family in a single environment, observing and recording the stem rot disease occurrence one by one, and finally taking the average value of the 10 materials as the family phenotype value; the best linear unbiased prediction (Best Linear Unbiased Prediction, BLUP) of the RIL population phenotype value in multiple environments was calculated by using the phenotype mean value of each family in a single environment.
[0143] 1.2.8 Development of molecular markers and QTL effect verification
[0144] Select the polymorphic SNPs located in the target QTL segment to develop KASP markers for effect verification. The KASP marker primer design parameters are as follows: the primer length is 20-27 bp, the GC content is between 40%-60%, and the annealing temperature is between 59℃-65℃ (the optimum temperature is 63℃). The 5' end of the designed forward primer is added with a fluorescent linker sequence, the FAM linker sequence is 5'-gaaggtgaccaagttcatgct-3', and the HEX linker sequence is 5'-gaaggtcggagtcaacggatt-3'. The primers are synthesized by Shanghai Sungene Biotech Co., Ltd.
[0145] The PCR reaction system is as follows: the total system is 4 μL, including 2 μL HiGeno 2×Probe Mix, 1 μL DNA template (20-50 ng / μL), 0.944 μL ddH2O and 0.056 μL primer mixture (preferably primer mixture ratio: 12 μL (100 μM) of forward primers Primer X and Primer Y, 30 μL of reverse primer Primer R (100 μM), and 46 μL of ddH2O).
[0146] The PCR reaction program was as follows: pre-denaturation at 94°C for 15 min, first amplification reaction, denaturation at 94°C for 20 s, annealing at 61°C for 60 s, for 10 cycles, and second amplification reaction, denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, for 38 cycles.
[0147] PCR products were scanned and fluorescence data were read using a FLUOstar Omega microplate reader (BMG Labtech, Offenburg, Germany). Genotype data were read and clustered using the SNP typing software KclusterCaller (V 3.4.1.36; LGCHoddesdon, UK). The genotype of the FAM allele was X:X, the genotype of the HEX allele was Y:Y, and the heterozygous genotype was X:Y.
[0148] 1.2.9 QTL effect verification and fine mapping
[0149] The QTL effect was verified and finely positioned by the recombinant progeny verification method. Based on the initial QTL positioning results, the remaining heterozygous lines with fixed background genotypes in the target segment were screened in the RIL population, and KASP markers were developed to screen for individuals that exchanged in the target segment. The key recombinant individuals were verified by the genotype and stem rot phenotype of the offspring for effect verification and fine positioning. 60-180 plants of each recombinant individual were planted for genotype and stem rot disease grading, and the disease severity index (DSI) of each genotype was calculated. The difference in resistance to Fusarium graminearum stem rot of corn between different genotypes was analyzed using a one-tailed t-test, and the difference between different genotypes was significant ( P <0.05) indicates that the major QTL is located in the heterozygous region, and vice versa.
[0150] The DSI is calculated as follows: .
[0151] 2. Results and Analysis
[0152] 2.1 Phenotypic variation in resistance to Fusarium graminearum stem rot in maize
[0153] Identification of resistance to Fusarium graminearum stem rot in RIL populations and parental materials under different environments ( Figure 1), the statistical analysis results showed that there were significant differences between the parent materials in different groups (Table 2). In the RIL population, the disease grade showed extensive continuous variation between different environments, indicating that the resistance to stem rot was a quantitative trait controlled by multiple genes. The variation range of disease grade was 1.00-9.00, the mean was between 4.21-4.50, and the coefficient of variation was 40.92%-51.49%. After calculating the BLUP value to eliminate the environmental influence, the coefficient of variation of disease grade in RIL population decreased to 33.52%, and the disease grade in single environment showed a skewed normal distribution (Fig. 1). Figure 2 ), and the BLUP value showed a normal distribution in multiple environments.
[0154] The results of joint variance analysis showed (Table 3) that the difference between genotypes in RIL population was extremely significant, and the difference between environments and the interaction between genotypes and environments was extremely significant. The genetic variance estimate was greater than the variance estimate of environment and genotype-environment interaction, indicating that the genetic factor was the main source of variation, and was greatly affected by the environment. The heritability of stem rot resistance was 81.01%.
[0155] Table 2
[0156]
[0157] Table 3 Variance and heritability analysis of stem rot phenotype in multiple environments
[0158]
[0159] 2.2 Construction of linkage map
[0160] A linkage map was constructed using 215 RIL families combined with 8,257 bin markers. The total length of the map was 6,541 cM, and the average genetic distance between adjacent markers was 0.79 cM. Chromosome 1 was the longest, with a length of 926.78 cM and 1,191 markers distributed; chromosome 10 was the shortest, with a length of 385.39 cM and 393 markers distributed.
[0161] 2.3 QTL mapping of corn Fusarium graminearum stem rot resistance
[0162] Using the phenotypic data of disease grade in single environment and multiple environment joint analysis, QTL mapping of corn Fusarium graminearum stem rot resistance was performed by WinQTLCart V 2.5 composite interval mapping method. One QTL was detected on chromosome 2 bin2.02 ( Figure 3), with a physical location between 10,606,703 bp and 14,892,011 bp, and a confidence interval of approximately 4.29 Mb (referenced to the B73AGP_V3 genome). This QTL was co-located in both 2020YL and 2021YL varieties, explaining 5.40%-15.60% of the phenotypic variation. The disease resistance allele originated from KA105, and the locus exhibited environmental specificity (Table 4).
[0163] Table 4 QTL analysis of disease grade of Fusarium graminearum stem rot under single and combined environments
[0164]
[0165] 2.4 Verification and fine mapping of QTL effects for resistance to Fusarium graminearum stem rot
[0166] Among 215 F7RIL families, one heterozygous genotype in the target QTL candidate interval was screened, and the remaining heterozygous line material KHRIL-187, which had a relatively fixed background genotype, was self-pollinated to obtain seeds of segregating population progeny. The developed molecular markers (Table 5) were used to screen individuals that exchanged in the target segment. The key recombinant individuals were finely located by progeny testing. For each recombinant single plant, 100-200 plants were planted to identify the genotype and stem rot resistance phenotype. The effect verification of the target QTL showed that the homozygous allele from the disease-resistant parent can significantly improve the field resistance to stem rot ( P <0.001) ( Figure 4 Among them, the average DSI of the homozygous disease-resistant KA105 / KA105 genotype plants was 31.48%, and the average DSI of the homozygous disease-susceptible HZ4 / HZ4 genotype plants was 55.42%. The t-test results in the population showed that there was a very significant difference in DSI between the homozygous disease-resistant and disease-susceptible genotypes ( P <0.001). In summary, the resistance QTL effect was detected using the remaining heterozygous line material KHRIL-187, and the experimental results showed significant differences, indicating that the genetic effect of this locus on resistance to Fusarium graminearum stem rot is real. The QTL locus with a homozygous disease-resistant allele can reduce the DSI by about 23.94%, significantly improving the plant's field resistance to Fusarium graminearum stem rot.
[0167] Three molecular markers were encrypted within the candidate interval of the target QTL, and the molecular marker primers were designed with reference to the V3 version sequence of the maize B73 reference genome. The molecular markers Ks1 and Ks3 at both ends of the candidate interval, Ks1 is located at position 12360576 of maize chromosome 2, with the mutant base being A or G; Ks3 is located at position 14116694 of maize chromosome 2, with the mutant base being A or C. The newly developed markers were used to divide the offspring of the segregating population into two recombinant types, and the target QTL was finely positioned using the progeny test method. The results showed that the DSI of plants carrying the homozygous KA105 genotype and the homozygous HZ4 genotype in types I and II were both extremely significantly different ( P <0.001) ( Figure 4 (B) indicates that the target QTL is present in the heterozygous segments of both recombination types. In type II, the heterozygous genotype is at molecular marker Ks2, while the homozygous susceptible genotypes are at molecular markers Ks1 and Ks3. The candidate QTL interval is inferred to be located between molecular markers Ks1 and Ks3, with a physical distance of approximately 1.75 Mb (B73 AGP_V3).
[0168] The detailed information of the molecular markers developed above that are tightly linked to the maize stalk rot resistance QTL is as follows (the locations of the molecular markers are referenced to the B73 AGP_V3 genome):
[0169] (1) Molecular marker Ks1: The polymorphic site is located at nucleotide 12360576 on maize chromosome 2, and the polymorphism is A / G;
[0170] (2) Molecular marker Ks3: The polymorphic site is located at nucleotide 14116694 on maize chromosome 2, and the polymorphism is A / C.
[0171] Among them, the molecular marker Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 200 as shown in SEQ ID NO.1, and the molecular marker Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 200 as shown in SEQ ID NO.2.
[0172] Optionally, the nucleotide sequence of the molecular marker Ks1 is as shown in SEQ ID NO.1, the polymorphic site is located at the 50th position of the sequence shown in SEQ ID NO.1, and the polymorphism is A / G; the nucleotide sequence of the molecular marker Ks3 is as shown in SEQ ID NO.2, the polymorphic site is located at the 50th position of the sequence shown in SEQ ID NO.2, and the polymorphism is A / C.
[0173] SEQ ID NO.1:
[0174] GAAATTTACTGGTTAGCGCCAGACATGCAGCTTATAGACAGGGGTTTGGRCACCATGTTTATTTTTTTACTATAAATACACAGTGGGAAACTAAAATAAT, wherein R represents A / G.
[0175] SEQ ID NO. 2:
[0176] AAGTATGTGATAAGAGCTGCGGCAGGAGTTGGTCATCAGCTTGTCAAAAMCCCTCTTTCTCAATTGATTGACAGTGCCACCAGGACGGCTTGCGAAACTA, wherein M represents A / C.
[0177] The KASP primer set information developed based on the above SNP molecular marker is shown in Table 5.
[0178] Table 5 Primers of KASP markers for QTL effect verification
[0179]
[0180] Note: The lower case gaaggtgaccaagttcatgct is a specific fluorescent tag sequence FAM; the lower case gaaggtcggagtcaacggatt is a specific fluorescent tag sequence HEX.
[0181] Example 2 Application of a QTL for Fusarium verticillioides stalk rot resistance in maize and its closely linked molecular marker
[0182] The substance for detecting the polymorphism or genotype of the SNP molecular marker site closely linked to the QTL for Fusarium verticillioides stalk rot resistance in maize at least has the following applications:
[0183] (1) Identifying or assisting in identifying corn resistant to stalk rot;
[0184] (2) Preparing related products for identifying or assisting in identifying corn resistant to stalk rot;
[0185] (3) Corn assisted breeding or preparing products for corn assisted breeding.
[0186] The method for identifying or assisting in identifying the stalk rot resistance of corn using the molecular marker closely linked to the QTL for corn stalk rot resistance is as follows:
[0187] If the genotype of the molecular marker Ks1 in the corn to be tested is AA, the genotype of the target QTL site is a disease-resistant gene; if the genotype of the molecular marker Ks1 in the corn to be tested is GG, the genotype of the target QTL site is a disease-susceptible gene;
[0188] If the genotype of the molecular marker Ks3 in the corn to be tested is AA, the genotype of the target QTL site is a disease-resistant gene; if the genotype of the molecular marker Ks3 in the corn to be tested is CC, the genotype of the target QTL site is a disease-susceptible gene;
[0189] In summary, corn with the genotype AA of the molecular marker Ks1 and the genotype AA of the molecular marker Ks3 is selected as the breeding parent for stem rot resistance.
[0190] The SNP molecular marker developed in Example 1 is used for screening of corn stem rot resistance materials. The test materials are 214 recombinant inbred lines in addition to the target QTL fine mapping family KHRIL-187 in the RIL population. Fifty-five recombinant inbred lines are screened for homozygous genotype at Ks1 and Ks3 molecular markers. Phenotypic identification of stem rot is performed. It is found that when the genotypes of molecular markers Ks1 and Ks3 are both homozygous disease-resistant alleles AA, among 20 recombinant inbred lines, 16 exhibit high resistance to stem rot, with disease severity classification between 1.81 and 2.81, and the accuracy rate of stem rot resistance identification is 80%; when only the molecular marker Ks1 is a homozygous disease-resistant allele AA, among 24 recombinant inbred lines, 12 exhibit resistance to stem rot, including 9 families with high resistance to stem rot, with disease severity classification between 1 and 3, and the accuracy rate of stem rot resistance identification is 50%; when only the molecular marker Ks3 is a homozygous disease-resistant allele AA, among 20 recombinant inbred lines, 5 exhibit high resistance to stem rot, with disease severity classification of 1, and the accuracy rate of stem rot resistance identification is 25%; when the genotypes of molecular markers Ks1 and Ks3 are both homozygous disease-susceptible alleles GG and CC, among 23 recombinant inbred lines, 18 exhibit high susceptibility to stem rot, with disease severity classification between 6.83 and 8.51, and the accuracy rate of stem rot susceptibility identification is 78%. In order to expand the sample size, the phenotypic values of single plants of 12 families are selected for screening of corn stem rot resistance materials, which are KHRIL-102, KHRIL-149, KHRIL-154, KHRIL-199, KHRIL-168, KHRIL-148, KHRIL-68, KHRIL-205, KHRIL-204, KHRIL-176, KHRIL-099, and KHRIL-123. The identification results are shown in Table 6, in which the disease severity classification of a single family is represented by the BLUP value using multi-environment joint analysis, and the disease severity classification of a single plant of a family is represented by the phenotypic value of a single plant in the 2021 SY environment. The accuracy rate of phenotypic identification is shown in Table 7.
[0191] Table 6 Allelic genotypes of molecular markers Ks1 and Ks3 and phenotypes
[0192]
[0193] Note: Ks1: AA (resistant allele), GG (susceptible allele); Ks3: AA (resistant allele), CC (susceptible allele).
[0194] Table 7 Identification accuracy of molecular markers Ks1 and Ks3 for stem rot resistance
[0195]
[0196] Note: In the estimation of the identification accuracy of stem rot resistance, the family of the recombinant inbred line showing high resistance and resistance is considered as resistant material. Ks1: AA (resistant allele), GG (susceptible allele); Ks3: AA (resistant allele), CC (susceptible allele).
[0197] The above results show that the SNP molecular markers Ks1 and Ks3 tightly linked to QTL can be used for identification of corn stem rot resistance. When Ks1 is used alone, the accuracy of stem rot resistance identification is about 50%; when Ks3 is used alone, the accuracy of stem rot resistance identification is about 25%; when both are used for detection, the accuracy of stem rot resistance identification is 80%. It can be seen that the SNP molecular markers Ks1 and Ks3 used for identification of corn stem rot resistance have high accuracy, and are effective for the assisted selection of corn resistance to stem rot phenotype.
[0198] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application, and not to limit it; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Claims
1. Use of a SNP molecular marker associated with corn stalk rot resistance, or a primer set for amplifying the molecular marker, or a kit comprising the primer set in identifying or assisting in identifying corn stalk rot resistance; in, The SNP molecular markers associated with corn stalk rot resistance include molecular marker Ks1 and molecular marker Ks3. Referring to the B73 AGP_V3 genome, the polymorphic site of the molecular marker Ks1 is located at position 12360576 on corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116694 on corn chromosome 2, and the polymorphism is A / C.
2. Use of a SNP molecular marker associated with corn stalk rot resistance, or a primer set for amplifying the molecular marker, or a kit comprising the primer set, in the preparation of a product for identifying or assisting in identifying corn stalk rot resistance; in, The SNP molecular markers associated with corn stalk rot resistance include molecular marker Ks1 and molecular marker Ks3. Referring to the B73 AGP_V3 genome, the polymorphic site of the molecular marker Ks1 is located at position 12360576 on corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116694 on corn chromosome 2, and the polymorphism is A / C.
3. Use of a SNP molecular marker associated with corn stalk rot resistance, a primer set for amplifying the molecular marker, or a kit comprising the primer set in the early prediction of corn stalk rot resistance; in, The SNP molecular markers associated with corn stalk rot resistance include molecular marker Ks1 and molecular marker Ks3. Referring to the B73 AGP_V3 genome, the polymorphic site of the molecular marker Ks1 is located at position 12360576 on corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116694 on corn chromosome 2, and the polymorphism is A / C.
4. Use of a SNP molecular marker associated with corn stalk rot resistance, or a primer set for amplifying the molecular marker, or a kit comprising the primer set in screening corn for stalk rot resistance; in, The SNP molecular markers associated with corn stalk rot resistance include molecular marker Ks1 and molecular marker Ks3. Referring to the B73 AGP_V3 genome, the polymorphic site of the molecular marker Ks1 is located at position 12360576 on corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116694 on corn chromosome 2, and the polymorphism is A / C.
5. Use of a SNP molecular marker associated with corn stalk rot resistance, or a primer set for amplifying the molecular marker, or a kit comprising the primer set in marker-assisted breeding for corn stalk rot resistance; in, The SNP molecular markers associated with corn stalk rot resistance include molecular marker Ks1 and molecular marker Ks3. Referring to the B73 AGP_V3 genome, the polymorphic site of the molecular marker Ks1 is located at position 12360576 on corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116694 on corn chromosome 2, and the polymorphism is A / C.
6. Use of a SNP molecular marker associated with corn stalk rot resistance, or a primer set for amplifying the molecular marker, or a kit comprising the primer set, in the preparation of a product for molecular marker-assisted breeding of corn stalk rot resistance; in, The SNP molecular markers associated with corn stalk rot resistance include molecular marker Ks1 and molecular marker Ks3. Referring to the B73 AGP_V3 genome, the polymorphic site of the molecular marker Ks1 is located at position 12360576 on corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116694 on corn chromosome 2, and the polymorphism is A / C.
7. Use of SNP molecular markers associated with corn stalk rot resistance, primer sets for amplifying said molecular markers, or kits containing said primer sets in improving corn stalk rot resistance germplasm resources; in, The SNP molecular markers associated with corn stalk rot resistance include molecular marker Ks1 and molecular marker Ks3. Referring to the B73 AGP_V3 genome, the polymorphic site of the molecular marker Ks1 is located at position 12360576 on corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116694 on corn chromosome 2, and the polymorphism is A / C.
8. A method for identifying corn stalk rot resistance, characterized in that: The method comprises: Using the genomic DNA of the maize to be identified as a template, PCR amplification of SNP molecular markers associated with maize stalk rot resistance was performed; analyzing the genotype of the SNP molecular marker associated with corn stalk rot resistance in the PCR amplification product, and determining the stalk rot resistance of the corn to be identified based on the genotype; Among them, the SNP molecular markers associated with corn stalk rot resistance include molecular markers Ks1 and Ks3. Referring to the B73 AGP_V3 genome, the polymorphic site of the molecular marker Ks1 is located at position 12360576 on corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116694 on corn chromosome 2, and the polymorphism is A / C; In the molecular marker Ks1, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot; in the molecular marker Ks3, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.
9. A method for screening corn plants for resistance to stalk rot, characterized in that The method comprises the following steps: (1) Isolation of nucleic acids from corn plants; (2) detecting SNP molecular markers associated with corn stalk rot resistance in the nucleic acid; (3) selecting corn plants having stalk rot resistance based on the presence of the SNP molecular marker detected in step (2); Among them, the SNP molecular markers associated with corn stalk rot resistance include molecular markers Ks1 and Ks3. Referring to the B73 AGP_V3 genome, the polymorphic site of the molecular marker Ks1 is located at position 12360576 on corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116694 on corn chromosome 2, and the polymorphism is A / C; The selection refers to selecting the corn plant when the genotype of the polymorphic site of the SNP molecular marker Ks1 in the isolated nucleic acid is AA and the genotype of the polymorphic site of the SNP molecular marker Ks3 is AA.
Citation Information
Patent Citations
Development and application of KASP marker related to corn stem rot resistance gene
CN115992289A
Maize plants with improved disease resistance
US20180116140A1