A multi-mode biosensor and its preparation method and application

Abstract

The application belongs to the technical field of biological detection, and particularly relates to a multi-mode biosensor and a preparation method and application thereof. The multi-mode biosensor takes a magnetic covalent organic framework as a substrate, takes a gold nanoparticle modified enrofloxacin aptamer as a recognition site, and is connected through adsorption of the substrate and the recognition site to construct the multi-mode biosensor. The multi-mode biosensor provided by the application is adsorbed on Fe3O4@COF through the Au NCs modified enrofloxacin aptamer through electrostatic adsorption and pi-pi stacking adsorption. Because the COF has excellent fluorescence quenching capacity, the red light of the Au NCs disappears, and the peroxidase-like activity is reduced. When the measured substance ENR is added, the aptamer specifically recognizes. Because the aptamer and the ENR have higher affinity, the aptamer falls off from the surface of the COF. The adsorption and falling off of the aptamer cause changes in the fluorescence signal and the enzyme activity, so that accurate and specific detection is performed.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological detection, and particularly relates to a multi-mode biosensor and a preparation method and application thereof. BACKGROUND

[0002] Enrofloxacin, abbreviated as ENR, English full name Enrofloxacin, has good antibacterial effect, and is mainly used for treating gram-negative bacteria and gram-positive bacteria, and is widely used as veterinary drugs to treat infectious diseases of livestock and poultry. However, in recent years, the abuse of ENR in the livestock industry has become more and more serious, and excessive use will produce drug-resistant bacteria and residues in animal-derived products. Long-term consumption of food containing ENR will cause allergies, carcinogenesis, teratogenicity, etc. Among them, the maximum residue amount of ENR in animal-derived food is 100 μg / kg.

[0003] Traditional detection methods of ENR include high performance liquid chromatography, liquid chromatography-mass spectrometry and capillary electrophoresis, etc. These detection methods are accurate, but have the disadvantages of long time consumption, complex sample pretreatment, expensive machine equipment and the need for professional operation, etc., and are not suitable for real-time detection on site. Therefore, how to accurately, conveniently and quickly detect ENR in animal-derived food or water is very important.

[0004] At present, nanoenzyme is an enzyme mimic based on nanomaterials, which usually has high stability, low cost and good catalytic activity, and is a good substitute for natural enzymes. Due to its easy modification, strong substrate specificity and biocompatibility, it is used in many fields such as material science, chemistry, biological detection, medicine and environment, etc. At present, nanoenzyme is often combined with colorimetric method to quickly and accurately detect the analyte, and the nanoenzyme colorimetric analysis method mainly relies on the color change of chromogenic substrate 3,3',5,5'-tetramethylbenzidine and the change of ultraviolet absorption signal. The color change of the system solution is obvious, and the naked eye can easily observe it, so it is more suitable for real-time and on-site detection in outdoor scenes. For example, Peng's group synthesized dopamine-coordinated iron-based nanoenzyme with peroxidase activity, and prepared a colorimetric sensor for detecting norfloxacin by using the interaction between norfloxacin and L-cysteine. However, in most cases, the sensitivity of the colorimetric sensor is insufficient, which limits the practical application of these sensors. SUMMARY

[0005] In order to solve the above problems, the application provides a multi-mode biosensor and a preparation method and application thereof. The multi-mode biosensor provided by the application is based on a magnetic covalent organic framework as a substrate, and the magnetic covalent organic framework is abbreviated as Fe3O4@COF. The Fe3O4@COF has a core-shell structure, the substrate has good peroxidase-like activity and magnetism, and an enrofloxacin aptamer modified by gold nanoparticles is used as a recognition site. The gold nanoparticles are abbreviated as Au NCs. The enrofloxacin aptamer modified by the gold nanoparticles is adsorbed on the Fe3O4@COF through electrostatic adsorption and π-π stacking adsorption. Since the organic framework has excellent fluorescence quenching ability, the organic framework is abbreviated as COF, which causes the red light of the Au NCs to disappear and the peroxidase-like activity to decrease. When the multi-mode biosensor is used for detecting a to-be-detected substance ENR, after the to-be-detected substance ENR is added, the aptamer specifically recognizes. Since the aptamer and the ENR have higher affinity, the aptamer will fall off from the surface of the COF. The adsorption and falling off of the aptamer cause changes in the fluorescence signal and the enzyme activity, so that accurate and specific detection is performed. The multi-mode biosensor has the advantages of good selectivity, easy separation, high accuracy, low detection limit, wide range and multi-mode detection. The analysis method is simple to operate and has great application potential in on-site detection of antibiotic residues in the environment and food.

[0006] The application solves the above technical problems through the following technical solutions.

[0007] The application is based on ligand regulation of nanoscale enzyme activity and induction of FRET "switch", and develops a biosensor with high sensitivity, selectivity and multi-mode. The first object of the application is to provide a multi-mode biosensor. A magnetic covalent organic framework is used as a substrate, and an enrofloxacin aptamer modified by gold nanoparticles is used as a recognition site. The multi-mode biosensor is constructed by adsorption and connection of the substrate and the recognition site. The enrofloxacin aptamer modified by the gold nanoparticles is based on the enrofloxacin aptamer as a carrier, and the gold nanoparticles are cross-linked and loaded on the enrofloxacin aptamer.

[0008] The multimode biosensor provided by the application takes Fe3O4@COF as a substrate, the substrate has good peroxidase-like activity and magnetism, has excellent catalytic performance, and can catalyze the oxidation of an enzyme-substrate under the action of H2O2, that is, the oxidation of 3,3', 5,5'-tetramethylbenzidine enzyme substrate, and the abbreviation of 3,3', 5,5'-tetramethylbenzidine enzyme substrate is TMB, to produce blue oxidation product ox-TMB. The ENR aptamer modified by the red light of Au NCs is used as a recognition site, the enrofloxacin aptamer modified by the Au NCs is adsorbed on the Fe3O4@COF through electrostatic adsorption and π-π stacking, and the multimode biosensor is constructed. Because the COF has excellent fluorescence quenching ability, the aptamer has specific recognition, and the aptamer and the ENR have higher affinity, the aptamer will fall off from the surface of the COF, the red light of the Au NCs disappears, the adsorption and falling off of the aptamer cause the changes of the fluorescence signal and the enzyme activity, and accurate and specific detection is performed.

[0009] A second object of the application is to provide a preparation method of the multimode biosensor.

[0010] S1, mixing enrofloxacin aptamer and a crosslinking agent and stirring and reacting at 37 DEG C, adding a gold nanoparticle solution to the enrofloxacin aptamer, and performing modification reaction under the action of the crosslinking agent to obtain an enrofloxacin aptamer solution modified by Au NCs;

[0011] S2, adding a magnetic covalent organic framework solution to the gold nanoparticle-modified enrofloxacin aptamer solution to perform adsorption connection reaction, and obtaining the multimode biosensor.

[0012] The multimode biosensor provided by the application takes Fe3O4@COF as a substrate, the substrate has good peroxidase-like activity and magnetism, has excellent catalytic performance, and can catalyze the oxidation of an enzyme-substrate under the action of H2O2, that is, the oxidation of 3,3', 5,5'-tetramethylbenzidine enzyme substrate, and the abbreviation of 3,3', 5,5'-tetramethylbenzidine enzyme substrate is TMB, to produce blue oxidation product ox-TMB. The ENR aptamer modified by the red light of Au NCs is used as a recognition site, the enrofloxacin aptamer modified by the Au NCs is adsorbed on the Fe3O4@COF through electrostatic adsorption and π-π stacking, and the multimode biosensor is constructed. Because the COF has excellent fluorescence quenching ability, the aptamer has specific recognition, and the aptamer and the ENR have higher affinity, the aptamer will fall off from the surface of the COF, the red light of the Au NCs disappears, the adsorption and falling off of the aptamer cause the changes of the fluorescence signal and the enzyme activity, and accurate and specific detection is performed.

[0013] In some embodiments, the volume ratio of the enrofloxacin aptamer and the gold nanoparticle solution is 1:5-20, the concentration of the enrofloxacin aptamer is 10-20 muM, and the concentration of the gold nanoparticle solution is 4-10 mM. It should be noted that the concentration of the enrofloxacin aptamer is 10-20 muM, and the purpose is to enable the enrofloxacin aptamer to be modified with sufficient Au NCs, so as to obtain high fluorescence determination results in subsequent fluorescence spectrum experiments.

[0014] In some embodiments, the volume ratio of enrofloxacin aptamer and cross-linking agent is 1:0.5-2, and the concentration of the cross-linking agent is 0.5 mM-2 mM; the modification reaction is carried out at 37°C overnight with stirring. It should be noted that the purpose of the cross-linking agent is to efficiently activate the aptamer and promote the full interaction of the aptamer with the Au NCs. Preferably, the cross-linking agent is a mixture of 1-ethyl-(3-dimethylaminopropyl) carbodiimide and N-hydroxysuccinimide in a mass ratio of 1:1.

[0015] In some embodiments, the nucleotide sequence of the enrofloxacin aptamer is: CCCATCAGGGGGCTAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTCAGGGGGA.

[0016] In some embodiments, the volume ratio of the gold nanoparticle-modified enrofloxacin aptamer solution and the magnetic covalent organic framework solution is 1:0.2-1, the concentration of the magnetic covalent organic framework solution is 2 mg / L-5 mg / L, and the final concentration of the gold nanoparticle-modified enrofloxacin aptamer solution is 100 nM-700 nM. It should be noted that the concentration of the magnetic covalent organic framework solution is 2 mg / L-5 mg / L, and the purpose is to load enough gold nanoparticle-modified enrofloxacin aptamer on the magnetic covalent organic framework. The abbreviation of the gold nanoparticle-modified enrofloxacin aptamer is Apt-Au NCs, the COF has excellent fluorescence quenching ability, the aptamer has specific recognition, and the aptamer has higher affinity with ENR, which will fall off from the surface of the COF. The red light of the Au NCs disappears, the adsorption and falling off of the aptamer cause changes in the fluorescence signal and enzyme activity, thereby enabling accurate and specific detection.

[0017] In some embodiments, the adsorption connection reaction is carried out at room temperature with oscillation for 5 min-10 min.

[0018] In some embodiments, the preparation method of the gold nanoparticle solution comprises the following steps:

[0019] Under the condition of stirring at 37°C, the HAuCl4 solution is added to the bovine serum albumin solution, and then the NaOH solution is added to adjust the pH value to 12. The luminescent gold nanoparticle solution is obtained by stirring overnight at 37°C.

[0020] In some embodiments, the volume ratio of the HAuCl4 solution and the bovine serum albumin solution is 1:1, the concentration of the HAuCl4 solution is 1 mM, and the concentration of the bovine serum albumin solution is 50 mg / mL.

[0021] The application synthesizes Au NCs solution by using HAuCl4 as a precursor of Au atom, using bovine serum albumin as a reducing agent and a protective agent, and using a one-pot synthesis method.

[0022] In some embodiments, the method for preparing a magnetic covalent organic framework solution comprises the following steps:

[0023] Step 1, synthesizing Fe3O4 NPs by using a solvothermal method: FeCl3.6H2O, anhydrous sodium acetate and sodium citrate are dissolved in a solvent to obtain a mixed solution A, the mixed solution A is stirred and mixed uniformly, and then is transferred into a reaction kettle, and is subjected to a solvothermal reaction at 200 DEG C, after the reaction is completed, the product is collected by a magnet, is washed and dried to obtain Fe3O4 NPs.

[0024] The mass ratio of FeCl3.6H2O, anhydrous sodium acetate and sodium citrate is 1.36:2.4:0.4, and the solvothermal reaction time is 14 h.

[0025] Step 2, synthesizing a magnetic covalent organic framework Fe3O4@COF NPs solution: 2,5-dimethoxy terephthaldehyde and 1,3,5-tri(4-aminophenyl) benzene are dissolved in a mixed solvent, and are mixed uniformly, then Fe3O4 NPs are added, and after ultrasonic mixing, acetic acid is added to make the COF NPs preliminarily polymerize, after stirring at room temperature for 2 h, acetic acid solution is continuously added to make the polymerization reaction more complete, and mixed solution B is obtained, the mixed solution B is transferred into a reaction kettle, and is subjected to a solvothermal reaction at 70 DEG C, after the reaction is completed, the product is collected by a magnet, is washed and dried to obtain magnetic covalent organic framework Fe3O4@COF NPs.

[0026] The mass ratio of 2,5-dimethoxy terephthaldehyde, 1,3,5-tri(4-aminophenyl) benzene and Fe3O4 NPs is 34.8:42:36, and the solvothermal reaction time is 48 h.

[0027] The application synthesizes a COF with an imine bond -C=N- by condensation of 2,5-dimethoxy-p-xylene dicarboxaldehyde and 1,3,5-tri-4-aminobenzene, and then modifies the COF on magnetic Fe3O4 NPs to obtain a magnetic material Fe3O4@COF with a core-shell structure.

[0028] The application also provides application of the above-mentioned multi-mode biosensor in detection of enrofloxacin in water or food, and the food includes milk and chicken.

[0029] After the to-be-detected substance ENR, the aptamer specifically recognizes, and due to the higher affinity between the aptamer and the ENR, in the presence of the ENR, the Apt-Au NCs are induced to separate from the surface of the Fe3O4@COF, the Apt-Au NCs fall off from the surface of the COF, resulting in recovery of the Apt-Au NCs fluorescence, and then recovery of the red fluorescence and the enzyme activity, and the peroxidase-like activity of the Fe3O4@COF is increased to perform accurate and specific detection.

[0030] In some embodiments, the detection mode of the biosensor is fluorescence method, colorimetric method or intelligent image recognition method.

[0031] The biosensor prepared in the application has multiple detection modes, and the multi-mode sensing strategy of fluorescence, colorimetric and intelligent image recognition method has the advantages of wide linear range, low detection limit and good selectivity, and has good analysis performance for detection of ENR.

[0032] In some embodiments, the intelligent image recognition method comprises the following steps:

[0033] S1, using image processing software, reading the RGB value of the sample containing different known enrofloxacin concentration after color development, calculating the gray value through the RGB value, constructing the detection linear response relationship between enrofloxacin concentration and gray value, and selecting the curve with the highest fitting degree as the enrofloxacin detection standard curve.

[0034] The detection linear regression equation of enrofloxacin concentration and gray value is y1=-15.8249x1+163.7164, wherein x1 is the gray value, y1 is the enrofloxacin concentration in the sample to be measured, the detection linear range is 10 ng / mL to 5*10 4 ng / mL, and the detection limit is 0.12 ng / mL.

[0035] S2, according to the obtained enrofloxacin detection linear regression equation and the measured gray value of the sample to be measured, the concentration of enrofloxacin in the sample to be measured is obtained.

[0036] The image processing software is software with the functions of shooting color images and reading RGB values, and in the present application, the image processing software is the application program Color Grap in a smart phone, the RGB value is read through the application program Color Grap, the gray value is calculated through the formula I=0.3R+0.59G+0.11B, and the standard curve is constructed, wherein I is the gray value, R, G and B respectively represent the intensity of red, green and blue three primary colors. The smart image recognition method realizes intuitive analysis of rapid real-time detection of ENR, and has the advantages of good selectivity, easy separation, high accuracy, low detection limit, wide range and multi-mode detection, and the like. The analysis method is simple to operate, has great application potential in on-site detection of antibiotic residues in environment and food.

[0037] Compared with the prior art, the present application has the following beneficial effects:

[0038] (1) The multimodal biosensor provided by the application is based on a covalent organic framework Fe3O4@COF as a substrate, the substrate has good peroxidase-like activity and magnetism, an enrofloxacin aptamer modified by Au NCs is used as a recognition site, the enrofloxacin aptamer modified by Au NCs is adsorbed on the Fe3O4@COF through electrostatic adsorption and pi-pi stacking adsorption, because the COF has excellent fluorescence quenching capability, the red light of the Au NCs disappears, and the peroxidase-like activity is reduced. When the multimodal biosensor is used for detecting the to-be-detected substance ENR, after the to-be-detected substance ENR is added, the aptamer specifically recognizes, because the enrofloxacin aptamer modified by Au NCs and the ENR have higher affinity, the enrofloxacin aptamer modified by Au NCs falls off from the surface of the COF, the adsorption and falling off of the aptamer cause changes in the fluorescence signal and the enzyme activity, so that accurate and specific detection is carried out, and the multimodal biosensor has the advantages of good selectivity, easy separation, high accuracy, low detection limit, wide range and multimodal detection. The analysis method is simple to operate, and has great application potential in on-site detection of antibiotic residues in the environment and food.

[0039] (2) The multimodal biosensor prepared by the application is based on a covalent organic framework Fe3O4@COF as a substrate, the covalent organic framework Fe3O4@COF has a unique core-shell structure, the surface has rich carboxyl groups, which is beneficial to the subsequent coating of the COF and increases the fluorescence quenching capability of the COF, and the Fe3O4@COF is a nanomaterial, has good peroxidase-like activity and magnetism, has excellent catalytic performance, can catalyze the oxidation of TMB under the action of H2O2 to produce a blue product ox-TMB, increases the affinity between the enzyme and the substrate, and improves the oxidase activity, and then based on the ligand regulating the nanozyme activity and inducing the FRET "switch", a kind of biosensor with high sensitivity, selectivity and multimodal is developed. BRIEF DESCRIPTION OF DRAWINGS

[0040] Figure 1 It is the morphology structure diagram of Fe3O4@COF of the embodiment 1 of the application.

[0041] Figure 2 It is the infrared spectrum diagram of Fe3O4@COF and COF of the embodiment 1 of the application.

[0042] Figure 3 It is the X-ray diffraction spectrum diagram of Fe3O4NPs and Fe3O4@COF of the embodiment 1.

[0043] Figure 4 It is the zeta potential value diagram of Aptamer, Apt-Au NCs, COF, Fe3O4@COF and Apt-Au NCs-Fe3O4@COF of the embodiment 1 of the application.

[0044] Figure 5X-ray photoelectron spectrogram of Fe3O4@COF of embodiment 1 of the present application. Figure 5 Figure A in the figure is a spectrogram of Fe3O4@COF, Figure B is a spectrogram of C1s, and Figure C is a spectrogram of N1s.

[0045] Figure 6 Figure of peroxidase-like activity of Fe3O4@COF and Apt-Au NCs-Fe3O4@COF of embodiment 1 of the present application.

[0046] Figure 7 Michaelis-Menten curve and corresponding Lineweaver-Burk double reciprocal figure of TMB of Fe3O4@COF of embodiment 1 of the present application. Figure 7 Figure A in the figure is a Michaelis-Menten curve, Figure 7 Figure B in the figure is a corresponding Lineweaver-Burk double reciprocal figure.

[0047] Figure 8 Michaelis-Menten curve and corresponding Lineweaver-Burk double reciprocal figure of H2O2 of Fe3O4@COF of embodiment 1 of the present application. Figure 8 Figure A in the figure is a Michaelis-Menten curve, Figure 8 Figure B in the figure is a corresponding Lineweaver-Burk double reciprocal figure.

[0048] Figure 9 Figure of comparative performance of Apt-Au NCs Fe3O4@COF of embodiment 1 to embodiment 7 of the present application. Figure 9 Figure A in the figure is absorbance value of embodiment 1 to embodiment 7, Figure 9 Figure B in the figure is ultraviolet spectrogram and line graph of peroxidase activity change of embodiment 1 to embodiment 7, Figure 9 C in the figure is adsorption time optimization figure of Apt-Au NCs and Fe3O4@COF.

[0049] Figure 10 Figure of detection performance of Apt-Au NCs-Fe3O4@COF of embodiment 5 of the present application in fluorescence mode and colorimetric mode.

[0050] Figure 11 Figure of fluorescence intensity and linear change of Apt-Au NCs-Fe3O4@COF of embodiment 5 of the present application in fluorescence mode. Figure 11 Figure A in the figure is fluorescence intensity figure of Apt-Au NCs-Fe3O4@COF under different concentrations of ENR, Figure 11 Figure B in the figure is linear change figure.

[0051] Figure 12 Figure 5 is a fluorescence intensity and linear change diagram of the Apt-Au NCs-Fe3O4@COF colorimetric mode of the embodiment 5 of the present application. Figure 12 Figure 5A is a fluorescence intensity diagram of the Apt-Au NCs-Fe3O4@COF at different concentrations of ENR, Figure 12 Figure 5B is a linear change diagram.

[0052] Figure 13 Figure 3 is a schematic diagram of the ENR detection platform and a linear relationship diagram of the Apt-Au NCs-Fe3O4@COF of the embodiment 3 of the present application. Figure 13 Figure 3A is a schematic diagram of the ENR detection platform, Figure 13 Figure 3B is a linear relationship diagram. DETAILED DESCRIPTION

[0053] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0054] It should be noted that the professional terms used in the present application are only for the purpose of describing the specific embodiments, and are not intended to limit the protection scope of the present application. Unless otherwise specified, the various raw materials, reagents, instruments and equipment used in the following embodiments of the present application can be purchased from the market or prepared by the existing method. Among them, n-butanol, ferric chloride hexahydrate, anhydrous sodium acetate, sodium citrate, ethylene glycol, 1,4-dioxane, butanol and tetrahydrofuran are purchased from China Pharmaceutical Group Co., Ltd. (Shanghai, China). 2,5-dimethoxy-p-phenylenediamine, 1,3,5-tri-4-aminobenzene, 1,3,5-trimethylbenzene, bovine serum albumin, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride, N-hydroxysuccinimide sodium salt, enrofloxacin are purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. All aqueous solutions are purchased from Wahaha Group Co., Ltd.

[0055] Embodiment 1

[0056] A preparation method of a multi-mode biosensor, comprising the following steps:

[0057] S1, synthesis of Fe3O4 NPs by solvothermal method: 1.36 g FeCl3·6H2O, 2.4 g anhydrous sodium acetate and 0.4 g sodium citrate were dissolved in 40 mL ethylene glycol to form a mixed solution, the mixed solution was stirred at a speed of 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reaction kettle, and reacted by solvothermal method at 200 ℃ for 14 h. After the reaction was completed, the product was collected by a magnet, washed with anhydrous ethanol and deionized water for three times respectively, and vacuum dried at 30 ℃ for 12 h to obtain Fe3O4 NPs.

[0058] S2, synthesis of magnetic covalent organic framework solution: 34.8 mg 2,5-dimethoxy terephthaldehyde, abbreviated as DMTP, and 42 mg 1,3,5-tris(4-aminophenyl)benzene, abbreviated as TAPB, were dissolved in a mixed solvent of 8 mL butanol and 8 mL 1,4-dioxane to form a mixed solution, and ultrasonically mixed for 5 min; then 36 mg Fe3O4 NPs were added to the mixed solution, and ultrasonically mixed for 5 min, followed by adding 0.2 mL acetic acid, stirring at room temperature at a speed of 1200 rpm for 2 h, then adding 1.8 mL of 12 M acetic acid aqueous solution to obtain a mixed solution, and transferring the mixed solution to a stainless steel high-pressure reaction kettle, and reacting by solvothermal method at 70 ℃ for 48 h. After the reaction was completed, the product was collected by a magnet, washed with acetone and tetrahydrofuran for three times respectively, and vacuum dried at 30 ℃ for 12 h to obtain a magnetic covalent organic framework solution, named as Fe3O4@COF NPs solution.

[0059] S3, synthesis of Au NCs: 5 mL of 1 mM HAuCl4 solution was added to 5 mL of 50 mg / mL bovine serum albumin solution under stirring at 37 ℃ and 1500 rpm, then 0.5 mL of 1 M NaOH solution was added to adjust the pH value to 12, and then the mixture was stirred at 37 ℃ overnight to obtain luminescent Au NCs.

[0060] S4, synthesis of enrofloxacin aptamer modified with Au NCs: 10 μL of 10 μM enrofloxacin aptamer and 10 μL of 1 mM cross-linking agent were mixed to form a mixed solution, wherein the cross-linking agent was obtained by mixing 1-ethyl-(3-dimethylaminopropyl) carbodiimide and N-hydroxysuccinimide at a mass ratio of 1:1, wherein 1-ethyl-(3-dimethylaminopropyl) carbodiimide is abbreviated as EDC, and N-hydroxysuccinimide is abbreviated as NHS; the mixed solution was stirred at 37 ℃ and a speed of 1200 rpm for 0.5 h, then 180 μL of Au NCs obtained in S3 was added, and the mixture was continuously stirred at 37 ℃ overnight to obtain Au NCs modified enrofloxacin aptamer solution, and the solution was stored at 4 ℃, named as Apt-Au NCs.

[0061] S5, preparation of a multi-modal biosensor: 40 μΐ of Fe3O4@COF solution with a concentration of 2.5 mg / mL was added to 160 μΐ of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 100 nM. Oscillation was performed at room temperature for 5 min, so that the enrofloxacin aptamer modified Au NCs were completely adsorbed to the surface of Fe3O4@COF. The product was collected by a magnet, and after washing with deionized water, the final product, a multi-modal biosensor, was obtained, which was named Apt-Au NCs-Fe3O4@COF. After washing with deionized water, the product was dispersed in 200 μΐ of water. The concentration of Fe3O4@COF in the water was 0.5 mg / mL based on the content of Fe3O4@COF, which facilitated subsequent use.

[0062] Example 2

[0063] A method for preparing a multi-modal biosensor, comprising the following steps:

[0064] S1, synthesis of Fe3O4 NPs by a solvothermal method: 1.36 g of FeCl3-6H2O, 2.4 g of anhydrous sodium acetate and 0.4 g of sodium citrate were dissolved in 40 mL of ethylene glycol to form a mixed solution. After stirring at a speed of 1200 rpm for 1.5 h, the mixed solution was transferred to a stainless steel high-pressure reaction kettle and reacted by a solvothermal method at 200°C for 14 h. After the reaction was completed, the product was collected by a magnet, washed with anhydrous ethanol and deionized water three times respectively, and vacuum dried at 30°C for 12 h to obtain Fe3O4 NPs.

[0065] S2, synthesis of a magnetic covalent organic framework solution: 34.8 mg of DMTP and 42 mg of TAPB were dissolved in a mixed solvent of 8 mL of butanol and 8 mL of 1,4-dioxane to form a mixed solution, and ultrasonic mixing was performed for 5 min. Then, 36 mg of Fe3O4 NPs was added to the mixed solution, and ultrasonic mixing was continued for 5 min. Subsequently, 0.2 mL of acetic acid was added, and stirring was performed at room temperature at a speed of 1200 rpm for 2 h. Then, 1.8 mL of 12 M aqueous acetic acid solution was added to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reaction kettle and reacted by a solvothermal method at 70°C for 48 h. After the reaction was completed, the product was collected by a magnet, washed with acetone and tetrahydrofuran three times respectively, and vacuum dried at 30°C for 12 h to obtain a magnetic covalent organic framework solution, which was named Fe3O4@COF NPs solution.

[0066] S3, synthesis of Au NCs: 5 mL of 1 mM HAuCl4 solution was added to 5 mL of 50 mg / mL bovine serum albumin solution under stirring at 37℃ and 1500 rpm, then 0.5 mL of 1 M NaOH solution was added to adjust the pH value to 12, and then the mixture was stirred at 37℃ overnight to obtain luminescent Au NCs.

[0067] S4, synthesis of Au NCs modified enrofloxacin aptamer: 10 μL of 10 μM enrofloxacin aptamer and 10 μL of 1 mM cross-linking agent were mixed to form a mixed solution, wherein the cross-linking agent was obtained by mixing EDC and NHS at a mass ratio of 1:1; the mixed solution was stirred at 37℃ and 1200 rpm for 0.5 h, then 180 μL of Au NCs obtained in S3 was added, and the mixture was continuously stirred at 37℃ overnight to obtain Au NCs modified enrofloxacin aptamer solution, which was stored at 4℃ and named as Apt-Au NCs.

[0068] S5, preparation of multi-mode biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 200 nM. The mixture was shaken at room temperature for 5 min to make the Au NCs modified enrofloxacin aptamer completely adsorbed on the surface of Fe3O4@COF, and then the product was collected by a magnet to obtain the final product, i.e. a multi-mode biosensor, which was named as Apt-Au NCs-Fe3O4@COF and dispersed in 200 μL of water after being washed with deionized water. The concentration of Fe3O4@COF in the water was 0.5 mg / mL based on the content of Fe3O4@COF, which was convenient for subsequent use.

[0069] Example 3

[0070] A method for preparing a multi-mode biosensor, comprising the following steps:

[0071] S1, synthesis of Fe3O4 NPs by solvothermal method: 1.36 g of FeCl3·6H2O, 2.4 g of anhydrous sodium acetate and 0.4 g of sodium citrate were dissolved in 40 mL of ethylene glycol to form a mixed solution, which was stirred at 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reaction kettle, and reacted by solvothermal method at 200℃ for 14 h. After the reaction, the product was collected by a magnet, washed with anhydrous ethanol and deionized water for three times respectively, and vacuum dried at 30℃ for 12 h to obtain Fe3O4 NPs.

[0072] S2, synthesis of magnetic covalent organic framework solution: 34.8 mg DMTP and 42 mg TAPB were dissolved in 8 mL of butanol and 8 mL of 1,4-dioxane mixed solvent, ultrasonic mixing for 5 min; then 36 mg Fe3O4 NPs were added to the mixed solution, and ultrasonic mixing was continued for 5 min, followed by the addition of 0.2 mL of acetic acid. After stirring at room temperature at a speed of 1200 rpm for 2 h, 1.8 mL of 12 M aqueous acetic acid solution was added to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reaction kettle, and a solvothermal reaction was carried out at 70°C for 48 h. After the reaction was completed, the product was collected by a magnet, washed with acetone and tetrahydrofuran three times respectively, and vacuum dried at 30°C for 12 h to obtain a magnetic covalent organic framework solution, which was named Fe3O4@COF NPs solution.

[0073] S3, synthesis of Au NCs: 5 mL of 1 mM HAuCl4 solution was added to 5 mL of 50 mg / mL bovine serum albumin solution at 37°C and stirred at a speed of 1200 rpm. Then 0.5 mL of 1 M NaOH solution was added to adjust the pH to 12. The solution was then stirred overnight at 37°C to obtain luminescent Au NCs.

[0074] S4, synthesis of enrofloxacin aptamer modified Au NCs: 10 μL of 10 μM enrofloxacin aptamer and 10 μL of 1 mM cross-linking agent were mixed to form a mixed solution, wherein the cross-linking agent was obtained by mixing EDC and NHS at a mass ratio of 1:1; the mixed solution was stirred at 37°C and a speed of 1200 rpm for 0.5 h, then 180 μL of Au NCs obtained in S3 was added, and the mixture was continuously stirred overnight at 37°C to obtain an enrofloxacin aptamer modified Au NCs solution, which was stored at 4°C and named Apt-Au NCs.

[0075] S5, preparation of a multi-mode biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above to make the final concentration of Apt-Au NCs 300 nM. The solution was shaken at room temperature for 5 min to make the Au NCs modified enrofloxacin aptamer completely adsorbed on the surface of Fe3O4@COF. The product was collected by a magnet to obtain a final product, which was washed with deionized water and dispersed in 200 μL of water. The concentration of Fe3O4@COF in the Apt-Au NCs-Fe3O4@COF was 0.5 mg / mL based on the content of Fe3O4@COF, which was convenient for subsequent use.

[0076] Example 4

[0077] A method for preparing a multi-mode biosensor, comprising the following steps:

[0078] S1, synthesizing Fe3O4 NPs by a solvothermal method: 1.36 g of FeCl3·6H2O, 2.4 g of anhydrous sodium acetate, and 0.4 g of sodium citrate were dissolved in 40 mL of ethylene glycol to form a mixed solution, the mixed solution was stirred at a speed of 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reaction kettle, and reacted by a solvothermal method at 200 °C for 14 h. After the reaction was completed, the product was collected by a magnet, washed with anhydrous ethanol and deionized water for three times respectively, and vacuum dried at 30 °C for 12 h to obtain Fe3O4 NPs.

[0079] S2, synthesizing a magnetic covalent organic framework solution: 34.8 mg of DMTP and 42 mg of TAPB were dissolved in a mixed solvent of 8 mL of butanol and 8 mL of 1,4-dioxane to form a mixed solution, and ultrasonically mixed for 5 min; then 36 mg of Fe3O4 NPs were added to the mixed solution, and ultrasonically mixed for 5 min, followed by adding 0.2 mL of acetic acid, stirring at a speed of 1200 rpm at room temperature for 2 h, and then adding 1.8 mL of 12 M acetic acid aqueous solution to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reaction kettle, and reacted by a solvothermal method at 70 °C for 48 h. After the reaction was completed, the product was collected by a magnet, washed with acetone and tetrahydrofuran for three times respectively, and vacuum dried at 30 °C for 12 h to obtain a magnetic covalent organic framework solution, which was named as Fe3O4@COF NPs solution.

[0080] S3, synthesizing Au NCs: 5 mL of 1 mM HAuCl4 solution was added to 5 mL of 50 mg / mL bovine serum albumin solution under stirring at 37 °C and a speed of 1200 rpm, and then 0.5 mL of 1 M NaOH solution was added to adjust the pH value to 12, and then the mixture was stirred at 37 °C overnight to obtain luminescent Au NCs.

[0081] S4, synthesizing enrofloxacin aptamer modified Au NCs: 10 μL of 10 μM enrofloxacin aptamer and 10 μL of 1 mM crosslinking agent were mixed to form a mixed solution, wherein the crosslinking agent was obtained by mixing EDC and NHS at a mass ratio of 1:1; the mixed solution was stirred at 37 °C and a speed of 1200 rpm for 0.5 h, then 180 μL of Au NCs obtained in S3 was added, and the mixture was continuously stirred at 37 °C overnight to obtain an enrofloxacin aptamer modified Au NCs solution, which was named as Apt-AuNCs and stored at 4 °C.

[0082] S5, preparation of multi-mode biosensor: 40 μL of Fe3O4@COF solution with a concentration of 2.5 mg / mL was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 400 nM. Oscillation at room temperature for 5 min made the enrofloxacin aptamer modified Au NCs completely adsorbed to the surface of Fe3O4@COF, and the product was collected by a magnet, to obtain the final product, i.e. a multi-mode biosensor, named Apt-Au NCs-Fe3O4@COF, which was washed with deionized water and dispersed in 200 μL of water. With the content of Fe3O4@COF as the matrix, the concentration of Fe3O4@COF in Apt-Au NCs-Fe3O4@COF in water was 0.5 mg / mL, for subsequent use.

[0083] Example 5

[0084] A method for preparing a multi-mode biosensor, comprising the following steps:

[0085] S1, synthesis of Fe3O4 NPs by solvothermal method: 1.36 g of FeCl3·6H2O, 2.4 g of anhydrous sodium acetate and 0.4 g of sodium citrate were dissolved in 40 mL of ethylene glycol to form a mixed solution, which was stirred at a speed of 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reaction kettle, and reacted by solvothermal method at 200°C for 14 h. After the reaction was completed, the product was collected by a magnet, washed with anhydrous ethanol and deionized water for three times respectively, and vacuum dried at 30°C for 12 h to obtain Fe3O4 NPs.

[0086] S2, synthesis of magnetic covalent organic framework solution: 34.8 mg of DMTP and 42 mg of TAPB were dissolved in a mixed solvent of 8 mL of butanol and 8 mL of 1,4-dioxane to form a mixed solution, which was ultrasonically mixed for 5 min; then 36 mg of Fe3O4 NPs was added to the mixed solution, and ultrasonic mixing was continued for 5 min, followed by adding 0.2 mL of acetic acid. After stirring at room temperature at a speed of 1200 rpm for 2 h, 1.8 mL of 12 M acetic acid aqueous solution was added to obtain a mixed solution, which was transferred to a stainless steel high-pressure reaction kettle and reacted by solvothermal method at 70°C for 48 h. After the reaction was completed, the product was collected by a magnet, washed with acetone and tetrahydrofuran for three times respectively, and vacuum dried at 30°C for 12 h to obtain a magnetic covalent organic framework solution, named Fe3O4@COF NPs solution.

[0087] S3, synthesis of Au NCs: 5 mL of 1 mM HAuCl4 solution was added to 5 mL of 50 mg / mL BSA solution under stirring at 37℃ and 1200 rpm, and then 0.5 mL of 1 M NaOH solution was added to adjust the pH value to 12, and then the mixture was stirred at 37℃ overnight to obtain luminescent Au NCs.

[0088] S4, synthesis of Au NCs modified enrofloxacin aptamer: 20 μL of 10 μM enrofloxacin aptamer and 20 μL of 1 mM cross-linking agent were mixed to form a mixed solution, wherein the cross-linking agent was obtained by mixing EDC and NHS at a mass ratio of 1:1; the mixed solution was stirred at 37℃ and 1200 rpm for 0.5 h, then 160 μL of Au NCs obtained in S3 was added, and the mixture was continuously stirred at 37℃ overnight to obtain Au NCs modified enrofloxacin aptamer solution, which was stored at 4℃ and named as Apt-Au NCs.

[0089] S5, preparation of multi-mode biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4, so that the final concentration of Apt-Au NCs was 500 nM. The mixture was shaken at room temperature for 5 min to make the Au NCs modified enrofloxacin aptamer completely adsorbed on the surface of Fe3O4@COF, and then the product was collected by a magnet to obtain a final product, i.e. a multi-mode biosensor, which was named as Apt-Au NCs-Fe3O4@COF and dispersed in 200 μL of water after being washed with deionized water. The concentration of Fe3O4@COF in the water was 0.5 mg / mL based on the content of Fe3O4@COF, which was convenient for subsequent use.

[0090] Example 6

[0091] A method for preparing a multi-mode biosensor, comprising the following steps:

[0092] S1, synthesis of Fe3O4 NPs by solvothermal method: 1.36 g of FeCl3·6H2O, 2.4 g of anhydrous sodium acetate and 0.4 g of sodium citrate were dissolved in 40 mL of ethylene glycol to form a mixed solution, which was stirred at 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reaction kettle, and reacted by solvothermal method at 200℃ for 14 h. After the reaction, the product was collected by a magnet, washed with anhydrous ethanol and deionized water for three times respectively, and vacuum dried at 30℃ for 12 h to obtain Fe3O4 NPs.

[0093] S2, synthesis of magnetic covalent organic framework solution: 34.8 mg DMTP and 42 mg TAPB were dissolved in 8 mL of butanol and 8 mL of 1,4-dioxane mixed solvent, ultrasonic mixing for 5 min; then 36 mg Fe3O4 NPs were added to the mixed solution, and ultrasonic mixing was continued for 5 min, followed by the addition of 0.2 mL of acetic acid. After stirring at room temperature at a speed of 1200 rpm for 2 h, 1.8 mL of 12 M aqueous acetic acid solution was added to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reaction kettle, and a solvothermal reaction was carried out at 70°C for 48 h. After the reaction was completed, the product was collected by a magnet, washed with acetone and tetrahydrofuran three times respectively, and vacuum dried at 30°C for 12 h to obtain a magnetic covalent organic framework solution, which was named Fe3O4@COF NPs solution.

[0094] S3, synthesis of Au NCs: 5 mL of 1 mM HAuCl4 solution was added to 5 mL of 50 mg / mL bovine serum albumin solution at 37°C and stirred at a speed of 1200 rpm. Then 0.5 mL of 1 M NaOH solution was added to adjust the pH to 12. The solution was then stirred overnight at 37°C to obtain luminescent Au NCs.

[0095] S4, synthesis of enrofloxacin aptamer modified Au NCs: 20 μL of 10 μM enrofloxacin aptamer and 20 μL of 1 mM cross-linking agent were mixed to form a mixed solution, wherein the cross-linking agent was obtained by mixing EDC and NHS at a mass ratio of 1:1; the mixed solution was stirred at 37°C and a speed of 1200 rpm for 0.5 h, then 160 μL of Au NCs obtained in S3 was added, and the resulting Au NCs modified enrofloxacin aptamer solution was continuously stirred overnight at 37°C. The solution was stored at 4°C and named Apt-Au NCs.

[0096] S5, preparation of a multi-mode biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 600 nM. The solution was shaken at room temperature for 5 min to allow the Au NCs modified enrofloxacin aptamer to completely adsorb onto the surface of Fe3O4@COF. The product was collected by a magnet to obtain a final product, which was washed with deionized water to obtain a multi-mode biosensor, named Apt-Au NCs-Fe3O4@COF. The biosensor was dispersed in 200 μL of water after washing with deionized water. The concentration of Fe3O4@COF in water in Apt-Au NCs-Fe3O4@COF was 0.5 mg / mL, which facilitated subsequent use.

[0097] Example 7

[0098] A method for preparing a multi-mode biosensor, comprising the following steps:

[0099] S1, synthesizing Fe3O4 NPs by a solvothermal method: 1.36 g of FeCl3·6H2O, 2.4 g of anhydrous sodium acetate, and 0.4 g of sodium citrate were dissolved in 40 mL of ethylene glycol to form a mixed solution, the mixed solution was stirred at a speed of 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reaction kettle, and reacted by a solvothermal method at 200 °C for 14 h. After the reaction was completed, the product was collected by a magnet, washed with anhydrous ethanol and deionized water for three times respectively, and vacuum dried at 30 °C for 12 h to obtain Fe3O4 NPs.

[0100] S2, synthesizing a magnetic covalent organic framework solution: 34.8 mg of DMTP and 42 mg of TAPB were dissolved in a mixed solvent of 8 mL of butanol and 8 mL of 1,4-dioxane to form a mixed solution, and ultrasonically mixed for 5 min; then 36 mg of Fe3O4 NPs were added to the mixed solution, and ultrasonically mixed for 5 min, followed by adding 0.2 mL of acetic acid, stirring at a speed of 1200 rpm at room temperature for 2 h, and then adding 1.8 mL of 12 M acetic acid aqueous solution to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reaction kettle, and reacted by a solvothermal method at 70 °C for 48 h. After the reaction was completed, the product was collected by a magnet, washed with acetone and tetrahydrofuran for three times respectively, and vacuum dried at 30 °C for 12 h to obtain a magnetic covalent organic framework solution, which was named as Fe3O4@COF NPs solution.

[0101] S3, synthesizing Au NCs: 5 mL of 1 mM HAuCl4 solution was added to 5 mL of 50 mg / mL bovine serum albumin solution under stirring at 37 °C and a speed of 1200 rpm, and then 0.5 mL of 1 M NaOH solution was added to adjust the pH value to 12. The mixture was stirred at 37 °C overnight to obtain luminescent Au NCs.

[0102] S4, synthesizing enrofloxacin aptamer modified with Au NCs: 20 μL of 10 μM enrofloxacin aptamer and 20 μL of 1 mM crosslinking agent were mixed to form a mixed solution, wherein the crosslinking agent was obtained by mixing EDC and NHS at a mass ratio of 1:1; the mixed solution was stirred at 37 °C and a speed of 1200 rpm for 0.5 h, then 160 μL of Au NCs obtained in S3 was added, and the mixture was continuously stirred at 37 °C overnight to obtain an enrofloxacin aptamer modified with Au NCs, which was named as Apt-AuNCs and stored at 4 °C.

[0103] S5, preparation of a multi-mode biosensor: 40 μL of Fe3O4@COF solution with a concentration of 2.5 mg / mL was added to 160 μL of the Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 700 nM. Oscillation was carried out at room temperature for 5 min, so that the enrofloxacin aptamer modified Au NCs were completely adsorbed to the surface of Fe3O4@COF, the product was collected by a magnet, and the final product was obtained after washing with deionized water, which was a multi-mode biosensor, named Apt-Au NCs-Fe3O4@COF, and was dispersed in 200 μL of water after washing with deionized water, with the content of Fe3O4@COF as a matrix, the concentration of Fe3O4@COF in the Apt-Au NCs-Fe3O4@COF in water was 0.5 mg / mL, for subsequent use.

[0104] Since the structures of the Apt-Au NCs-Fe3O4@COF prepared in Examples 1 to 7 are similar, the structure of the Apt-Au NCs-Fe3O4@COF prepared in Example 1 is taken as an object, and the structure of the Apt-Au NCs-Fe3O4@COF is described, and the results are as follows.

[0105] Figure 1 It is a morphology structure diagram of the Fe3O4@COF of Example 1 of the application. As shown in Figure 1 , the Fe3O4@COF is uniformly distributed and has a unique core-shell structure, and the total size is between 600 nm and 700 nm.

[0106] Figure 2 It is an infrared spectrum of the Fe3O4@COF and COF of Example 1 of the application. As shown in Figure 2 , the typical absorption at 585 cm -1 is attributed to Fe-O vibration, and the absorption at 1631 cm -1 is from the newly formed imine bond-C=N-, which indirectly proves the successful preparation of COF. And the weak stretching vibration band of -CHO of DMTP at 1681 cm -1 and -NH2 of TAPB at 2874 cm -1 , 2975 cm -1 and 3005 cm -1 , it can be seen that spherical Fe3O4 NPs are prepared by using a hydrothermal method, and the surface has abundant carboxyl groups, which is beneficial to the subsequent coating of COF.

[0107] Figure 3 It is an X-ray diffraction spectrum of the Fe3O4 NPs and Fe3O4@COF of Example 1. As shown in Figure 3As shown in the figure, the six prominent diffraction peaks of Fe3O4 are at 30.12°, 35.50°, 43.16°, 53.71°, 57.30° and 62.70°; and the distinguishable peaks are shown at 4.84°, 5.56°, 7.44°, 9.74° and 25.6°, which correspond to the (110), (200), (210), (220) and (001) diffraction of TAPB-DMTP-COF, respectively.

[0108] To prove whether the Au NCs are modified to the aptamer to constitute Apt-Au NCs, and whether the Apt-Au NCs are successfully connected to the Fe3O4@COF, we made the zeta potential to prove.

[0109] Figure 4 The zeta potential value graph of the aptamer, Apt-Au NCs, COF, Fe3O4@COF and Apt-Au NCs-Fe3O4@COF of the embodiment 1 of the application is shown in the figure. Figure 4 As shown in the figure, after the Au NCs are modified to the aptamer, the value is reduced from -22 to -27. After the Apt-Au NCs are connected to the Fe3O4@COF, the zeta potential of the Fe3O4@COF is also reduced to a certain extent.

[0110] Figure 5 The X-ray photoelectron spectrogram of the Fe3O4@COF of the embodiment 1 of the application is shown in the figure. Figure 5 In the figure, A is the spectrogram of the Fe3O4@COF, B is the spectrogram of C1s, and C is the spectrogram of N1s. As shown in A of the figure, Figure 5 As shown in the figure, there are obvious N, O and C element signals in the spectrogram of the Fe3O4@COF; as shown in B of the figure, Figure 5 The C 1s spectrum shows two peaks centered at 288.4 eV and 285.7 eV, which correspond to C-O and C=O groups, respectively; as shown in C of the figure, Figure 5 The N 1s spectrum shows two deconvolution peaks, which are attributed to C=N and residual -NH2 groups, respectively, which is consistent with the result of Figure 2 .

[0111] The above results prove that the Fe3O4@COF and Apt-Au NCs-Fe3O4@COF are successfully prepared.

[0112] The peroxidase-like activity of the Apt-Au NCs-Fe3O4@COF prepared in the embodiment 1 is studied, including the following steps:

[0113] The 40 μg / mL Fe3O4@COF, 0.5 mM TMB and 10 mM H2O2 were mixed in a concentration of 0.2 M, pH acetate buffer, and then reacted at room temperature for 5 min. The absorbance value at 652 nm was recorded by ultraviolet-visible spectrophotometer.

[0114] The peroxidase-like activity of the prepared material was evaluated by catalyzing the oxidation of TMB by H2O2.

[0115] Figure 6 The peroxidase-like activity of the Fe3O4@COF and Apt-Au NCs-Fe3O4@COF of Example 1 of the present application is shown in the figure. As shown in the figure, Figure 6 the Fe3O4@COF showed a strong ultraviolet absorption peak at 652 nm, and the substrate color was deep. When the Apt-Au NCs were adsorbed onto the surface of the Fe3O4@COF, the enzyme active site was hindered, the enzyme activity was reduced, the absorbance was reduced, and the test substance ENR had no effect on the enzyme activity.

[0116] The catalytic performance of the Fe3O4@COF was further studied by steady-state kinetic experiments, and TMB and H2O2 were used as enzyme reaction substrates for steady-state kinetic calculation. According to the Michaelis-Menten equation and the Lineweaver-Burk double-reciprocal plot, the Michaelis constant Km and the maximum speed Vmax of the enzyme reaction were obtained. Among them, Km represents the affinity of the enzyme for the substrate, and the lower the value, the stronger the affinity.

[0117] Figure 7 The Michaelis-Menten curve of the Fe3O4@COF of Example 1 of the present application for TMB and the corresponding Lineweaver-Burk double-reciprocal plot are shown in the figure. Figure 7 The A graph in the figure is a Michaelis-Menten curve graph, Figure 7 The B graph in the figure is a corresponding Lineweaver-Burk double-reciprocal plot. As shown in the figure, Figure 7 when TMB of different concentrations is used as a substrate, Km and Vmax are calculated as 0.85 mM and 8.52 x 10 -8 M·s -1 .

[0118] Figure 8 The Michaelis-Menten curve of the Fe3O4@COF of Example 1 of the present application for H2O2 and the corresponding Lineweaver-Burk double-reciprocal plot are shown in the figure. Figure 8 The A graph in the figure is a Michaelis-Menten curve graph, Figure 8Figure B in the figure is the corresponding Lineweaver-Burk double-reciprocal plot. Figure 8 As shown in Figure B, for H2O2, Km and Vmax are 0.86 mM and 2.21 x 10 -8 M·s -1 The above results prove that Fe3O4@COF has excellent catalytic performance.

[0119] For comparison, different concentrations of Apt-Au NCs in Comparative Example 1 to Example 7 are adsorbed to the surface of Fe3O4@COF NPs, and the absorbance values of Apt-Au NCs-Fe3O4@COF at 652 nm under different concentrations are obtained.

[0120] Figure 9 Figure A in the figure is the comparison performance graph of Apt-Au NCs-Fe3O4@COF in Example 1 to Example 7. Figure 9 Figure A in the figure is the absorbance value of Example 1 to Example 7, Figure 9 Figure B in the figure is the ultraviolet spectrum and line graph of the change of peroxidase activity of Example 1 to Example 7, Figure 9 Figure C in the figure is an adsorption time optimization graph of Apt-Au NCs and Fe3O4@COF. Figure 9 As shown in Figure A and Figure B, as the final concentration of Apt-Au NCs increases from 100 nM to 700 nM, the absorbance at 652 nm gradually decreases, and when the aptamer concentration reaches 500 nM, the absorbance is stable and no longer decreases. The time of Fe3O4@COF adsorbing Apt-Au NCs is a key parameter, and the fluorescence of Apt-Au NCs quenched by Fe3O4@COF is used to determine the adsorption time. Figure 9 As shown in Figure C, 5 min Apt-Au NCs can be completely assembled to the surface of Fe3O4@COF.

[0121] Therefore, the Apt-Au NCs with a concentration of 500 nM in Example 5 are selected for further research.

[0122] The multi-mode biosensor Apt-Au NCs-Fe3O4@COF prepared in Example 5 is used for detecting ENR, including the following steps:

[0123] 1. Fluorescence Method: 20 μL of ENR solutions (0.001 ng / mL, 0.01 ng / mL, 0.1 ng / mL, 1 ng / mL, 1 μg / mL, 10 μg / mL, 100 μg / mL, 300 μg / mL, 500 μg / mL, 800 μg / mL, 850 μg / mL, and 900 μg / mL) were introduced into 180 μL of the Apt-Au NCs-Fe3O4@COF solution prepared in the previous step. The Au NCs-Fe3O4@COF solution used Fe3O4@COF as the matrix, and the concentration of Fe3O4@COF in water was 0.5 mg / mL. The reaction was carried out at 37℃ for 1 h. Separation was performed using a magnet. The supernatant was used to measure the ENR of all samples using a fluorescence excitation wavelength of 470 nm.

[0124] 2. Colorimetric Method: The precipitate obtained from the magnetic separation in the previous steps is then subjected to a colorimetric reaction based on the amount of Fe3O4@COF, with a final concentration of 100 μg / mL. The obtained precipitate is added to a mixed solution of TMB (final concentration 0.5 mM) and H2O2 (final concentration 20 mM), and the reaction is carried out at room temperature for 10 min. The absorbance at 652 nm is measured, and the analyte is detected colorimetrically.

[0125] Figure 10 The graphs show the detection performance of Apt-Au NCs-Fe3O4@COF in fluorescence and colorimetric modes in Example 5 of this invention. Figure 10 Figure A in the diagram is the fluorescence spectrum. Figure 10 Figure B in the diagram shows the activity of peroxidase-like enzymes. For example... Figure 10 As shown in Figure A, in fluorescence mode, the fluorescence intensity change of Apt-Au NCs at 620 nm is used as the detection signal. After the introduction of Fe3O4@COF, the fluorescence of Apt-Au NCs at 620 nm is quenched. This is because electrons are transferred from Apt-Au NCs to Fe3O4@COF after the aptamer successfully adsorbs onto the surface. The fluorescence intensity at 620 nm recovers when the analyte ENR is detected; similarly, as shown in Figure A... Figure 10 In Figure B, in colorimetric mode, after Apt-Au NCs successfully adsorbed onto the surface, they masked the active sites, resulting in decreased peroxidase-like activity and a significant reduction in UV absorbance at 652 nm. Upon the presence of the analyte, the activity recovered, and the absorbance increased.

[0126] Under optimized conditions, add 0 ng / mL to 9 × 10⁻⁶. 4 After magnetic separation, the fluorescence intensity changes at 620 nm in the supernatant were recorded for different concentrations of ENR at ng / mL. Figure 11This is a graph showing the fluorescence intensity and linear variation of Apt-Au NCs-Fe3O4@COF fluorescence mode in Example 5 of the present invention. Figure 11 Figure A in the diagram shows the fluorescence intensity of Apt-Au NCs-Fe3O4@COF at different concentrations of ENR. Figure 11 Graph B in the diagram shows the current linear change. For example... Figure 11 As shown, with the increase of the concentration of the analyte ENR, the fluorescence intensity I... 620nm Gradually increase the concentration until it reaches 8 × 10⁻⁶. 5 At ng / mL, fluorescence intensity I 620nm The fluorescence intensity remained essentially unchanged, ranging from 0.01 ng / mL to 1 × 10⁻⁶. 4 ng / mL (lg C) ENR Within the range of ), the fluorescence intensity exhibits a linear change with increasing ENR concentration. The linear regression equation between ENR concentration and fluorescence intensity is: y2 = -17.6704x2 + 88.5253, where x2 is lg C. ENR Let y2 be the fluorescence intensity, and the regression coefficient R2 be... 2 The value was 0.9914, and the linear range of ENR was 0.01 ng / mL to 1 × 10⁻⁶. 4 The detection limit is 4.65 pg / mL.

[0127] Figure 12 This is a graph showing the fluorescence intensity and linear variation of Apt-Au NCs-Fe3O4@COF in colorimetric mode according to Example 5 of the present invention. Figure 12 Figure A in the diagram shows the fluorescence intensity of Apt-Au NCs-Fe3O4@COF at different concentrations of ENR. Figure 12 Graph B in the diagram shows the current linear change. For example... Figure 12 As shown, in the colorimetric detection of ENR, the absorbance at 652 nm increases with increasing ENR concentration, and the solution gradually changes from light blue to dark blue. The constructed colorimetric sensing strategy can be accurately applied to the visual analysis of ENR. (The data is presented in the range of 10 ng / mL to 5 × 10⁻⁶.) 5 Within the range of ng / mL, the UV response was linearly correlated with the ENR concentration. The linear regression equation between ENR concentration and fluorescence intensity was: y3 = -0.1014x3 + 0.1589, where x3 is lg C. ENR y3 represents fluorescence intensity, and the regression coefficient R3 2 =0.9941, the linear range of ENR is 10 ng / mL to 5 × 10⁻⁶. 4 The detection limit was calculated to be 0.07 ng / mL based on a three-fold signal-to-noise ratio.

[0128] 3. Intelligent Image Recognition Method: Color changes in the colorimetric system inspire us to detect ENR via smartphone.

[0129] The color of the reaction solution deepened with increasing ENR concentration, becoming increasingly blue. Different concentrations of ENR (0 μg / mL, 0.01 μg / mL, 0.05 μg / mL, 0.1 μg / mL, 1 μg / mL, 10 μg / mL, 30 μg / mL, and 50 μg / mL) were arranged in a 96-well plate using colorimetric mode, and color images were captured using a smartphone. The RGB values ​​were then read using the Color Grap app, and the grayscale value was calculated using the formula I = 0.3R + 0.59G + 0.11B.

[0130] Figure 13 This is a schematic diagram and a linear relationship graph of the ENR detection platform for Apt-Au NCs-Fe3O4@COF in Embodiment 3 of the present invention. Figure 13 In the diagram, A represents the ENR detection platform. Figure 13 In the graph, B represents a linear relationship. For example... Figure 13 As shown, the Color Grab application on the mobile phone was used to extract colors and RGB values, converting the RGB values ​​of different colors into grayscale values ​​I. The ENR concentration showed a good linear relationship with I: y1 = -15.8249x1 + 163.7164, where x1 is the grayscale value, y1 is the enrofloxacin concentration in the sample, and R1 is the grayscale value. 2 =0.9944, linear range is 10 ng / mL~5×10 4 The detection limit is 0.12 ng / mL. The establishment of a smartphone reading platform enables rapid, convenient, and accurate detection of ENR, providing a simple and practical new approach. In summary, the established fluorescence / colorimetric / intelligent image recognition multi-mode detection platform can be used for sensitive real-time determination of ENR.

[0131] To verify the practicality and accuracy of the multi-mode sensing platform, various real samples, including water, milk, and chicken, were analyzed. All samples were purchased from the local Jiajiayue Supermarket. The real samples were pretreated before analysis. 5 mL of milk was used as the sample matrix, and 10 mL of methanol was added to remove proteins. The samples were centrifuged at 10,000 rpm for 10 min to obtain the supernatant, which was then further processed using a 0.22 μm filter membrane.

[0132] The obtained actual sample solution was diluted 20 times with a pH = 4, 0.2M concentration acetic acid buffer solution, and a standard recovery experiment was performed after adding different standard concentrations of ENR. Then, 0.5mM concentration TMB, Apt-Au NCs-Fe3O4@COF and 20mM concentration H2O2 were added to the actual sample according to the amount of Fe3O4@COF, the concentration of Fe3O4@COF was 100μg / mL, the ultraviolet absorbance A at 652nm, the fluorescence intensity I at 620nm and the gray value I were measured, and the recovery rate and relative standard deviation were calculated using the measured concentration and standard concentration.

[0133] In order to verify the effectiveness and reliability of the designed nanomolecule for detecting ENR, tap water and milk were detected by multi-mode detection using fluorescence method, colorimetric method and smartphone-assisted sensing platform. The recovery rate experiment was carried out at the standard concentration of 10ng / mL, 1×10 3 ng / mL, 1×10 4 ng / mL. As shown in Tables 1 and 2, the recovery rates of fluorescence mode and colorimetric mode were 91.70% to 108.74% and 92.50% to 107.45%, respectively, and the relative standard deviation was less than 6%.

[0134] Table 1 Detection of ENR in real samples by fluorescence method, n = 3

[0135]

[0136]

[0137] Table 2 Detection of ENR in real samples by colorimetric method, n = 3

[0138]

[0139] Similarly, for smartphone-assisted sensing detection, as shown in Table 3, the recovery rate was 91.20% to 106.24%, and the RSD was also less than 6%. The results prove that the designed nanomolecule can accurately and effectively detect ENR, and the proposed smartphone-assisted sensing platform has good reliability in practical application, and can provide technical support for the rapid detection of ENR residues in the field.

[0140] Table 3 Detection of ENR in real samples by smartphone-assisted sensing, n = 3

[0141]

[0142]

[0143] In summary, the application provides a multi-mode biosensor and its preparation method and application, taking covalent organic framework Fe3O4@COF with a magnetic core-shell structure as a substrate, the substrate has good peroxidase-like activity and magnetism, taking enrofloxacin aptamer modified by Au NCs as a recognition site, the enrofloxacin aptamer modified by Au NCs is adsorbed on Fe3O4@COF through electrostatic adsorption and pi-pi stacking adsorption, because COF has excellent fluorescence quenching ability, the red light of Au NCs disappears, and the peroxidase-like activity is reduced. When the detected substance ENR is added, the aptamer specifically recognizes, because the aptamer and ENR have higher affinity, the aptamer will fall off from the surface of COF, the adsorption and falling off of the aptamer cause the changes of fluorescence signal and enzyme activity, so as to accurately and specifically detect. The biosensor has the advantages of good selectivity, easy separation, high accuracy, low detection limit, wide range and multi-mode detection. The analysis method is simple to operate, and has great application potential for on-site detection of antibiotic residues in the environment and food. The prepared biosensor has multiple detection modes, and the multi-mode sensing strategy of fluorescence, colorimetric and intelligent image recognition method has the advantages of wide linear range, low detection limit and good selectivity. The detection of ENR has good analysis performance. More importantly, by comparing the results of the fluorescence mode and the colorimetric mode, the reliability and accuracy of the sensing strategy can be ensured. In addition, the introduction of intelligent image recognition method realizes the rapid real-time detection of ENR, and the method has good practicability.

[0144] It should be noted that when the numerical range is involved in the application, the two endpoints of each numerical range and any number between the two endpoints can be selected. Since the same steps and examples are used, the preferred embodiments are described in the application to prevent redundancy. Although the preferred embodiments of the application have been described, those skilled in the art can make additional changes and modifications to the embodiments once they know the basic creative concept. Therefore, the appended claims are intended to include the preferred embodiments and all changes and modifications falling within the scope of the application.

[0145] Obviously, those skilled in the art can make various modifications and variations to the application without departing from the spirit and scope of the application. Thus, if these modifications and variations of the application fall within the scope of the claims of the application and their equivalent technologies, the application also intends to include these modifications and variations.

Claims

1. A multi-mode biosensor, characterized in that, Using a magnetic covalent organic framework as the matrix and enrofloxacin aptamers modified with gold nanoparticles as recognition sites, a multi-mode biosensor was constructed by adsorption and connection between the matrix and the recognition sites. Among them, the enrofloxacin aptamers modified with gold nanoparticles are used as carriers to cross-link and load gold nanoparticles onto the enrofloxacin aptamers. The matrix exhibits peroxidase-like activity, the magnetic covalent organic framework possesses fluorescence quenching properties, and the gold nanoparticles emit red light. When the matrix and recognition site are adsorbed and connected, the red light of the gold nanoparticles disappears, and the peroxidase-like activity decreases. When detection is performed, the recognition site detaches from the surface of the magnetic covalent organic framework, causing changes in fluorescence signal and enzyme activity. The red fluorescence of the gold nanoparticles is restored, and the peroxidase-like activity increases.

2. A method for preparing the multi-mode biosensor according to claim 1, characterized in that, Includes the following steps: A gold nanoparticle solution was added to the enrofloxacin aptamer, and a modification reaction was carried out under the action of a crosslinking agent to obtain a gold nanoparticle-modified enrofloxacin aptamer solution. A magnetic covalent organic framework solution was added to a solution of enrofloxacin aptamer modified with gold nanoparticles to carry out an adsorption-linking reaction, resulting in a multimode biosensor.

3. The method for fabricating a multi-mode biosensor according to claim 2, characterized in that, The volume ratio of enrofloxacin aptamer to gold nanoparticle solution was 1:5 to 20, the concentration of enrofloxacin aptamer was 10 μM to 20 μM, and the concentration of gold nanoparticle solution was 4 mM to 10 mM.

4. The method for preparing a multi-mode biosensor according to claim 2, characterized in that, The volume ratio of enrofloxacin aptamer to crosslinking agent is 1:0.5 to 2, and the concentration of crosslinking agent is 0.5 mM to 2 mM. The crosslinking agent is obtained by mixing 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide in a mass ratio of 1:

1.

5. The method for fabricating a multi-mode biosensor according to claim 2, characterized in that, The nucleotide sequence of the enrofloxacin aptamer is: CCCATCAGGGGGCTAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTCAGGGGGA.

6. The method for fabricating a multi-mode biosensor according to claim 2, characterized in that, The volume ratio of the enrofloxacin aptamer solution modified with gold nanoparticles to the magnetic covalent organic framework solution was 1:0.2–1, the concentration of the magnetic covalent organic framework solution was 2 mg / L–5 mg / L, and the final concentration of the enrofloxacin aptamer solution modified with gold nanoparticles was 100 nM–700 nM.

7. The method for fabricating a multi-mode biosensor according to claim 2, characterized in that, The conditions for the adsorption-linking reaction are: room temperature shaking for 5 to 10 minutes.

8. The application of the multi-mode biosensor of claim 1 in detecting enrofloxacin in water or food, characterized in that, The food items include milk and chicken.

9. The application of the multi-mode biosensor according to claim 8 in the detection of enrofloxacin in water or food, characterized in that, The biosensor uses fluorescence, colorimetry, or intelligent image recognition methods for detection.

10. The application of the multi-mode biosensor according to claim 9 in the detection of enrofloxacin in water or food, characterized in that, The intelligent image recognition method includes the following steps: Image processing software was used to read the RGB values ​​of samples containing different known enrofloxacin concentrations after color development. Gray values ​​were calculated from the RGB values ​​to construct a linear response relationship between enrofloxacin concentration and gray value. The curve with the highest fit was selected as the standard curve for enrofloxacin detection. The linear regression equation for the detection of enrofloxacin concentration and gray value is: y1 = -15.8249x1 + 163.7164, where x1 is the gray value and y1 is the enrofloxacin concentration in the sample. The linear range of detection is 10 ng / mL to 5 × 10⁻⁶ ng / mL. 4 The detection limit was 0.12 ng / mL. The concentration of enrofloxacin in the sample was obtained based on the linear regression equation for enrofloxacin detection and the measured gray value of the sample.

Images