Brazilian sweet protein mutant and application thereof

Abstract

The invention belongs to the technical field of protein engineering, and discloses a Brazilian sweet protein mutant and application thereof. According to the invention, lysine is used for replacing aspartic acid at the 29th site of Brazilian sweet protein, and / or arginine is used for replacing glutamic acid at the 36th site, and / or alanine is used for replacing aspartic acid at the 50th site, amino acid mutation at the sites is carried out to construct a Brazilian sweet protein mutant, and the Brazilian sweet protein mutant is subjected to heterologous expression in pichia pastoris GS115, so that the Brazilian sweet protein mutant is obtained. And carrying out sweetness performance evaluation on the expressed Brazilian sweet protein mutant. The sweetness property of the double mutant Asp29Lys-Asp50Ala protein is improved by 240% compared with the sweetness property of the Brazilian sweet protein before mutation.

Description

Technical Field

[0001] The invention belongs to the technical field of protein engineering and relates to a brasiliensis mutant and application thereof. Background Art

[0002] Brazzein, or Brazilian sweet protein, is a natural plant protein that produces sweetness by binding to human sweet taste receptors. Brazzein has a low relative molecular mass, high sweetness, good water solubility, low calories, long-lasting sweetness, and can be degraded into amino acids for human absorption and utilization. It has excellent nutritional value, so its application in the food industry has attracted widespread attention, which has further increased the demand for economical, efficient and safe production of brazzein.

[0003] In order to solve the problem of low yield and difficulty in industrialization of plant sweet protein, domestic and foreign scholars have been committed to using microorganisms to heterologously express sweet protein and increase sweet protein production in recent years, such as Escherichia coli, plant cells, animal cells, etc. However, these all have the problem of insufficient yield for production and uneven sweetness performance, which is also the bottleneck for the industrialization of sweet protein. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a brasiliensis mutant and its application in view of the deficiencies in the prior art.

[0005] In order to solve the above technical problems, the present invention discloses a brasiliensis mutant and its application. The specific technical scheme is as follows:

[0006] A brasiliensis mutant, wherein the brasiliensis mutant is obtained by subjecting the brasiliensis having an amino acid sequence as shown in SEQ ID No. 1 to any one of the following amino acid mutations (1) to (6):

[0007] (1) D50A; represents the substitution of aspartic acid at position 50 with alanine;

[0008] (2) E36R; represents the substitution of glutamic acid at position 36 with arginine;

[0009] (3) D29K; represents the substitution of aspartic acid at position 29 with lysine;

[0010] (4) D29K and D50A; representing substitution of aspartic acid at position 29 with lysine and substitution of aspartic acid at position 50 with alanine;

[0011] (5) E36R and D50A; representing the substitution of glutamic acid at position 36 with arginine and aspartic acid at position 50 with alanine;

[0012] (6) D29K and E36R; represent substitution of aspartic acid at position 29 with lysine and substitution of glutamic acid at position 36 with arginine.

[0013] The brazzein whose amino acid sequence is shown in SEQ ID No. 1 is derived from the West African plant Pentadiplandra brazzeana Baillon.

[0014] Preferably, the amino acid sequence of the brazilian tamanin mutant obtained by any one of the amino acid mutations in (1) to (6) is as shown in SEQ ID No. 2 to 7.

[0015] The brazilian thauma protein mutant is obtained by subjecting the brazilian thauma protein with an amino acid sequence as shown in SEQ ID No. 1 to amino acid mutations of D29K and D50A, or to amino acid mutations of E36R and D50A.

[0016] In a second aspect, the present invention provides a gene encoding the brasiliensis mutant described in the first aspect.

[0017] In a third aspect, the present invention provides an expression cassette or a recombinant vector containing the gene described in the second aspect.

[0018] In a fourth aspect, the present invention provides a recombinant bacterium containing the expression cassette or recombinant vector described in the third aspect.

[0019] Wherein, the starting strain of the recombinant bacteria is Pichia pastoris, preferably Pichia pastoris GS115.

[0020] Further preferably, the recombinant bacteria are constructed according to the following method: vector pPIC9K is connected with the gene encoding the brasiliensis mutant, and the resultant is transformed into a Pichia pastoris starting bacterium.

[0021] In a fifth aspect, the present invention provides the use of the recombinant bacteria described in the fourth aspect in the fermentation production of brasiliensis mutants.

[0022] The recombinant bacteria were inoculated into the first culture medium and cultured at 28-32°C until OD 600 After 3-4 hours, the mixture was transferred to the second culture medium and cultured at 28-32°C for 96-144 hours to obtain the brazilian tamanin mutant. Preferably, the mixture was cultured at 30°C until the OD 600 After 3-4 days, transfer to the second culture medium and continue culturing at 30°C for 120 hours.

[0023] The first culture medium is a buffered complete culture medium BMGY containing glycerol; the second culture medium is a buffered complete culture medium BMMY containing methanol; during the culture process after the transfer, methanol is added once every 24 hours, and the volume of methanol added each time is 0.5% to 2% of the volume of the fermentation liquid. Preferably, the volume of methanol added is 0.5%.

[0024] In a sixth aspect, the present invention provides the use of the brasilien mutant described in the first aspect as a sweetener in the field of food or medical excipients. The brasilien mutant can improve the sweetness performance of brasilien, and its sweetness is increased by 240% compared with the brasilien before mutation.

[0025] Beneficial effects:

[0026] The invention provides a brasiliensis mutant, which, after being expressed in Pichia pastoris, has a sweetness that is 240% higher than that of the brasiliensis before mutation and can be widely used in the fields of food, medicine, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0028] Figure 1 This is the PCR identification diagram of the recombinant strain GS115 / pPIC9K-Bra, where M is a 5000 bp marker and 1-4 correspond to 4 different positive clones.

[0029] Figure 2 The PCR identification diagram of the mutant plasmid. Among them, M, 5000bp Marker; 0, plasmid vector pPIC9K-Bra; 1-6 correspond to the recombinant plasmids pPIC9K-Bra-Asp29Lys, pPIC9K-Bra-Glu36Arg, pPIC9K-Bra-Asp50Ala, pPIC9K-Bra-Asp29Lys-Glu36Arg, pPIC9K-Bra-Asp29Lys-Asp50Ala, and pPIC9K-Bra-Glu36Arg-Asp50Ala, respectively.

[0030] Figure 3The figure is the SDS-PAGE identification diagram of the recombinant Saccharomyces cerevisiae into which the mutant protein was introduced. Among them, M, 66.0KdaMarker; 0, unmutated strain GS115 / pPIC9K-Bra; 1-6 correspond to strains GS115 / pPIC9K-Bra-Asp29Lys, GS115 / pPIC9K-Bra-Glu36Arg, GS115 / pPIC9K-Bra-Asp50Ala, GS115 / pPIC9K-Bra-Asp29Lys-Glu36Arg, GS115 / pPIC9K-Bra-Asp29Lys-Asp50Ala, GS115 / pPIC9K-Bra-Glu36Arg-Asp50Ala, respectively.

[0031] Figure 4 The sweetness test results of mutant proteins relative to standard sucrose. Among them, 1 is the unmutated protein Bra; 2-7 correspond to the mutant proteins Bra-Asp29Lys, Bra-Glu36Arg, Bra-Asp50Ala, Bra-Asp29Lys-Glu36Arg, Bra-Asp29Lys-Asp50Ala, and Bra-Glu36Arg-Asp50Ala, respectively. DETAILED DESCRIPTION

[0032] The present invention will be further described in detail below in conjunction with specific embodiments. The following examples are only illustrative and not definitive, and cannot be used to limit the scope of protection of the present invention.

[0033] The raw materials used in the present invention, unless otherwise specified, are conventional commercially available products; the methods used in the present invention, unless otherwise specified, are conventional methods in the art.

[0034] The culture medium used in the present invention can be as follows:

[0035] LB medium: tryptone 10 g / L, yeast extract powder 5 g / L, sodium chloride 10 g / L;

[0036] YPD medium: tryptone 20 g / L, yeast extract powder 10 g / L, glucose 20 g / L;

[0037] Solid culture medium is liquid culture medium with agar powder added in an amount of 20 g / L;

[0038] MD solid medium: glucose 20g / L, YNB 13.4g / L, biotin 0.4mg / L, agar powder 20g / L.

[0039] Buffered complete medium containing glycerol (BMGY): 20 g / L tryptone, 10 g / L yeast extract powder, 3.4 g / L yeast nitrogen base without amino acids and ammonium sulfate, 10 g / L ammonium sulfate, 20 g / L glycerol, 0.4 mg / L biotin, 100 mL / L 1M (pH 6.0) phosphate buffer;

[0040] Methanol buffered complete medium (BMMY): 20 g / L tryptone, 10 g / L yeast extract powder, 3.4 g / L yeast nitrogen base without amino acids and ammonium sulfate, 10 g / L ammonium sulfate, 2% v / v methanol, 0.4 mg / L biotin, 100 mL / L 1M (pH 6.0) phosphate buffer.

[0041] The present invention is further described below in conjunction with examples.

[0042] Example 1 Construction of Pichia pastoris engineered bacteria expressing recombinant brasiliensis

[0043] 1. Construction of expression vector pPIC9K-Bra

[0044] The Brazzein (Bra) gene from the West African plant Pentadiplandra brazzeana Baillon was used as a template. The amino acid sequence of the Brazzein is shown in SEQ ID No. 1. The primers Bra-F (tgaagcttacgta gaattc atggacaaatgcaaaaaagtg, underlined is the EcoRⅠ restriction site) and Bra-R (tgcgactactgcgaatactaa gcggccgc gaattaattcg, underlined NotⅠ restriction site), PCR amplification, amplification conditions are 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 10s, reaction for 30 cycles; 72℃ extension for 5min. The PCR amplification product was recovered by gel and connected to the pPIC9K vector double-digested with EcoRⅠ and NotⅠ through one-step cloning, and transformed into E. coli DH5α competent cells for sequence determination, colony PCR and EcoRⅠ and NotⅠ double digestion verification. The verified recombinant vector pPIC9K-Bra was used to transform Pichia pastoris competent cells to construct the recombinant strain GS115 / pPIC9K-Bra.

[0045] 2. Transformation of Pichia pastoris with expression vector pPIC9K-Bra

[0046] The expression vector pPIC9K-Bra obtained in step (1) was linearized by SalⅠ digestion and then recovered by gel extraction using 30-50 μL sterile ddH 2 O was dissolved. 5-10 μg of linearized plasmid was mixed with 90 μL of Pichia pastoris GS115 competent cells and transformed by electroporation. After screening on MD plates, the recombinant strain GS115 / pPIC9K-Bra was obtained, and positive clones were selected for PCR identification. The results are shown in Figure 1 As shown, there is a clear band at the 600 bp position, the size of which is consistent with the expected fragment size, indicating that the linearized recombinant plasmid has been successfully integrated into the chromosome of the P. pastoris GS115 genome.

[0047] At the same time, the vector pPIC9K was linearized by SalⅠ digestion and recovered by gel using 30-50 μL sterile ddH 2 5-10 μg of the linearized plasmid was mixed with 90 μL of Pichia pastoris GS115 competent cells and transformed by electroporation to obtain the control strain GS115 / pPIC9K.

[0048] 3. Protein production by fermentation of Pichia pastoris transformant GS115 / pPIC9K-Bra

[0049] The recombinant strain GS115 / pPIC9K-Bra and the control strain GS115 / pPIC9K constructed in step (2) were inoculated into YPD medium, and cultured at 30°C and 200 rpm for 24 h to obtain seed solution. The seed solution was inoculated into glycerol buffered complete medium (BMGY) at a 10% v / v inoculum and cultured at 30°C and 200 rpm until OD 600 3-4, the cells were collected by centrifugation and transferred to a complete methanol buffered medium (BMMY) at 30°C and 200 rpm for 120 h, and methanol was added every 24 h at 0.5% of the volume of the fermentation liquid. The supernatant was collected by centrifugation after induced expression, and the sweetness performance and concentration were measured.

[0050] Example 2 Determination of site-directed mutation sites of the brasilin gene

[0051] The tertiary structure of the brasiliensis gene (KF013250) was simulated by computer, and three key sites were selected for site-directed mutagenesis, including amino acid sites 29, 36 and 50 that may be related to sweetness properties.

[0052] The 29th position was originally aspartic acid (Asp), the 36th position was originally glutamic acid (Glu), and the 50th position was originally aspartic acid (Asp). The present invention pre-mutates the 29th position to lysine (Lys), the 36th position to arginine (Arg), and the 50th position to alanine (Ala), and performs site-directed mutagenesis by reverse PCR.

[0053] Primers were designed for the selected mutation sites using SnapGene, as shown in Table 1.

[0054] Table 1 Primer sequences used for site-directed mutagenesis

[0055]

[0056] The recombinant plasmid pPIC9K-Bra prepared in Example 1 was extracted using a kit produced by Nanjing Novezan Biotechnology Co., Ltd.

[0057] Aspartic acid at position 29 of the amino acid sequence of brazilian melamine was mutated using primers Asp29Lys-F and Asp29Lys-R to construct the recombinant plasmid pPIC9K-Bra-Asp29Lys.

[0058] Glu36Arg-F and Glu36Arg-R were used as primers to mutate the glutamic acid at position 36 and construct the recombinant plasmid pPIC9K-Bra-Glu36Arg;

[0059] Aspartic acid at position 50 was mutated using Asp50Ala-F and Asp50Ala-R as primers to construct the recombinant plasmid pPIC9K-Bra-Asp50Ala.

[0060] The PCR reaction system was as follows: 2×Phanta Master Mix 25 μL, ddH 2 O 19μL, 2μL of 20μM upstream and downstream primers, 2μL of template DNA, total volume 50μL. Reaction conditions: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 10min; 30 cycles; 72℃ extension for 5min. The PCR product was subjected to agarose gel electrophoresis.

[0061] After the single mutation was successful, the second mutation site was introduced using the single site mutation plasmid as a template and another pair of mutation primers according to the same PCR system, that is, the double mutation sites Asp29Lys-Glu36Arg, Asp29Lys-Asp50Ala, and Glu36Arg-Asp50Ala were constructed.

[0062] After the PCR reaction was completed, 1 μL of DpnⅠ was directly added to the PCR reaction system, mixed well, and incubated in a 37°C metal bath for 1 h.

[0063] The PCR product was purified using a kit from Nanjing Novozymes Biotech Co., Ltd. The above single mutation recombinant plasmid and double mutation recombinant plasmid were transformed into Escherichia coli DH5α competent cells, respectively, to obtain recombinant bacteria, single clones of recombinant bacteria were picked, and plasmids were extracted respectively: pPIC9K-Bra-Asp29Lys, pPIC9K-Bra-Glu36Arg, pPIC9K-Bra-Asp50Ala, pPIC9K-Bra-Asp29Lys-Glu36Arg, pPIC9K-Bra-Asp29Lys-Asp50Ala, and pPIC9K-Bra-Glu36Arg-Asp50Ala.

[0064] After double digestion of the recombinant vectors pPIC9K-Bra-Asp29Lys, pPIC9K-Bra-Glu36Arg, pPIC9K-Bra-Asp50Ala, pPIC9K-Bra-Asp29Lys-Glu36Arg, pPIC9K-Bra-Asp29Lys-Asp50Ala, and pPIC9K-Bra-Glu36Arg-Asp50Ala with EcoRI and NotI, agarose gel electrophoresis was performed, as shown in FIG. Figure 2 , the lengths of the target fragments are all equal, and they are all the correct lengths of the target fragments. The recombinant vectors with the correct enzyme digestion identification were selected and sent to General Bio (Anhui) Co., Ltd. for sequencing. The consistency of the nucleotide sequence comparison results of the amplified Brazilian sweet protein gene reached 99.23%, and the nucleotide sequences except the mutation site were completely consistent. The above verification shows that the recombinant plasmid was successfully constructed.

[0065] The recombinant plasmid constructed in this example was transformed into Pichia pastoris GS115 according to the method described in Example 1 to obtain a recombinant strain, and the recombinant strain was fermented to produce protein according to the method described in Example 1. SDS-PAGE analysis showed that Figure 3 As shown, there is an obvious band at a molecular weight of 6.5 kDa, which is basically consistent with the size of the sweet protein Brazzein.

[0066] Example 3 Sweetness Detection

[0067] The method for determining the expression level of the sweet protein Brazzein in the present invention can be as follows:

[0068] Accurately weigh 0.05g of crystallized bovine serum albumin on an analytical balance into a beaker, add a small amount of distilled water to dissolve, and transfer to a 50mL volumetric flask. Rinse the residual liquid in the beaker with a small amount of distilled water for several times, pour the rinse liquid into the volumetric flask, and finally dilute to the scale with distilled water to complete the preparation of standard protein, in which the concentration of bovine serum albumin is 1g / L.

[0069] The method for drawing the standard curve is to take 6 test tubes respectively, number them, add reagents according to Table 2 and mix them evenly.

[0070] Table 2 Standard curve concentration drawing method

[0071] Tube No. 1 2 3 4 5 6 Sample (mL) 0 0.4 0.8 1.2 1.6 2 Distilled water (mL) 2 1.6 1.2 0.8 0.4 0 Protein concentration (g / L) 0 0.2 0.4 0.6 0.8 1.0

[0072] The samples were subjected to SDS-PAGE protein electrophoresis and imaged using an optical density scanner. The SDS-PAGE images were analyzed using computer software Image J to obtain the absolute gray value of the standard protein to be tested. A standard curve was drawn with protein concentration as the horizontal axis and absolute gray value as the vertical axis.

[0073] The sample detection method is to use SDS-PAGE protein electrophoresis, use optical density scanner to image, analyze the SDS-PAGE image through computer software Image J, obtain the absolute gray value of the protein of the sample to be tested, and obtain the protein concentration based on the standard curve.

[0074] The results showed that the protein content of the unmutated Brazilian sweet protein Brazzein in the recombinant bacteria at the shake flask level was 0.64 g / L; the protein content of the Bra-Asp29Lys mutant was 0.65 g / L; the protein content of the Bra-Glu36Arg mutant was 0.51 g / L; the protein content of the Bra-Asp50Ala mutant was 0.61 g / L; the protein content of the Bra-Asp29Lys-Glu36Arg mutant was 0.63 g / L; the protein content of the Bra-Asp29Lys-Asp50Ala mutant was 0.61 g / L; and the protein content of the Bra-Glu36Arg-Asp50Ala mutant was 0.59 g / L.

[0075] The sweet taste detection method of the sweet protein Brazzein in the present invention can be as follows:

[0076] The protein sample obtained by fermentation in the above example was passed through distilled water. Ultra-15 ultrafiltration centrifuge tubes were used to replace the target protein solution to obtain protein samples for sweetness threshold determination.

[0077] The sweetness threshold refers to the lowest concentration at which the sweetness of protein can be tasted. This paper uses the artificial tasting double-blind method for determination. Ten volunteers of average gender and average age were selected. The concentration of the protein sample was first set to 0.5g / L using distilled water, and then the concentration was set to 0.5, 0.4, 0.3, 0.2, 0.1, 0.05, 0.01g / L and other solutions with different dilution multiples, and a 10g / L sucrose solution was used as the control group. Volunteers were required to taste 2mL of sucrose solution first, and then taste 2mL of protein samples. The sample tasting order was from low to high; after each tasting, they had to rinse their mouths with deionized water until no taste remained, and all samples were placed on the tip of the tongue for no less than 15s before spitting out. The scoring criteria for the sweetness intensity of samples of different concentrations were: 0, not sweet and uncertain sweetness; 1, a little sweet; 2, sweet; 3, very sweet; 4, strong sweetness. The average value was taken as the result, and the sample with a score of 2 was selected as the sweetness threshold and compared with the 10g / L sucrose solution. The sweetness of the sample was obtained according to the following formula: sweetness multiple relative to sucrose = 10 / dilution multiple of the sample that tasted sweetness.

[0078] The results are as follows Figure 4 As shown, the sweetness of the unmutated Brazilian sweet protein Brazzein in the recombinant bacteria at the shake flask level reached 2000 times that of standard sucrose; the sweetness of the Bra-Asp29Lys mutant was 2800 times that of standard sucrose; the sweetness of the Bra-Glu36Arg mutant was 3200 times that of standard sucrose; the sweetness of the Bra-Asp50Ala mutant was 3200 times that of standard sucrose; the sweetness of the Bra-Asp29Lys-Glu36Arg mutant was 4000 times that of standard sucrose; the sweetness of the Bra-Asp29Lys-Asp50Ala mutant was 6800 times that of standard sucrose; and the sweetness of the Bra-Glu36Arg-Asp50Ala mutant was 4800 times that of standard sucrose.

[0079] The brasiliensis mutant provided by the invention can be used as a sweetener and is widely used in the fields of food, biology and medicine, and has broad application prospects.

[0080] The present invention provides a brasiliensis mutant and its application ideas and methods. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A brasiliensis mutant, characterized in that: The brazilian thauma protein mutant is obtained by subjecting the brazilian thauma protein with an amino acid sequence as shown in SEQ ID No. 1 to any one of the following amino acid mutations (1) to (6): (1)D50A; (2) E36R; (3)D29K; (4) D29K and D50A; (5) E36R and D50A; (6) D29K and E36R.

2. The brasiliensis mutant according to claim 1, characterized in that The brazilian thauma protein mutant is obtained by subjecting the brazilian thauma protein with an amino acid sequence as shown in SEQ ID No. 1 to amino acid mutations of D29K and D50A, or to amino acid mutations of E36R and D50A.

3. A gene encoding the brasiliensis mutant according to claim 1 or 2.

4. An expression cassette or recombinant vector containing the gene according to claim 3.

5. A recombinant bacterium containing the expression cassette or recombinant vector according to claim 4.

6. The recombinant bacterium according to claim 5, characterized in that The starting bacteria of the recombinant bacteria is Pichia pastoris.

7. Use of the recombinant bacteria according to claim 5 or 6 in the fermentation production of brasiliensis mutants.

8. The use according to claim 7, characterized in that: The recombinant bacteria were inoculated into the first culture medium and cultured at 28-32°C until OD 600 After 3 to 4 hours, the cells were transferred to the second culture medium and cultured at 28 to 32° C. for 96 to 144 hours to obtain the brasiliensis mutant.

9. The use according to claim 8, characterized in that: The first culture medium is a buffered complete culture medium BMGY containing glycerol; the second culture medium is a buffered complete culture medium BMMY containing methanol; After transferring to the second culture medium, methanol is added once every 24 hours during the culture process, and the amount of methanol added each time is 0.5% to 2% of the volume of the fermentation liquid.

10. Use of the brasiliensis mutant according to claim 1 or 2 as a sweetener in the field of food or medical excipients.

Images