Application and methods of KLF5 transcription factor in regulating porcine skeletal muscle development

Abstract

This invention discloses the application of KLF5, a transcription factor from the KLF family with the highest differential expression in slow-oxidizing soleus muscle (SOL) and fast-fermenting extensor digitorum longus (EDL) tissues, in regulating porcine skeletal muscle development. By analyzing tissue-specific enhancer-promoter interactions and the specific expression of synergistic transcription factor regulation in specific muscle types, this study reveals and verifies that KLF5 can regulate the activity of super-enhancers interacting with the MYH1 / 4 genes (MYH1 and MYH4 genes), increase the interaction frequency between the super-enhancers and gene promoters, promote the transcription of MYH4 and MYH1 genes, and induce the formation of fast-fermenting myofibrils. This provides a new breeding target for pork quality improvement and a theoretical reference for using functional site mutation technology to directionally alter the proportion of myofibril types; it also provides a new method for increasing the proportion of red meat in pork and improving post-slaughter quality.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to the application and method of the KLF5 transcription factor in regulating porcine skeletal muscle development. Background Technology

[0002] Skeletal muscle accounts for 40-60% of the total body weight and is the main tissue providing meat products for livestock and poultry. It is also the primary organ for regulating glucose metabolism and maintaining blood glucose homeostasis. Differences in contractile ability and glycogen metabolism among different types of muscle fibers lead to varying compositional ratios, directly affecting the quality of livestock and poultry muscle and the body's susceptibility to metabolic diseases. The metabolic diversity, plasticity, and fiber type composition of muscle fibers result in different muscle characteristics. Based on the expression of myosin heavy chain (MyHC) subtypes, muscle fibers can be mainly divided into slow-twitch and fast-twitch muscle fibers. Slow-twitch muscle fibers primarily express MYH7 (MyHC I), while fast-twitch muscle fibers express MYH1 (MyHC IIa) and MYH4 (MyHC IIb). Slow-twitch muscle fibers are beneficial for oxidative metabolism and endurance, while fast-twitch muscle fibers are primarily beneficial for glycolysis and contract faster.

[0003] While the total number of muscle fibers in adults remains stable, the composition of muscle fiber types can adapt to external stimuli such as aging, exercise, or disease. In obesity and type 2 diabetes, the shift from oxidative slow-moving muscle fibers to glycolytic fast-moving muscle fibers leads to impaired insulin sensitivity, reduced metabolic flexibility, and insulin resistance. In livestock production, soleus muscle (SOL), rich in slow-moving muscle fibers, has superior meat quality compared to the fast-moving extensor digitorum longus (EDL), characterized by a redder color, higher water retention, and lower tenderness. A deeper understanding of the regulatory mechanisms governing muscle fiber determination and transformation can provide therapeutic insights and strategies for improving meat quality and treating human metabolic diseases.

[0004] Cis-regulatory elements (CREs), including enhancers and promoters, are defined by specific epigenetic features and regulate gene expression through cell type-specific chromatin loops. Superenhancers (SEs) are large clusters of enhancers and key regulators of lineage-specific gene expression. SEs coordinate with chromatin regulators to form extensive loops within topologically associated domains (TADs), enabling precise gene activation. However, the genome-wide dynamics of enhancer-promoter interactions (EPs) between muscles, particularly their role in shaping muscle-specific phenotypes, remain unclear. Therefore, further research is needed to provide new methods and insights for muscle regulation. Summary of the Invention

[0005] The purpose of this invention is to provide an application and method of KLF5 transcription factor in regulating porcine skeletal muscle development, so as to provide a new method and idea for regulating porcine skeletal muscle development, and its application in regulating porcine skeletal muscle development to regulate the type of muscle fibers in pigs, and to provide new ideas and methods for improving meat quality.

[0006] According to a first aspect of the present invention, the application of the KLF5 transcription factor in regulating porcine skeletal muscle development is provided. Thus, through this application, porcine muscle fiber type and porcine skeletal muscle development can be effectively regulated.

[0007] According to a second aspect of the present invention, the application of the KLF5 transcription factor in the preparation of products capable of regulating porcine skeletal muscle development is provided. Thus, through this application, porcine muscle fiber type and porcine skeletal muscle development can be effectively regulated.

[0008] According to a third aspect of the invention, an agent that promotes or inhibits the KLF5 transcription factor is provided for the application of regulating porcine skeletal muscle development. Thus, through this application, porcine muscle fiber type and porcine skeletal muscle development can be effectively regulated.

[0009] According to a fourth aspect of the invention, an agent that promotes or inhibits the KLF5 transcription factor is provided for use in the preparation of products capable of regulating porcine skeletal muscle development. Thus, through this application, porcine muscle fiber type and porcine skeletal muscle development can be effectively regulated.

[0010] In some embodiments, the regulation of porcine skeletal muscle development refers to the regulation of porcine muscle fiber type conversion by controlling the expression of the KLF5 transcription factor.

[0011] According to a fifth aspect of the present invention, a method for regulating porcine muscle fiber type conversion is provided, which regulates the expression of the KLF5 transcription factor to achieve the conversion of porcine muscle fiber type. Therefore, by regulating the expression of the KLF5 transcription factor, the conversion of porcine muscle fiber type and the development of porcine skeletal muscle can be regulated, which can then be used to improve pork quality.

[0012] In some embodiments, the method includes injecting or transfecting a KLF5 overexpression vector to promote KLF5 expression, thereby promoting the formation of glycolytic fast myofibers, inhibiting the formation of oxidative slow myofibers, or promoting the conversion of oxidative slow myofibers to glycolytic fast myofibers.

[0013] In some embodiments, the nucleotide sequence of the KLF5 overexpression vector is shown in SEQ ID No:14.

[0014] In some embodiments, the method includes promoting the formation of oxidative slow muscle fibers, inhibiting the formation of glycolytic fast muscle fibers, or promoting the conversion of glycolytic fast muscle fibers to oxidative slow muscle fibers by inhibiting the expression of KLF5.

[0015] According to a sixth aspect of the present invention, the application of the KLF5 transcription factor in regulating the activity of a super-enhancer (hereinafter referred to as "SE-MYH1 / 4") that interacts with the MYH1 and MYH4 genes is provided. Thus, in this application, the activity of the SE-MYH1 / 4 enhancer is regulated by overexpressing KLF5, thereby regulating the interaction frequency between SE-MYH1 / 4 and gene promoters, and consequently regulating MYH1 / 4 gene expression, promoting the formation of glycolytic fast myofibrils, and achieving regulation of myofibril type.

[0016] According to a seventh aspect of the present invention, the application of the KLF5 transcription factor in increasing the interaction frequency between super-enhancers and gene promoters that interact with the MYH1 and MYH4 genes (hereinafter referred to as "MYH1 / 4 genes"). Thus, in this application, by overexpressing KLF5, the interaction frequency between SE-MYH1 / 4 and gene promoters can be increased, thereby regulating MYH1 / 4 gene expression, promoting the formation of glycolytic fast-twitch myofibrils, and achieving regulation of myofibril type.

[0017] According to an eighth aspect of the invention, the application of the KLF5 transcription factor in promoting the transcription or expression of the MYH4 and MYH1 genes is provided. Thus, in this application, by overexpressing KLF5, the expression of the MYH1 / 4 genes is promoted, thereby promoting the formation of glycolytic fast myofibrils and achieving regulation of myofibril type.

[0018] According to a ninth aspect of the present invention, an application is provided for regulating porcine myofiber type conversion using a kit / nucleic acid molecule / recombinant protein / recombinant vector / product containing a KLF5 transcription factor expression regulator. Thus, through this application, regulation of porcine myofiber type conversion and regulation of porcine skeletal muscle development can be achieved.

[0019] The beneficial effects of this invention are as follows: This invention discloses the application of KLF5, a transcription factor from the KLF family with the highest differential expression in slow-oxidizing soleus muscle (SOL) and fast-fermenting extensor digitorum longus (EDL) tissues, in regulating porcine skeletal muscle development. By analyzing tissue-specific enhancer-promoter interactions and the specific expression of synergistic transcription factor regulation in specific muscle types, this invention reveals and verifies that KLF5 can regulate the enhancer activity of SE-MYH1 / 4, increase the interaction frequency between SE-MYH1 / 4 and gene promoters, promote the transcription of MYH4 and MYH1 genes, and induce the formation of fast-fermenting myofibrils. This provides new breeding targets for pork quality improvement and a theoretical reference for using functional site mutation technology to directionally change the proportion of myofibril types; it also provides new methods for increasing the proportion of red meat in pork and improving post-slaughter quality. Attached Figure Description

[0020] Figure 1 The image shows the results of SE identification and characteristic analysis: [Image showing the results of SE identification and characteristic analysis] Figure 1 A is a note for SE, and 554 and 592 super enhancers were identified in the SOL and EDL organizations, respectively; Figure 1 B represents the proportion of super enhancers specific to EDL and SOL tissues; Figure 1 C represents the location of super enhancers, the vast majority of which reside within conservative topological domains;

[0021] Figure 2 Figure showing the analysis results of how super-enhancers promote the formation of glycolytic myofibrils via chromatin loops: (The figure is missing from the original text.) Figure 2 A shows a heatmap of the expression characteristics of SOL-specific super-enhancer interacting genes, EDL-specific super-enhancer interacting genes, and SOL and EDL interacting with super-enhancer interacting genes. Figure 2 B is an IGV analysis showing the interaction diagram between the MYH4 gene encoding MyHC type IIb and the MYH1 gene encoding MyHC type IIx in EDL tissue and a 42-kb long EDL-specific superenhancer (SE-MYH1 / 4); Figure 2 C represents a reconstructed three-dimensional chromatin conformation model of the MYH1 and MYH4 genes to explore the spatial distance between SE-MYH1 / 4 and the promoters of the MYH1 and MYH4 genes.

[0022] Figure 3The diagram shows the results of KLF5 promoting SE-MYH1 / 4-mediated chromatin three-dimensional interactions: [Diagram showing KLF5 promoting SE-MYH1 / 4-mediated chromatin interactions] Figure 3 A shows the footprint analysis results of super enhancers. Diff indicates the difference in the proportion of transcription factors with at least one binding site in super enhancers between SOL and EDL. FC indicates the difference in the expression of transcription factors between SOL and EDL tissues. Figure 3 Figure B shows the results of differential analysis of transcription factor footprints, identifying the proportion of super-enhancers bound to the KLF transcription factor family in SOL and EDL tissues. Figure 3 Figure C shows the binding analysis results of the KLF transcription factor family in SE-MYH1 / 4;

[0023] Figure 4 The diagram shows the results of CRISPR-Cas9 experiments verifying the regulatory effect of SE-MYH1 / 4 on the expression of myofibril MYH1 and MYH4 genes: [Image showing the results of CRISPR-Cas9 experiments verifying SE-MYH1 / 4 on the expression of myofibrils MYH1 and MYH4 genes] Figure 4 A shows the results of the dual-luciferase reporter assay to verify enhancer activity. Vector represents the control group, SE-MYH1 / 4-E1 represents the E-MYH1 / 4-E1 recombinant plasmid group, and SE-MYH1 / 4-E2 represents the SE-MYH1 / 4-E2 recombinant plasmid group. Figure 4 B is an experimental schematic diagram of CRISPR-Cas9; Figure 4 C is the result of PCR electrophoresis experiment verifying the SE-MYH1 / 4 cleavage efficiency; Figure 4 Figure D shows the results of qPCR detection of changes in the expression of myofibroblast marker genes MYH1 and MYH4 before and after super enhancer knockout. In the figure, * represents P<0.05, ** represents P<0.01, and *** represents P<0.001.

[0024] Figure 5 A graph showing the difference in binding ability of KLF5 and SE-MYH1 / 4 in SOL and EDL tissues;

[0025] Figure 6 The results of ChIP-qPCR experiments to verify the enhanced H3K27ac enrichment after KLF5 overexpression are shown in the figure: EV represents the control group, OV-KLF5 represents the KLF5 overexpression group, IgG represents the detection by immunoglobulin G antibody, and IP represents the detection by H3K27ac antibody. ** in the figure represents P<0.01.

[0026] Figure 7 The figure shows the results of dual-luciferase assays to verify the enhanced activity of SE-MYH1 / 4 after KLF5 overexpression. *** in the figure represents P<0.001.

[0027] Figure 8The results of 3C-qPCR experiments to verify the effect of KLF5 promoting the interaction between SE-MYH1 / 4 and MYH4 and MYH1 are shown in the figure: where EV represents the control group, OV-KLF5 represents the KLF5 overexpression group, and the horizontal axis represents the interaction results of the internal reference genes ACTB, MYH1, and MYH4 in the KLF5 overexpression group and the control group. In the figure, ** represents P<0.01, and *** represents P<0.001.

[0028] Figure 9 The following figure shows the results of qPCR analysis of changes in the expression of MYH1 and MYH4 after KLF5 overexpression: EV represents the control group, OV-KLF5 represents the KLF5 overexpression group, and the horizontal axis represents the relative mRNA expression levels of KLF5, MYH1, and MYH4 in the KLF5 overexpression group and the control group. *** in the figure represents P<0.001. Detailed Implementation

[0029] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0030] Example 1: Discovering regulatory factors that can regulate the development of skeletal muscle in pigs.

[0031] Swine muscle tissue was collected, and the SOL and EDL tissue samples were ground into a fine powder using a cryogenic grinder. The powder was fixed with 2% formaldehyde at room temperature for 10 min. A certain volume of glycine solution was added to bring the final concentration to 0.2 M, and the reaction was carried out at room temperature for 5 min. After termination, the cells were centrifuged at 1500 rpm for 5 min, and the supernatant was discarded. The cells were resuspended in an equal volume of PBST solution, centrifuged at 1500 rpm for 5 min, and the supernatant was discarded. 350 μL of cold Hi-C lysis buffer (15 mM Tris-HCl, 15 mM NaCl, and 0.2% Igepal) was added, and the reaction product was incubated on ice for 20 min. The lysed cell pellets were then resuspended in 50 μL of 0.5% SDS solution and incubated at 65 °C for 10 min. The reaction was then terminated by incubation at 37 °C for 20 min with Triton X-100. 100 UA of Ulu I restriction endonuclease was added, and the cells were digested overnight at 37 °C. The enzymatic digestion reaction was terminated at 62°C for 20 minutes. The DNA fragments were then incubated with a biotin-containing mixture and DNA polymerase at 37°C to achieve end labeling. The DNA was ligated using T4 DNA ligase and slowly rotated at room temperature for 4 hours. After the reaction, 5 μL of 20 mg / mL proteinase K and 12 μL of 10% SDS solution were added to the system, and the mixture was incubated at 55°C for 30 minutes. Then, 13 μL of 5M NaCl solution was added, and the mixture was incubated overnight at 68°C to decrosslink. The DNA was then precipitated using DNA purification buffer (15 μL of 3M sodium acetate solution, 1 μL of glycogen, and 240 μL of anhydrous ethanol) at -80°C, washed twice with 75% ethanol, and finally dissolved in an appropriate amount of water. The purified DNA was sheared using Covaris S220, ensuring the fragments were in the 300-500 bp range. Hi-C libraries were then constructed following the instructions of the Illumina library construction kit (GenSeq, GS-EG-003) and sequenced on the Illumina HiSeq X TenPE150 platform.

[0032] Sequencing results of pig SOL and EDL tissue Hi-C library are as follows: Figure 1 As shown, the results indicate that 554 and 592 candidate SEs were identified in the SOL and EDL organizations, respectively. Figure 1 A) It was found that approximately 35% of SEs were tissue-specific. Figure 1 B), and the vast majority of them are located inside the TAD, with only about 3.2% of the SEs located at the TAD boundary. Figure 1 C). Furthermore, over 80% of SEs are located within conservative TADs ( Figure 1 C) suggests that SE plays an important role in gene regulation.

[0033] Further analysis of the sequencing results of the Hi-C library from porcine SOL and EDL tissues yielded the following results: Figure 2 As shown: 365 and 673 super-enhancer-promoter interactions (SE-Ps) identified in SOL and EDL tissues, respectively, involving 744 expressed genes, including 46 differentially expressed genes, were classified into three categories based on their tissue specificity: Category 1 consists of SOL-specific super-enhancer interacting genes; Category 2 consists of EDL-specific super-enhancer interacting genes; and Category 3 consists of genes that interact with super-enhancers in both SOL and EDL, such as... Figure 2 As shown in Figure A, both the MYH4 gene encoding the glycolytic MyHC IIb type and the MYH1 gene encoding the MyHC IIx type in the EDL tissue interact with a 42-kb long EDL-specific superenhancer (abbreviated as SE-MYH1 / 4). Figure 2 B). Chromatin region interaction analysis also confirmed that the SE-MYH1 / 4 interacts more frequently with the MYH1 and MYH4 promoters in the EDL tissue compared to the SOL tissue. Using Genomeflow software, a three-dimensional chromatin model of the region near the MYH1 and MYH4 genes was reconstructed. Figure 2 C) The results confirmed that the SE-MYH1 / 4 gene promoters were more closely spaced from the MYH1 and MYH4 gene promoters in EDL tissues, suggesting that this super enhancer may promote the formation of glycolytic myofibrils through chromatin loops.

[0034] Further analysis revealed that the KLF and AP-1 transcription factor families showed the greatest difference in the proportion of SE binding between the two tissues. Figure 3 A). Specifically, compared to SOL tissue, SE was bound by the KLF transcription factor family at a higher rate in EDL tissue, and by the AP-1 transcription factor family at a lower rate. Finally, differential analysis of transcription factor footprints identified that the KLF transcription factor family had a stronger ability to bind to open chromatin regions in EDL (A). Figure 3 B). Based on these results, the focus was on the binding of the KLF transcription factor family to the superenhancer SE-MYH1 / 4. It was found that KLF5 is highly expressed in EDL tissues, has a stronger ability to bind to open chromatin regions, and binds to the EDL-specific superenhancer SE-MYH1 / 4 (B). Figure 3 C) indicates that the KLF5 transcription factor can promote chromatin three-dimensional interactions mediated by the super-enhancer SE-MYH1 / 4. It is speculated that the KLF5 transcription factor may be used to regulate porcine skeletal muscle development.

[0035] Example 2: CRISPR-Cas9 experiment to verify the regulation of SE-MYH1 / 4 on the expression of fast-twitch muscle fiber marker genes.

[0036] 2.1 Dual-luciferase reporter gene assay.

[0037] Based on the results of Example 1 and using ROSE software, two candidate enhancers were selected: SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2. SE-MYH1 / 4 represents a super enhancer interacting with the MYH1 / 4 gene, and SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2 represent conserved ordinary enhancers E1 and E2 within the super enhancer SE-MYH1 / 4, respectively. The nucleotide sequence of SE-MYH1 / 4-E1 is shown in SEQ ID No:1, and the nucleotide sequence of SE-MYH1 / 4-E2 is shown in SEQ ID No:2.

[0038] The pGL3-Promoter plasmid (Shanghai Zeye Biotechnology Co., Ltd., ZY6726) was double-digested with the SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2 fragments using restriction endonucleases (KpnⅠ and XbaⅠ) and then ligated. The resulting recombinant plasmids were designated as SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2, respectively. The ligated recombinant plasmids were then used for competent cell transformation and plasmid extraction.

[0039] Porcine skeletal satellite cells were transfected with either the SE-MYH1 / 4-E1 or SE-MYH1 / 4-E2 recombinant plasmid using Lipofectamine 3000 and Opti-MEM. In the control group, only the pGL3-Promoter empty vector was transfected into porcine skeletal satellite cells. The experimental groups were transfected with either the SE-MYH1 / 4-E1 or SE-MYH1 / 4-E2 recombinant plasmids, with each plasmid transfection performed at least three times. Cells were collected after 72 hours of incubation, and fluorescence values ​​were measured using a dual-luciferase reporter gene assay kit (YEASEN, 11402ES60). Results are shown below. Figure 4 As shown in Figure A: Compared with the control group (represented by Vector), the fluorescence values ​​of the SE-MYH1 / 4-E1 recombinant plasmid group and the SE-MYH1 / 4-E2 recombinant plasmid group were significantly increased (P<0.001), indicating that the conserved ordinary enhancer (TE) in the super enhancer SE-MYH1 / 4 has significant enhancer activity in porcine skeletal muscle satellite cells.

[0040] 2.2 CRISPR-Cas9 experiment.

[0041] (1) sgRNA design of candidate enhancers (SE-MYH1 / 4-E1, SE-MYH1 / 4-E2)

[0042] sgRNA sequences were designed for the two candidate enhancers (SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2) respectively (pattern shown in Figure 1). Figure 4 As shown in B), and add BbsI restriction sites to the 5' ends of the sgRNA's sense and antisense strands as needed (sgRNA sequences are shown in Table 1).

[0043] Table 1 sgRNA Sequence

[0044]

[0045] (2) Construction and identification of CRISPR / Cas9 recombinant plasmids.

[0046] The px330 plasmid (Addgene, 42230) was selected as the vector backbone to construct the targeting vector, and the px330 vector was linearized using the restriction endonuclease BbsI.

[0047] The linearized px330 vector was ligated to the sgRNA sequence fragment shown in Table 1. The ligated recombinant plasmid was then transformed (10 μL of the ligation product was mixed into 100 μL of competent cells before transformation). The extracted plasmid was then sequenced. After confirming successful sgRNA insertion, the recombinant px330 plasmid was stored at -20°C for subsequent transfection experiments.

[0048] (3) Transfection of CRISPR / Cas9 recombinant plasmids.

[0049] Uncontaminated PSC cells (porcine skeletal muscle satellite cells) were resuscitated. When the cells reached 80%–90% confluence, they were digested and passaged into 12-well plates. When the cells reached 60%–80% confluence, liposome transfection was performed. Each plate was divided into two groups: a treatment group (6 wells) co-transfected with recombinant px330 plasmid and pCDNA3.1-EGFP empty vector plasmid (Qiyun Biotechnology, QP1135); and a negative control group (6 wells) co-transfected with the same mass of px330 empty vector plasmid and pCDNA3.1-EGFP empty vector plasmid as the treatment group). The growth medium was replaced 24 hours after transfection. To screen for positive cells, G418 was added to each well to a final concentration of 200 ng / μL, and the cells were incubated at 37°C for 10 days. During this period, the cells were observed daily, and the culture medium and drug were replaced every three days based on cell growth. On day 11 of G418 treatment, when nearly half of the cells had died, the cells were collected for subsequent testing.

[0050] Genomic DNA was extracted from the collected cells, and then amplified by conventional PCR. After electrophoresis to detect qualified bands, sequencing was performed to identify the knockout effect and efficiency of the cells, and the expression of MYH1 and MYH4 genes was quantitatively detected. The results showed that the conserved sgRNA targets of the two superenhancers (SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2) in PSC cells were effective and were cleaved (e.g., Figure 4 (As shown in C). Furthermore, quantitative results also showed that knocking out SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2 significantly reduced the expression of the fast-twitch muscle marker genes MYH1 and MYH4. Figure 4 D)

[0051] The above results indicate that the conserved enhancer within SE-MYH1 / 4 in porcine skeletal muscle satellite cells has enhancer activity, and site-specific knockout will cause a decrease in the expression of the marker genes MYH1 and MYH4 of fast-twitch muscle fibers, proving that the superenhancer SE-MYH1 / 4 can regulate the expression of the marker genes MYH1 and MYH4 of porcine skeletal muscle fast-twitch muscle fibers.

[0052] Example 3: ATAC-seq footprint analysis of KLF5 expression differences in SOL and EDL. I. Experimental procedure.

[0053] Approximately 5 mg of porcine muscle tissue sample was finely powdered using a cryo-mill. Then, 5 mL of pre-frozen PBS solution was added to the powdered muscle tissue, and the mixture was gently vortexed for 10 minutes. The cell pellet was resuspended in 1 mL of lysis buffer (containing 50 mM HEPES, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, and 0.25% Triton X-100), and 50,000-100,000 cell nuclei were isolated following a published library preparation procedure. A transposition reaction mixture containing Tn5 transposase was then added to the isolated muscle cell nucleus suspension, and the mixture was incubated at 37°C for 2 hours. The reaction product was purified using a DNA purification kit. The purified DNA fragments were amplified using PCR, and the amplified products were selected for fragment size (100-600 bp) through gel electrophoresis and other experiments. The selected fragments were then sequenced using PE150 sequencing on an Illumina HiSeq X Ten platform.

[0054] II. Data Analysis.

[0055] Transcription factor footprinting analysis was performed using TOBIAS software with default parameters to identify footprint regions from open chromatin areas. Motif and other information for transcription factors were downloaded from the JASPAR database (https: / / jaspar.elixir.no / ). Transcription factors with a TPM > 1 in at least one tissue were used for subsequent analysis.

[0056] III. Results Analysis.

[0057] According to Example 1, it was found that superenhancers have abundant transcription factor binding sites, and their function requires the synergistic effect of transcription factors. The KLF transcription factor family showed the greatest difference in the proportion of superenhancers bound to EDL and SOL tissues. Compared to SOL tissues, SE was bound by a higher proportion of the KLF transcription factor family in EDL tissues. Therefore, further differential analysis of transcription factor footprints was used to identify the differences in the ability of the KLF transcription factor family to bind to open chromatin regions in EDL and SOL. The results are as follows... Figure 5 As shown, ATAC-seq footprint analysis reveals that KLF5 exhibits different binding modes in SOL and EDL tissues, with KLF5 showing a higher binding affinity to EDL compared to SOL.

[0058] Example 4: Amplification of the KLF5 fragment and construction of the KLF5 overexpression vector (denoted as OV-KLF5 vector).

[0059] Primer design: The porcine KLF5 gene (ID: 100038005) was searched on the ensemble website, and the predicted transcript (ID: NM_001097489) was selected. Its CDS sequence was obtained (as shown in SEQ ID No: 11). Primers for CDS region amplification were designed using the primer design function on the NCBI website (http: / / www.ncbi.nlm.nih.gov / ). The primers are shown in Table 2.

[0060] Table 2 Primers for amplification of porcine KLF5

[0061]

[0062] Note: The underlined part is the nucleic acid restriction endonuclease site.

[0063] Then, using porcine cDNA as a template, PCR amplification was performed using the primers in Table 2. The CDS region fragment of KLF5 was amplified by PCR, and after the sequence was confirmed to be correct by sequencing, it was recovered and purified for subsequent experiments.

[0064] The CDS region fragment of KLF5 and the eukaryotic gene expression vector pcDNA3.1 (Qiyun Biotechnology, QP1673) were digested with the same restriction endonucleases (KpnⅠ and XbaⅠ). The digested products were then ligated using T4 ligase (Guangzhou Angke Biotechnology Co., Ltd.). The recombinant ligation products were then transformed and sequenced. Endotoxin-free plasmids were extracted from correctly sequenced bacterial cultures using the Endo-free Plasmid Mini Kit II (Omega). The concentration was measured and recorded, yielding the porcine KLF5 overexpression vector (denoted as OV-KLF5 vector). Its nucleotide sequence is shown in SEQ ID No:14. The OV-KLF5 vector was stored at -20℃ for later use. Example 5: ChIP-qPCR and dual-luciferase experiments verified the increased H3K27ac enrichment and SE-MYH1 / 4 enhancer activity after KLF5 overexpression.

[0065] 5.1 ChIP-qPCR experiment.

[0066] The experiment was divided into two groups: a control group and a KLF5 overexpression group. The control group was transfected with the empty pcDNA3.1 vector; the KLF5 overexpression group was transfected with the KLF5 overexpression vector (OV-KLF5 vector). The specific procedure is as follows: Transfect porcine skeletal muscle satellite cells that have reached a confluence of approximately 70% are then transfected. The transfection system (using a six-well plate as an example) is as follows: Solution A consists of 125 μL Opti-MEM medium with 5 μL Lipofectamine 3000 added and mixed thoroughly; Solution B consists of 125 μL Opti-MEM medium with 1 μg KLF5 overexpression vector (OV-KLF5) plasmid (KLF5 overexpression group) or pcDNA3.1 empty vector (control group) added and mixed thoroughly, then incubated for 5 min; Solution A and Solution B from the previous step are then mixed and incubated at room temperature for 15 min; Next, the cells to be transfected are removed, the original medium is discarded, and fresh proliferation medium is replaced. 250 μL of transfection reagent is added to each well, shaken to mix, and cultured in a 37°C cell culture incubator; After the last 6 hours, the medium to be replaced is determined based on the cell density. If the cell density is greater than 80%, differentiation medium is used to induce differentiation; otherwise, fresh proliferation medium is used to culture until the cell confluence reaches over 80% before inducing differentiation.

[0067] After differentiation, the cells were fixed with formaldehyde at room temperature for 30 minutes, and then glycine was added to a final concentration of 0.2M. The nuclear lysis products were then fragmented into DNA using a Covaris S220 ultrasonic disruptor. The size of the fragmented DNA was then assessed by electrophoresis to ensure it was between 200-800 bp. Subsequently, 10 μg of H3K27ac antibody or negative control antibody IgG was added to the fragmented DNA product, and an immunoprecipitation reaction was performed overnight at 4°C. After incubation, a certain amount of protein magnetic beads was added to purify the antibody-bound DNA fragments, and the mixture was incubated at room temperature for 3 hours. The target antibody DNA fragments were eluted and purified using a DNA purification kit. Sequencing adapters were then added to the purified DNA fragments for blunt end repair, and sequencing was performed on an Illumina HiSeq X Ten PE150 platform.

[0068] ChIP-qPCR experiments were used to observe the binding of SE-MYH1 / 4 in EDL tissues after KLF5 overexpression. Figure 6 As can be seen, when using the negative control antibody IgG, there was no significant difference between the KLF5 overexpression group and the control group; however, when using the H3K27ac antibody, the enrichment of H3K27ac in the KLF5 overexpression group was significantly increased compared with the control group (P<0.01).

[0069] 5.2 Dual-luciferase experiment.

[0070] Referring to the procedure in 2.1 of Example 2, the SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2 recombinant plasmids obtained in 2.1 of Example 2 were used in the following experiments. The experiments were divided into three groups: Group A consisted of a control group transfected only with the empty pGL3-Promoter vector and the empty pcDNA3.1 vector in porcine skeletal satellite cells, and an experimental group transfected with the OV-KLF5 vector and the empty pGL3-Promoter vector; Group B consisted of a control group transfected only with the empty pcDNA3.1 vector and the SE-MYH1 / 4-E1 recombinant plasmid in porcine skeletal satellite cells, and an experimental group transfected with the OV-KLF5 vector and the SE-MYH1 / 4-E1 recombinant plasmid; Group C consisted of a control group transfected only with the empty pcDNA3.1 vector and the SE-MYH1 / 4-E2 recombinant plasmid in porcine skeletal satellite cells, and an experimental group transfected with the OV-KLF5 vector and the recombinant plasmid pGL3-SE-MYH1 / 4-E2. Each group was performed in at least three technical replicates. Cells were collected after 72 hours of incubation, and the fluorescence value was measured according to the instructions of the dual-luciferase reporter gene assay kit (YEASEN, 11402ES60).

[0071] from Figure 7The dual-luciferase assay results showed that in group A, the fluorescence value of the experimental group was not significantly different from that of the control group; however, in groups B and C, the fluorescence value of the experimental group after overexpression of KLF5 was significantly increased compared with the control group (P<0.001), indicating that the enhancer activity of SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2 was significantly increased after overexpression of KLF5 in porcine skeletal muscle satellite cells. This further demonstrates that the transcription factor KLF5 can increase the enhancer activity of SE-MYH1 / 4, thereby increasing the interaction frequency between SE-MYH1 / 4 and gene promoters. This indicates that KLF5 can regulate the enhancer activity and interaction frequency of SE-MYH1 / 4, thereby inducing the formation of fast-acting fibers. Example 6: 3C-qPCR experiment verified that KLF5 promotes the interaction between SE-MYH1 / 4 and MYH4 and MYH1.

[0072] 6.1 Formaldehyde fixation, crosslinking, and pyrolysis.

[0073] The experiment was divided into a control group and a KLF5 overexpression group. The control group was transfected with the empty pcDNA3.1 vector, while the KLF5 overexpression group was transfected with the KLF5 overexpression vector OV-KLF5. Specifically, porcine skeletal satellite cells were transfected with either the KLF5 overexpression vector OV-KLF5 (KLF5 overexpression group) or the empty pcDNA3.1 vector (control group) using Lipofectamine 3000 and Opti-MEM. After differentiation, 2% formaldehyde was added for fixation at room temperature for 10 min. A certain volume of glycine solution was added to bring the final concentration to 0.2 M, and the reaction was carried out at room temperature for 5 min. After termination, the cells were centrifuged at 1500 rpm for 5 min, and the supernatant was discarded. The cells were resuspended in one volume of PBST solution, centrifuged at 1500 rpm for 5 min, and the supernatant was discarded.

[0074] 6.2 Generation of in-situ interactions.

[0075] The suspension obtained in 6.1 was incubated on ice with Hi-C lysis buffer (15 mM Tris-HCl, 15 mM NaCl and 0.2% Igepal), the precipitate was collected, the precipitate was resuspended with 0.5% SDS, incubated at 62 °C for 10 minutes, and the reaction was terminated by adding 10% Triton X-100.

[0076] 6.3 DNA ligation.

[0077] The liquid obtained in step 6.2 was added to 100 μL of restriction endonuclease and digested overnight at 37°C. The digestion reaction was terminated at 62°C for 20 minutes. The DNA fragments were then incubated with a biotin-containing mixture and DNA polymerase at 37°C to achieve end labeling. The DNA was then ligated using T4 DNA ligase by slow rotational incubation at room temperature for 4 hours.

[0078] 6.43 Obtaining C-DNA.

[0079] The ligation product was washed twice with 10 mM Tris-HCl (pH 8.0), and then resuspended in 600 μL of solution. 10 μL of proteinase K solution was added, followed by 13 μL of NaCl (5 M) solution, and the mixture was incubated overnight at 68 °C to decrosslink. The DNA was then precipitated using DNA purification buffer (15 μL sodium acetate solution (3 M), 1 μL glycogen, and 240 μL anhydrous ethanol) at -80 °C, washed twice with 75% ethanol, and dissolved in an appropriate amount of water. Finally, the purified DNA was cleaved using a Covaris S220 cleavage apparatus to ensure the fragment was within the 300-500 bp range.

[0080] 6.53C-qPCR.

[0081] After obtaining 6.4g of DNA, the MboI restriction site was located and primers in the same direction were designed (Table 3). At the same time, a pair of primers located inside the internal reference gene ACTB (Table 3) were designed as a control, and then qPCR experiments were performed.

[0082] Table 3 Primer sequences

[0083]

[0084] Based on the analysis in Example 1, it was found that KLF5 is highly expressed in EDL tissues, has a stronger ability to bind to open chromatin regions, and can bind to the EDL-specific superenhancer SE-MYH1 / 4. Therefore, further 3C-qPCR and qPCR experiments were conducted to verify whether KLF5 can promote the interaction between SE-MYH1 / 4 and MYH4 and MYH1. For 3C-qPCR detection, random primers (randomly selected fragments were used as reference primers; ACTB primers were used in this experiment), MYH1 primers, and MYH4 primers were used, respectively. The results are as follows: Figure 8 As shown: When using Random primers (ACTB primers), there was no significant difference between the KLF5 overexpression group and the control group; when using MYH1 primers, the interaction between SE-MYH1 / 4 and MYH1 in the KLF5 overexpression group was significantly higher than that in the control group (transfected with pcDNA3.1 empty vector) (P<0.001); when using MYH4 primers, the interaction between SE-MYH1 / 4 and MYH4 in the KLF5 overexpression group was significantly higher than that in the control group (transfected with pcDNA3.1 empty vector) (P<0.01). This indicates that after KLF5 overexpression, the interaction between SE-MYH1 / 4 and MYH4 and MYH1 in the KLF5 overexpression group was significantly higher than that in the control group (P<0.001).

[0085] During qPCR detection, the relative mRNA expression levels of KLF5, MYH1, and MYH4 were measured, and the results are as follows: Figure 9 As shown in the figure: the mRNA level of KLF5 in the KLF5 overexpression group was significantly higher than that in the control group (P<0.001), indicating that the overexpression was successful; the mRNA level of MYH1 in the KLF5 overexpression group was significantly higher than that in the control group (P<0.001), indicating that KLF5 overexpression can promote MYH1 gene transcription or expression; the mRNA level of MYH4 in the KLF5 overexpression group was significantly higher than that in the control group (P<0.001), indicating that KLF5 overexpression can promote MYH4 gene transcription or expression.

[0086] The above results indicate that transcription factor KLF5 can promote the interaction between SE-MYH1 / 4 and the glycolytic marker genes MYH4 and MYH1, ultimately promoting the transcription or expression of MYH4 and MYH1 genes, thereby inducing fast-twitch muscle fiber formation.

[0087] In summary, this invention discloses a method for regulating porcine muscle fiber types. This method includes the first identification of the transcription factor KLF5 in porcine soleus and extensor digitorum longus muscle tissues, which regulates muscle fiber type conversion by promoting the activity of SE-MYH1 / 4, further promoting the transcription or expression of MYH4 and MYH1 genes, inducing the formation of glycolytic fast muscle fibers or promoting the conversion of oxidative slow muscle fibers to glycolytic fast muscle fibers.

[0088] SE-MYH1 / 4-E1 sequence (SEQ ID No:1):

[0089] TGCCTCCCAGGACCAGAGTCCAGAGAGCTTGCAGGCCAGCCAAGCAGAGTGCCCAGTGTAAGCACAGTCCAG

[0090] GGCCTCTGATGGATATAGAGCCCAGTTTAGAATGAGCTGGAAAGACCCTCTTATCGGCATGGGGGCACATCATGA

[0091] AAGATGATTATTTGTCACATAATTACAATAAAACTTATTTCTATCTGGTTACTTTTTTTTTTCTTTTTCAGAAGAAG

[0092] AAATTTTCCGTCTTTCTTAAGAAGTCCCAGGAAGCATTGTTTGATTCTCAGAAGTCAGTAGATAAGAAAAGTCTC

[0093] CTTGAATTCTTCTGAGTAAAAATCTTCCCATTAGACCTTTATGTGTCATCAAAGAACCCAGTTTTAAGGACATACT

[0094] TTCCATCTTTTTTTGTTTGTTTGTTTGTTTGTTTTTTAGGGCCACACGTGCAGCATATGGAAGGTCCCAGACTATG

[0095] GGTTGGATTAGAGCTGTAGCTGCTGGTCTACACCACAGCCACAGCAACGCCAGATCCAAGCCATGTCTGCGATC

[0096] TACACCACAGCTCACAGCAATGCTGGATCCTTAACCCACTGAGCAAGGCCAGGGATCAAACCCGCAACCTCAC

[0097] GGATACTAGTTGGGTTCTTAACCTGCTGAGCCACCATGGGAACTCCTCATACTTTCCATCTTTTTAAGAATTACTT

[0098] TTCACAAAAATAAAATTCACAGCTAGGAGGTTAAAAGCTAAGACTGAGGGTTTACTCAATGGGCTGATTTAGCC

[0099] TTTGCCTTTAATTCTGTGATTTGGGTAATACGAAGCAGTAGCTGTGAGCCCCAGAGTCTGCACATGCAAACCGAA

[0100] TCCCACACTAACAGTGATCTCCAAAGCCCAAGTCAGTTTCCCCTCTGAACTCGCTGTCTGCCTTCACTCGTACGG

[0101] GATCCTTGGAGCACCCAGTGTGAGGAGGTCTAGTAGTACCAGTTCTTCTCACTGTAGAGATGAGTGGGATAAAG

[0102] AGGAGAGGAGCAATTCTTGCCTCCAGAGAGTCTGGCGGGGACGACGCACATGAACACAACTAATAGAGAGCAG

[0103] CAGGGGCGAGGGTTGCGGTCTGACCTAGTGTGGTGGGGAGACGAAAAGTAATTCTTGCAAGACCAGGAGAGAT

[0104] TTCACTATGGAGGGGACAACATTGAGATTTATTCTTGGGAGGGGACTTTGCCAGACAGAGAATAGAAAAGGTGT

[0105] GTTCCCAGCTGCAGGAGGTGCATGGGTGAACTCTCCCCGTGGAGAATCAGAGAAGTTTGGTCATTGCGGGGAG

[0106] TGGCAGGAGGCGAACATGGAAGGATCTGGAGACACACGAAGAGACAGAAGACATAGGCTCTTGAGTTACCCA

[0107] GTTCTGGACACTGTGACACACATACAAAGGGCTCTCCCACTCGTTCTTACCCATAATAGTACTGAGACCCAGAG

[0108] AACAGGGTCGGGGAGACCAGAGCCTGGGCTTTGGGGAGTGACAGACTTGAGTTTTATTCTTGGCTCCAAAAGG

[0109] CGCTCTAGCCGTGGCCTTAGAAGATGAACTCTCCCTCAACCTCAGTTTCCTTATCTGTGAAATAGGGGTAAAATA

[0110] GCACCTTCTTCACGAGGCTCAGAAGGAACGAGGAAGAGAATGTACGTGATGCAGTCAACACATGTCCAGCCCA

[0111] TCGTAAGTGCTCAGCACGTTGAGTTCAGAATAATCCAAGATTAATACTAACGTCTGGTGAGGAACGTCGATAGTA

[0112] ACTCTCCCTTGGGCGGGTCAGCACCGAAGCCCGGGGCGGGGGAGATCAGCTGAGGTCAAAGGACCCATCACTT

[0113] GGTTTCTGATATCAGCCCCGGTGGGATTGACAGCCTCGGCCCATCTCTCGGCCAGATCTGCCGTGTCGCGGGGA

[0114] GGCCCAGCAGGCTCGTTCTTCCTCAGATTTCTTCCCCTGTGGGGATCAAGGCAGGAGAGCACAGGCCTCGGATG

[0115] ATAAACACATTCTTGCCTCTCCCTGTGTAAAGTGATAATGCCAGAGGTGCCTGGCACCAAGCAAGGGACAGTGC

[0116] CATCCCTCCAAGGCTCCTTGTCCCCACAGCTGACTAGGTGCCTGCGGGTATGGCTCTGGGAACTGTCTTGAAAG

[0117] TCCTTGTCTCTCTCCCCTTTGTCTTTGTTTAGCAGCTGCGTTGCACTGCTGGGTATGGGGTGCATTCCTGCCTCCT

[0118] GACAGTGATTGTTCCCTTCAACAAGTTTTAATAGATTTTGGGGGGAGCAATTTTATGTCCACAGCCGATTGTGTG

[0119] GAGAGCACAGAGAATGCCCTATCCTTCCTACGCCCTCAGACACACACAGCCTCCCCCGATCCACATCCCCCTGC

[0120] AGAGGGCACACTTTCGACCTCCGTGAACGTGCACGGACACGTCGTTATCGCTCAGATTCCACATTCACTGTAGG

[0121] ATTCGCTCTTGGCATTATACCTTCTATAGGAGTTGTTGACTTTTTACACCAGAAATTGTCCCATGAGAGCTTATTC

[0122] GAGTAATTCAGGGCAAAGCTGGGGATGCCGACCTGTTTCTAAATAATCCATTTTGGAGAAGAGCATTTGAGATG

[0123] AAATGGAAATAGAAAAGAAAGAAAGACACAATGGAAGGAAGGAGCAAGAGAAAGAGAAGAGACCATCCAGG

[0124] CACCCAGGCAGGTCCCTCCCCCCAGTCTCCGAAGCGCTTCACAAGCAGAGGTCAGTGGTTGTTCTTGCCTAAAA

[0125] TTCATACTCTTCTCCTGTTCCAAAATCCTCCCACCATCCCCCCACTGTCTCCTGGCCTTCCTCTTCCTGGGGGGAG

[0126] AGTTCTGCCTTTGAATCTTTGCCTTGAAGCTTTTCCGCTGCCTGTCCTCCAGGCCTCCATGGTGAGGCCCCTACC

[0127] GGTGAAAGGAGAGAGTTTTACTTTGAAATGGAGGGCCCAGGAATGGAGCAGGGCAGTTTGAAGAGTTTTTTCC

[0128] CCTGTACCTAAGATAACTTTTTATTGCTCTAGCAACGTTCTTGTAAGAAACCAAGTCAGCCTCCTGCTCTGACAG

[0129] ATGAAACCTTGAGGAGCTGGCTGTCCCCAGTGCTAAGATGTCCTTCCAAACCGGGACCCAGACAGCTGGAGGG

[0130] CTCCAGTTACTCAAGAGGTGAGTGACACGGACCCTTGGCCCGTGTGCGGAAGGGAGGAGTGGGGCAAGGGAG

[0131] CTCGGGGAGGGAAGGACAGAGGAGAAAGAAGGGCAGTGACAAGAGGGAGGGGGCTGCTAGGAAGGCGGGA

[0132] AGCAGGCGGGGCTGAGGCCTGGCTGTGGAGGAGGGGAGCGTCCTTTCTGACCATACCCCCTGCTGGACTTTGG

[0133] GGGCAAGGGTGGTGCCCCACCTTGGACCTCGGGGTGTGATTGGTGACTTTCCAACCCAAAAGACCCCTGAAGT

[0134] GGAAACCGTTCTGGCCGTCTCTCTCCCCCAGGATCATTAAGGTCCTTTCACAGCGAACGACCATTCCAGAAGCT

[0135] GGCCATCTCCAAGCCAGCAGATGGAGTTTGCTCTCAACCTTTGATTCGAGATTTAAATATGTATTGTTTTTTTTCA

[0136] AATAGTGAATTAAAATGCACACCCATCTAAATGTTTTTATTGTACTTTCTAAAATGACGATGGGTGGCGTTAGCAA

[0137] TGATAAAAAATGATTTTCCATGATAAAAATTGAATTGGTTTGAA

[0138] SE-MYH1 / 4-E2 sequence (SEQ ID No:2):

[0139] TAGATTGCTCAGAATTACGGGCAGGACAGGGCGGGCGTCACTGGGGTGTCAGCACCAAGCCACTTGGGCAGCA

[0140] GGAGTGTTCTGGGGTCAGAGTTAGGAGTTTGAATCCCGGTTTGTGGAGCTGTTTGGGGTTCAGAAGTGCTGACA

[0141] GGGCTGATTCTAGGCTTGGGGGCAGCGCCGTGGGTTAGGAGTTTGAATCCCGGTTTGTGGCACTGTTGGGGGTC

[0142] CCTCATTGCTGACAGGACTGATTCTAGGCTTGGGGGCAGCGCCGTGGGTGCCACTCTGACCCCTCGGGAGGGA

[0143] GATGGGTGAGAAGCAGGGGGCAGGGAGACACCCTATTTAAAGCTCCCTCTGATTGCATCAGGCGCTGCTAAGG

[0144] CCAAAGCAGCTCCCCCCTGGGGAAGGCCCATGTCCTCGTCCCATGGAGCCACTCACAAGGTGAGAATGAGCCC

[0145] ACGGGCTGCACGCTCTTGGCCATGGGGGGTTGATGGTGGCCACAGCACCTCGACTCGGTGTGTATCTATAGGTC

[0146] ACTCGTGATCTAAGACCCTCTCGTGGGCTGGATTTACTGTGGAACTCAAGGCAAATCCCTTGAACAGGTGAAAA

[0147] CTCGTGTCCTCTTAAACTCCTTTCCAAAAGTGGCCATCCCGTCCTCGCTGCCCTGTGGGCTGGCGTAGGAATGAT

[0148] CTGGGAAGTGTATTTTAGAACTGTGATGTCTGGCCTATGCATCCGCACCGTCGGGCACCACCTGGCTGTGGGCAT

[0149] CGGGGCAGTGGCGAGAAGGGGCCTGATTGGGCTCCACTCTGCGGGCTTCCCAAGCAAGCCTGGGGGTGGAGG

[0150] GGAGACGGGAGGAGGAGATGGTAGGTCTCCAGCTGGGGGCTGGTTCTGGCCCCTGGCCATGAGGCCAGGGCG

[0151] CCCCCAAATAAACACCCACGTAAGCGCCTGTTCTTCACGTCCCCACACCTGCTCCCCAGGGGCTGAGACCCCAG

[0152] GCCCGAAATAGGCGCAGCTGCTGCGGATGCTAATCCGGCCCCACGCTGAGGCTGAGCCGTATTTGGAAATGTCT

[0153] GGCCTGCCACCCGCCCTCAGCCTTGGGGCCTCAAAGCAGAGTTCTTGCTCCCTCTTCCTGGCCTGGCTTTCCTG

[0154] GGGACTTCTGTCTGCCTGTTTCCTGTCCCTGGGCACGCAGTGGGCAGCTGTAAATGACAGGTGAATGAGTTGGT

[0155] ACAGAAAGGAACAGAGACCTGAGACGTGCAGCCTCAAAACCGGCTTCCCACGGCAGCGCCTCACCCCCAAGG

[0156] GCCTCCTCTGCTACTCGACTCTGTCTTCAGGCTTCCGAGCCCCTGCGACCCGTGCCCAGCCATGCCCACACCCG

[0157] CTGCTTCAGGAAGCCACGCAAGCCCAGTGCCTGTTAGCACCTCTCCCACATCCGTGGGTCTCGGCTGCTGGGTT

[0158] GTCGTGACGTCTTTCTTGGTGACACGCAGAGCAGAAGGTCAGAAGAACTGGCTTTCCCCAGGGTCACACAGCA

[0159] TCCCCCACCGCTTTCTCTTCTTACTGGGAGTTCAGTTCAGCACATGCTGAGCACCTGCTGTGTACAGAGCAGTG

[0160] GCTCACTGCTAAAGGGATTGACTTTCTTTCGGTCTCTGACTCTAAAAGTGTGTCACCCTGTCACCTTCCTCAGTT

[0161] TCCTCTGTTTTCTCTTCCATCATTATCTCAGTACTTAGATTTCTTTGATTGTCCTTGAGGTTCAAGGTTCTGTCTCA

[0162] TTTATTTTTGAATCTCTGGGTCACTGAGGAACCCTCTGTGGACGACAATGGTCCATTTTCTTTATCTAAGATGCCC

[0163] CTCTGTCTGGAAGCTGGGCTCTTGGTGAAGGTGACCTATGGGCCTCTGTCACCTGCTCCCCTGGGCCTCCTCAG

[0164] GGGTCCTTGGGGCCACCTCTCATTTGCTAAAACATGGAGAAGGCCCCCAAATGCCCAGGTGACGGGGCTTCTTG

[0165] CTTCTCACTGCCACGGAAAGCTTGAAACAACTTAGCTAAAAATAATCAGTGCCTTCCTGGGCCCAGCTGCCCTC

[0166] ACCAGGCGCACGAGGGCCTCCGGCATGTCTTGGCCTTGCTCAGGGTAACCAGATCCCGGCTTGGCCCCGGCGA

[0167] GCAGCCGCAGGCACCCTCAGCCTCAGCTGGTTTTAGCAGGAGGATTCCTGGGAGGGCGGGCATAGACTCCGTG

[0168] TTCTGGGCGGCCTCCTCAGCCCACACGTCTAGGTACACTCGGCTTTGTTAAAGCGCTCAGCTGTCGCGGTGACC

[0169] AGGCGAGAAGGGCAAGGCCGCTCTCCCCAGCAGGAGGGCCTGCGGACCACAGCGGTTTGTCACCCTGAGGAC

[0170] GTGTTGCTCCAGTTAGAGCTGAGCCCCTTCCGTGTCCTAAAGAAGGGGGCCCCACCAATCATAAATCAGGATCT

[0171] CATCGCCTCCAAATAAAGGGAGTCTGCCGTCCCCGCGCCCGGCCCTTCAGCATTGACAGATAGATTGTTTTAGTC

[0172] CTGTGTCGAGCATTTCTTTTTGCTTTTTTTTTTTTTTTTTTTTTTTTGGGCCGCACCCATGGAG KLF5 CDS region sequence (SEQ ID No:11):

[0173] ATGGCTACGCGGGTGCTGACTATGAGCGCCCGCCTGGGACCCGTGCCCCAGCCGCCGGCCCCGCAGGACGAGC

[0174] CCGTGTTCGCGCAGCTTAAGCCCGTGTTGGGCGCCGCGAACCCAGCCCGCGACGCGGCGCTCTTCCCCGGCGA

[0175] CGAGCTGAAGCACCCGCACCACCACCCGCAGGCACAGCCCGCGCCGCCGCAGCCGCCGCAGCCGGCGCCGCC

[0176] GCCCGCCGCGGGCCCGCGGCTGCCCGCCGAGGAGCTGGTCCAGACGCGATGTGAAATGGAGAAGTATCTGACA

[0177] CCCCAGCTTCCGCCAGTTTCCATAATTCCAGAGCATAAGAAGTATAGACGAGACAGTGCCTCAGTCGTAGACCA

[0178] GTTCTTCACTGACAGTGAAGGGTTACCTTACAGTATCAACATGAACGTCTTCCTCCCTGACATCACTCACCTGAG

[0179] AACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACCCACATCAAGACCGAACCTGTTACCATTTTCAGCCACC

[0180] AGAGTGAAACGACGGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCCGAGTTCACCAGTATATTCAGCTCCCAC

[0181] CAGACCGCAGCTCCAGAGGTGAACAACATTTTCATCAAACAAGAACTTCCTACACCAGACCTTCATCTTTCTGT

[0182] CCCTCCCCAGCAGGGCCACCTGTACCAGCTGCTGAACACACCGGATCTAGATATGCCCAGTTCTACCAACCAGA

[0183] CAGCAGTGATGGACACTCTCAATGTTTCTATGTCAGCTGCCATGGCGGGCCTTAACACCCACACCGCCGCCGTC

[0184] CCGCAGACTGCGATGAAGCAATTCCAGAGCATGCCCCCTTGCACATACACCATGCCAAGTCAGTTTCTTCCCCA

[0185] GCAGGCTACTTACTTCCCCCCGTCACCACCAAGCTCGGAGCCGGGAAGTCCAGATAGACAAGCAGAGATGCTC

[0186] CAGAATCTAACCCCACCTCCATCCTATGCTGCTACGATTGCTTCTAAACTGGCGATTCATAATCCAAATTTGCCCG

[0187] CCACCCTGCCAGTTAATTCCCAAAACATCCAGCCTGTCAGATACAATAGGAGGAGTAACCCCGATCTGGAGAAA

[0188] CGACGCATCCACTACTGCGATTACCCGGGCTGCACCAAAGTTTATACAAAGTCTTCTCATTTAAAAGCTCACCTG

[0189] AGGACTCATACTGGCGAGAAGCCCTACAAGTGCACCTGGGAAGGCTGCGACTGGAGGTTCGCGCGCTCGGACG

[0190] AGCTGACCCGCCACTACCGCAAGCACACGGGAGCCAAGCCCTTCCAGTGCGGCGTGTGCAACCGCAGCTTCTC

[0191] CCGCTCTGATCACCTCGCCCTGCACATGAAGAGGCACCAGAACTGA

[0192] OV-KLF5 vector sequence (SEQ ID No:14):

[0193] GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCC

[0194] AGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAA

[0195] GGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAG

[0196] ATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATAT

[0197] GGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGT

[0198] CAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTA

[0199] AACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATG

[0200] GCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC

[0201] GCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCA

[0202] AGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAA

[0203] CAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGC

[0204] TAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGC

[0205] GTTTAAACTTAAGCTTGGTACCATGGCTACGCGGGTGCTGACTATGAGCGCCCGCCTGGGACCCGTGCCCCAGC

[0206] CGCCGGCCCCGCAGGACGAGCCCGTGTTCGCGCAGCTTAAGCCCGTGTTGGGCGCCGCGAACCCAGCCCGCGA

[0207] CGCGGCGCTCTTCCCCGGCGACGAGCTGAAGCACCCGCACCACCACCCGCAGGCACAGCCCGCGCCGCCGCA

[0208] GCCGCCGCAGCCGGCGCCGCCGCCCGCCGCGGGCCCGCGGCTGCCCGCCGAGGAGCTGGTCCAGACGCGATGT

[0209] GAAATGGAGAAGTATCTGACACCCCAGCTTCCGCCAGTTTCCATAATTCCAGAGCATAAGAAGTATAGACGAGA

[0210] CAGTGCCTCAGTCGTAGACCAGTTCTTCACTGACAGTGAAGGGTTACCTTACAGTATCAACATGAACGTCTTCCT

[0211] CCCTGACATCACTCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACCCACATCAAGACCGAAC

[0212] CTGTTACCATTTTCAGCCACCAGAGTGAAACGACGGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCCGAGTTC

[0213] ACCAGTATATTCAGCTCCCACCAGACCGCAGCTCCAGAGGTGAACAACATTTTCATCAAACAAGAACTTCCTAC

[0214] ACCAGACCTTCATCTTTCTGTCCCTCCCCAGCAGGGCCACCTGTACCAGCTGCTGAACACACCGGATCTAGATAT

[0215] GCCCAGTTCTACCAACCAGACAGCAGTGATGGACACTCTCAATGTTTCTATGTCAGCTGCCATGGCGGGCCTTA

[0216] ACACCCACACCGCCGCCGTCCCGCAGACTGCGATGAAGCAATTCCAGAGCATGCCCCCTTGCACATACACCATG

[0217] CCAAGTCAGTTTCTTCCCCAGCAGGCTACTTACTTCCCCCCGTCACCACCAAGCTCGGAGCCGGGAAGTCCAGA

[0218] TAGACAAGCAGAGATGCTCCAGAATCTAACCCCACCTCCATCCTATGCTGCTACGATTGCTTCTAAACTGGCGAT

[0219] TCATAATCCAAATTTGCCCGCCACCCTGCCAGTTAATTCCCAAAACATCCAGCCTGTCAGATACAATAGGAGGAG

[0220] TAACCCCGATCTGGAGAAACGACGCATCCACTACTGCGATTACCCGGGCTGCACCAAAGTTTATACAAAGTCTT

[0221] CTCATTTAAAAGCTCACCTGAGGACTCATACTGGCGAGAAGCCCTACAAGTGCACCTGGGAAGGCTGCGACTG

[0222] GAGGTTCGCGCGCTCGGACGAGCTGACCCGCCACTACCGCAAGCACACGGGAGCCAAGCCCTTCCAGTGCGGC

[0223] GTGTGCAACCGCAGCTTCTCCCGCTCTGATCACCTCGCCCTGCACATGAAGAGGCACCAGAACTGACTAGTCCA

[0224] GTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGA

[0225] TCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAA

[0226] GGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTC

[0227] TGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGG

[0228] TGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGC

[0229] GCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCC

[0230] TTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTA

[0231] GGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCC

[0232] ATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAAC

[0233] TGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTA

[0234] AAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAG

[0235] TCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTC

[0236] CCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAA

[0237] CTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTAT

[0238] GCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTT

[0239] TTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCAT

[0240] GATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCAC

[0241] AACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAG

[0242] ACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCG

[0243] TTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGG

[0244] GCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCA

[0245] TACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGG

[0246] AAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAG

[0247] GCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGG

[0248] TGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCG

[0249] TTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCC

[0250] GCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAA

[0251] TGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGC

[0252] TTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCAC

[0253] CCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTT

[0254] TTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGC

[0255] TAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATAC

[0256] GAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCA

[0257] CTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCG

[0258] GTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCG

[0259] GTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGC

[0260] AAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCT

[0261] GACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGT

[0262] TTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCC

[0263] CTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGC

[0264] TGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAAC

[0265] CCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCG

[0266] GTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGC

[0267] TGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTT

[0268] TTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTC

[0269] TGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGA

[0270] TCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATG

[0271] CTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAG

[0272] ATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGC

[0273] TCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCT

[0274] CCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTG

[0275] CCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAA

[0276] GGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTA

[0277] AGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATG

[0278] CTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCC

[0279] GGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGG

[0280] GGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTT

[0281] CAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAAT

[0282] AAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT

[0283] CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAA

[0284] GTGCCACCTGACGTC

Claims

1. The application of porcine KLF5 transcription factor in the preparation of products that can regulate porcine myofiber type transformation, characterized in that, The application promotes KLF5 expression by injecting or transfecting a KLF5 overexpression vector, thereby promoting the formation of glycolytic fast myofibers, inhibiting the formation of oxidative slow myofibers, or promoting the conversion of oxidative slow myofibers to glycolytic fast myofibers; or it promotes the formation of oxidative slow myofibers, inhibits the formation of glycolytic fast myofibers, or promotes the conversion of glycolytic fast myofibers to oxidative slow myofibers by inhibiting KLF5 expression.

2. A non-therapeutic method for regulating porcine muscle fiber types, characterized in that, The method regulates the transformation of porcine myofibril types by modulating the expression of the KLF5 transcription factor. The method promotes the expression of KLF5 by injecting or transfecting a KLF5 overexpression vector, thereby promoting the formation of glycolytic fast myofibrils, inhibiting the formation of oxidative slow myofibrils, or promoting the transformation of oxidative slow myofibrils into glycolytic fast myofibrils; or it promotes the formation of oxidative slow myofibrils, inhibits the formation of glycolytic fast myofibrils, or promotes the transformation of glycolytic fast myofibrils into oxidative slow myofibrils by inhibiting the expression of KLF5.

3. A kit / nucleic acid molecule / recombinant protein / recombinant vector containing a reagent that regulates porcine KLF5 transcription factor expression for non-therapeutic applications in regulating porcine myofiber type conversion, characterized in that... The application promotes KLF5 expression by injecting or transfecting a KLF5 overexpression vector, thereby promoting the formation of glycolytic fast myofibers, inhibiting the formation of oxidative slow myofibers, or promoting the conversion of oxidative slow myofibers to glycolytic fast myofibers; or it promotes the formation of oxidative slow myofibers, inhibits the formation of glycolytic fast myofibers, or promotes the conversion of glycolytic fast myofibers to oxidative slow myofibers by inhibiting KLF5 expression.

Images