RNase R mutant capable of improving reaction temperature and thermal stability as well as preparation method and application of RNase R mutant

Abstract

The invention discloses RNase R mutants capable of improving reaction temperature and thermal stability as well as a preparation method and application of the RNase R mutants, and relates to the technical field of biology. According to the invention, RNase R is designed, transformed and screened by using protein structure prediction related software, so that three RNase R mutants with amino acid sequences respectively shown as SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7 are obtained. Compared with a wild type RNase R, the reaction temperature and the thermal stability of the RNase R are improved, the advantages in applications such as circular RNA enrichment and the like are obvious, and the application range of the RNase R in the field of RNA research is expanded.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to an RNase R mutant with improved reaction temperature and thermal stability, and a preparation method and application thereof. Background Art

[0002] RNase R is a magnesium-dependent 3'→5' exoribonuclease with important applications in molecular biology, genome editing, and especially in circular RNA (circRNA) research. However, in traditional experiments and application scenarios, the enzyme structure of wild-type RNase R is easily thermally denatured under conditions exceeding room temperature, resulting in a rapid decrease in catalytic activity or even complete inactivation, which cannot meet the requirements of industrial-grade nucleic acid production and certain high-temperature experiments. In particular, in applications such as long-chain RNA degradation and RNA quality control, additional control of environmental conditions is required due to reaction temperature restrictions, which increases operational complexity and cost, and limits its applicability in a wide range of scenarios. Therefore, it is necessary to provide RNase R with high thermal stability and adaptability to higher temperatures. Summary of the invention

[0003] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes an RNase R mutant, which has a higher reaction temperature and higher thermal stability than the wild-type RNase R.

[0004] The invention also provides a recombinant protein.

[0005] The present invention also provides biological materials related to the above RNase R mutant or recombinant protein.

[0006] The invention also provides an enzyme preparation.

[0007] The present invention also provides a method for preparing the RNase R mutant or recombinant protein.

[0008] The present invention also provides applications related to the RNase R mutant, recombinant protein, biological material or enzyme preparation.

[0009] The invention also provides a kit.

[0010] According to an RNase R mutant of the first aspect of the present invention, compared with the wild-type RNase R, the RNase R mutant comprises a mutation site H486Q; the amino acid sequence of the wild-type RNase R is shown in SEQ ID NO:1.

[0011] The RNase R mutant according to the embodiment of the present invention has at least the following beneficial effects:

[0012] Compared with the wild-type RNase R, the reaction temperature of the RNase R mutant of the embodiment is increased. After heat treatment at 55°C for 30 minutes, the RNase R mutant still retains a high RNA degradation performance, and its thermal stability is better than that of the wild-type RNase R. It has a good application prospect in the fields of degrading linear RNA and preparing circular RNA.

[0013] According to some embodiments of the present invention, compared to the wild-type RNase R, the RNase R mutant further comprises at least one of the mutation sites M188E and K385Q.

[0014] According to some embodiments of the present invention, compared to the wild-type RNase R, the RNase R mutant comprises any one of the mutation sites A1) to A3):

[0015] A1), H486Q;

[0016] A2), K385Q, H486Q;

[0017] A3), M188E, K385Q, H486Q.

[0018] According to some embodiments of the present invention, the amino acid sequences of the RNase R mutants are shown as SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7, respectively.

[0019] According to some embodiments of the present invention, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO: 3, and the reaction temperature for degrading the linear RNA is 35° C. to 45° C. For example, it can be 35° C., 36° C., 37° C., 38° C., 39° C., 40° C., 41° C., 42° C., 43° C., 44° C. or 45° C.

[0020] According to some embodiments of the present invention, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO: 3, and the reaction time for degrading the linear RNA is 5 min to 30 min. For example, it can be 5 min, 10 min, 15 min, 20 min, 25 min or 30 min.

[0021] According to some embodiments of the present invention, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO:5, and the reaction temperature for degrading the linear RNA is 35°C to 45°C. For example, it can be 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C or 45°C.

[0022] According to some embodiments of the present invention, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO: 5, and the reaction time for degrading the linear RNA is 5 min to 30 min. For example, it can be 5 min, 10 min, 15 min, 20 min, 25 min or 30 min.

[0023] According to some embodiments of the present invention, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO:7, and the reaction temperature for degrading the linear RNA is 35°C to 55°C. For example, it can be 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C or 55°C.

[0024] According to some embodiments of the present invention, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO: 7, and the reaction time for degrading the linear RNA is 5 min to 30 min. For example, it can be 5 min, 10 min, 15 min, 20 min, 25 min or 30 min.

[0025] A recombinant protein according to the second aspect of the present invention comprises a tag and the above-mentioned RNase R mutant.

[0026] According to some embodiments of the present invention, the tag is connected to the N-terminus and / or the C-terminus of the RNase R mutant.

[0027] According to some embodiments of the present invention, the label includes at least one of the labels that facilitate the dissolution, purification and detection of RNase R mutants. It is understandable that the RNase R mutant of the present invention may include one or more labels; multiple labels may include a combination of multiple identical labels, or a combination of multiple different labels. For example: labels that facilitate the dissolution of RNase R mutants include but are not limited to nus labels or maltose binding protein labels; labels that facilitate the purification of RNase R mutants include but are not limited to strep labels, His labels, GST labels, pelB signal labels or ompA signal labels; labels that facilitate the detection of RNase R mutants include but are not limited to horseradish peroxidase (HRP) labels, β-galactosidase labels, luciferase labels, green fluorescent protein (GFP) labels, HcRed labels, DsRed labels or cyan fluorescent protein (CFP) labels. The label may specifically be a His label.

[0028] According to the third aspect of the present invention, the biological material related to the RNase R mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention is any one of B1) to B4):

[0029] B1), a nucleic acid molecule encoding the RNase R mutant described in the embodiment of the first aspect of the present invention or the recombinant protein described in the embodiment of the second aspect of the present invention;

[0030] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0031] B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2);

[0032] B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

[0033] According to some embodiments of the present invention, the nucleic acid molecule has any one of B11) to B14):

[0034] B11), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 4;

[0035] B12), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 6;

[0036] B13), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 8;

[0037] B14), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in B11), B12) or B13), and encoding the RNase R mutant;

[0038] B15), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B13) under stringent conditions and encodes the RNase R mutant.

[0039] According to some embodiments of the present invention, the stringent conditions can be hybridization and washing the membrane twice at 68°C in a solution of 2×SSC, 0.1% SDS, each for 5 min; or hybridization and washing the membrane twice at 68°C in a solution of 0.5×SSC, 0.1% SDS, each for 15 min.

[0040] According to some embodiments of the present invention, the expression cassette refers to a DNA capable of expressing the RNase R mutant in a host cell. The DNA may include not only a promoter for initiating transcription of the RNase R mutant encoding gene, but also a terminator for terminating transcription of the RNase R mutant encoding gene. Further, the expression cassette may also include an enhancer sequence.

[0041] According to some embodiments of the present invention, the vector may be a plasmid, a cosmid, a phage or a viral vector. For example, it may be a PET-28a vector.

[0042] According to some embodiments of the present invention, the recombinant vector may be a recombinant vector obtained by inserting a DNA molecule encoding the RNase R mutant into the multiple cloning site of the vector.

[0043] According to some embodiments of the present invention, biological cells include prokaryotic cells and eukaryotic cells. The prokaryotic cells include bacteria or algae. The eukaryotic cells include fungi, mammalian cells or insect cells. Among them, the bacteria can be Escherichia coli, such as E. coli DH5α or E. coli BL21. The recombinant organism does not contain reproductive material.

[0044] According to some embodiments of the present invention, the recombinant biological cell is a recombinant biological cell obtained by introducing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3) into a biological cell. Specifically, it can be a recombinant Escherichia coli obtained by introducing the recombinant vector into E. coli DH5α or E. coli BL21.

[0045] An enzyme preparation according to an embodiment of the fourth aspect of the present invention comprises the RNase R mutant described in the embodiment of the first aspect of the present invention or the recombinant protein described in the embodiment of the second aspect of the present invention.

[0046] According to some embodiments of the present invention, the enzyme preparation further includes a reaction premix.

[0047] According to some embodiments of the present invention, the reaction premix includes Tris-HCl, Mg 2+ , K + At least one of .

[0048] According to some embodiments of the present invention, the Mg 2+ The source includes at least one of magnesium chloride, magnesium acetate and magnesium sulfate.

[0049] According to some embodiments of the present invention, the K + The source includes at least one of potassium chloride, potassium acetate and potassium sulfate.

[0050] According to some embodiments of the present invention, the reaction premix includes 10 mmol / L to 50 mmol / L Tris-HCl, 0.1 mmol / L to 0.2 mmol / L Mg 2+ 100mmol / L~150mmol / LK + For example, the reaction premix may include 20 mM Tris-HCl, 0.1 mM MgCl2 and 100 mM KCl. The reaction premix should preferably not affect the activity of the RNase R mutant or recombinant protein.

[0051] According to some embodiments of the present invention, the pH of the reaction premix is ​​7.5 to 8.5, for example, it may be 8.0.

[0052] According to the fifth aspect of the present invention, the method for preparing the RNase R mutant described in the first aspect of the present invention comprises:

[0053] The RNase R mutant described in the first aspect of the present invention or the coding gene of the recombinant protein described in the second aspect of the present invention is introduced into a biological cell to express the coding gene, thereby obtaining the RNase R mutant.

[0054] According to some embodiments of the present invention, the biological cells include prokaryotic cells and eukaryotic cells.

[0055] According to some embodiments of the present invention, the prokaryotic cell comprises bacteria or algae, wherein the bacteria may be Escherichia coli (eg, E. coli BL21).

[0056] According to some embodiments of the present invention, the eukaryotic cells include fungi (such as yeast), mammalian cells (such as HEK293 cells) or insect cells.

[0057] Application of the seventh embodiment according to the present invention.

[0058] According to some embodiments of the present invention, the application is the application of the RNase R mutant described in the embodiment of the first aspect of the present invention, the recombinant protein described in the embodiment of the second aspect of the present invention, or the enzyme preparation described in the embodiment of the fourth aspect of the present invention in any one of C1) to C3).

[0059] C1), purification of circular RNA;

[0060] C2), degrading linear RNA;

[0061] C3), identification of circular RNA and / or linear RNA.

[0062] According to some embodiments of the present invention, the application is the application of any one of D1) to D4) in any one of E1) to E3),

[0063] D1), the RNase R mutant described in the embodiment of the first aspect of the present invention;

[0064] D2), the recombinant protein described in the embodiment of the second aspect of the present invention;

[0065] D3), ​​the biomaterial described in the embodiment of the third aspect of the present invention;

[0066] D4), the enzyme preparation described in the embodiment of the fourth aspect of the present invention;

[0067] E1) Preparation of purified circular RNA products

[0068] E2), preparing products for degrading linear RNA;

[0069] E3), preparing products for identifying circular RNA and / or linear RNA.

[0070] A kit according to an eighth aspect of the present invention comprises the above-mentioned RNase R mutant, the above-mentioned recombinant protein or the above-mentioned enzyme preparation.

[0071] A method for degrading linear RNA according to a ninth aspect of the present invention comprises the following steps:

[0072] The linear RNA is contacted with the RNase R mutant described in the embodiment of the first aspect of the present invention or the recombinant protein described in the embodiment of the second aspect of the present invention.

[0073] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 The three-dimensional modeling structure diagram of the mutation site of the RNase R mutant;

[0075] Figure 2 The electrophoresis diagram of each RNase R after expression and purification; M is a protein marker, and lanes 1-4 are enzyme protein samples RNase R-wt, RNase R-w1, RNase R-w2, and RNase R-w3, respectively;

[0076] Figure 3 It is a statistical diagram of the Tm values ​​of different RNase R;

[0077] Figure 4The degradation effects of different RNase R on linear RNA at 37°C for 10 min; A: RNase R-wt, B: RNase R-w1, C: RNase R-w2, D: RNase R-w3; In each figure, M is GL DNAMarker 2000, lanes 1-5 are experimental groups with 10ng, 20ng, 30ng, 40ng, and 50ng of enzyme added for reaction, respectively, and lane 6 is a negative control group without adding enzyme;

[0078] Figure 5 The degradation effects of different RNase R on linear RNA at different reaction temperatures for 10 min; A: RNaseR-wt (37°C), B: RNase R-w1 (40°C), C: RNase R-w2 (40°C), D: RNase R-w3 (50°C); in each figure, M is GL DNAMarker 2000, lane 1 is the negative control group without adding enzyme, and lanes 2-6 are experimental groups with 10ng, 20ng, 30ng, 40ng, and 50ng of enzyme added for reaction, respectively;

[0079] Figure 6 The degradation effects of different RNase R on linear RNA at the optimal reaction temperature after heat treatment at 37°C for 30 min; A: RNase R-wt, B: RNase R-w1, C: RNase R-w2, D: RNase R-w3; In each figure, M is GL DNAMarker 2000, lane 1 is the negative control group without adding enzyme, and lanes 2-6 are experimental groups with 10ng, 20ng, 30ng, 40ng, and 50ng of enzyme added for reaction, respectively;

[0080] Figure 7 The degradation effects of different RNase R on linear RNA at the optimal reaction temperature after heat treatment at 55°C for 30 min; A: RNase R-wt, B: RNase R-w1, C: RNase R-w2, D: RNase R-w3; In each figure, M is GL DNAMarker 2000, lane 1 is the negative control group without adding enzyme, and lanes 2-6 are experimental groups with 10ng, 20ng, 30ng, 40ng, and 50ng of enzyme added for reaction, respectively;

[0081] Figure 8The results show the selective degradation performance of linear RNA by different RNase R at the optimal reaction temperature; A: substrate template is single-stranded RNA, B: substrate template is circular RNA, C: substrate template is a mixture of single-stranded RNA and circular RNA; in each figure, lane 1 is the negative control group without adding enzyme reaction, and lanes 2-5 are the experimental groups with RNase R-wt, RNase R-w1, RNase R-w2, and RNase R-w3 added for reaction. DETAILED DESCRIPTION

[0082] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0083] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0084] In the description of the present invention, the terms "comprises" and "having" and any variations thereof are intended to cover non-exclusive inclusions. For example, a process, method or product comprising a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to these processes, methods or products.

[0085] Unless otherwise defined, all scientific or technical terms in this patent are consistent with the common understanding of most ordinary persons in the field.

[0086] The following amino acid sequences are all in order from N-terminus to C-terminus; the nucleotide sequences are all in order from 5' to 3' end.

[0087] In order to obtain RNase R with improved thermal stability, wild-type RNase R (RNase R-wt) was mutated and screened in large quantities to obtain a variety of RNase R mutants (RNase R-w1 to w3). Among them, the amino acid sequence of RNase R-wt is shown in SEQ ID NO: 1, and the nucleotide sequence of the DNA molecule encoding RNase R-wt is shown in SEQ ID NO: 2.

[0088] (SEQ ID NO:1).

[0089]

[0090] The RNase R mutant (RNase R-w1) is formed by mutation of the amino acid sequence of RNase R-wt, and the specific amino acid mutation is H486Q. The amino acid sequence is specifically shown in SEQ ID NO:3, and the corresponding nucleotide sequence is shown in SEQ ID NO:4.

[0091] (SEQ ID NO:3).

[0092]

[0093] The RNase R mutant (RNase R-w2) is formed by mutation based on the amino acid sequence of RNase R-wt, and the specific amino acid mutations are K385Q and H486Q. The amino acid sequence is specifically shown in SEQ ID NO:5, and the corresponding nucleotide sequence is shown in SEQ ID NO:6.

[0094] (SEQ ID NO:5).

[0095]

[0096] The RNase R mutant (RNase R-w3) is formed by mutation based on the amino acid sequence of RNase R-wt, and the specific amino acid mutations are M188E, K385Q, and H486Q. The amino acid sequence is specifically shown in SEQ ID NO:7, and the corresponding nucleotide sequence is shown in SEQ ID NO8.

[0097] (SEQ ID NO:7).

[0098]

[0099] Example 1

[0100] 1. Construction of expression vector:

[0101] Hunan Aikerui Bioengineering Co., Ltd. was commissioned to design a nucleotide sequence encoding a histidine tag (HHHHHHHH) and a connecting peptide (GS) at the 3' end based on the coding nucleotide sequence information of RNase R-wt, RNase R-w1 to RNase R-w3, namely ATGCATCACCACCATCACCATCACCACGGTAGC (SEQ ID NO: 9), and synthesize the corresponding DNA molecules. The DNA molecules were then connected to the PET-28a vector by overlapping PCR to obtain recombinant expression vectors PET-28a / RNase R-wt, PET-28a / RNase R-w1, PET-28a / RNase R-w2 and PET-28a / RNase R-w3.

[0102] Furthermore, PCR amplification was performed using the above-mentioned recombinant expression vector as a template, and then the PCR product was purified and recovered using the SteadyPure PCR reaction liquid purification kit (Hunan Aikerui Biotechnology Co., Ltd., Catalog No. AG21003). The recovered product was transformed into DH5α competent cells, and positive monoclonal clones were screened for sequencing verification. After verification, the results were consistent with expectations.

[0103] 2. Expression:

[0104] The recombinant expression vectors capable of expressing wild-type RNase R or RNase R mutant were transformed into host cells E. coli BL21 (DE3), and single colonies were picked and inoculated into 10 mL LB medium containing 50 μg / mL ampicillin, respectively. After shaking and culturing in a 37°C shaker overnight, they were inoculated into 200 mL LB medium containing 50 μg / mL ampicillin at a volume ratio of 1:100, and shaken and cultured in a 37°C shaker until 0 D 600 is 0.6-0.8; add IPTG to a final concentration of 1.0mmol / L, lower the temperature to 25℃ and continue shaking induction for 12h-16h; collect the induced bacteria by centrifugation and weigh them, record the wet weight of the bacteria, and store them at -80℃.

[0105] 3. Purification:

[0106] Take the bacteria frozen at -80°C after induction of expression, add 5 mL of lysis buffer (25 mM Tris-HCl, 150 mM NaCl, 20 mM imidazol, pH 7.5) per gram of wet weight to resuspend the bacteria, and use a high-pressure crusher to lyse the bacteria. The high-pressure crushing condition is 650 bar, and the crushing is repeated three times. The lysed bacteria are centrifuged at 4°C and 12000 rpm for 30 min. The supernatant A is taken into a 200 mL sterile beaker, and the precipitate A is discarded.

[0107] After equilibration of the chromatography column Ni-NTA Purose 6 Fast Flow (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.) with buffer A (25 mM Tris-HCl, 150 mM NaCl, 20 mM imidazol, pH 7.5), the supernatant A was loaded into the chromatography column. After loading, the column was first rinsed with buffer A, and then gradient eluted with buffer B (25 mM Tris-HCl, 150 mM NaCl, 700 mM imidazole, pH 7.5) at 0% to 100%, and the eluted components were subjected to SDS-PAGE protein electrophoresis detection. According to the detection results, the eluate A containing the target protein was collected, and the eluate A was dialyzed into an enzyme preservation solution (50 mM Tris-HCl, 0.1 mM EDTA, 150 mM NaCl, 0.1% (v / v) Triton X-100, 1 mM DTT, 50% (v / v) glycerol, pH 7.5), and the dialyzate A was collected.

[0108] Take 30 μL of each protein dialyzate A and analyze the purification results by SDS-PAGE electrophoresis. Figure 2 shown.

[0109] Test Example 1

[0110] This test example uses differential scanning fluorescence (DSF) to detect the melting temperature (Tm value) of RNase R. There are environmentally sensitive fluorescent dye binding sites in proteins. The dye binding is weak in the natural state. The temperature rises to denature the protein, expose the hydrophobic region, enhance the dye binding, and significantly change the fluorescence intensity. By monitoring the curve of the fluorescence signal intensity changing with temperature, the temperature corresponding to the midpoint of the curve where the fluorescence intensity changes sharply is the melting point (Tm), which can reflect the thermal stability of the protein and the protein-ligand interaction. The higher the measured Tm value, the stronger the thermal stability of the protein.

[0111] (1) Dilute RNase R-wt, RNase R-w1 to RNase R-w3 appropriately with enzyme storage solution and use Micro BCA TMProtein Assay Kit (purchased from Thermo Fisher Scientific, catalog number 23235) was used to determine the protein concentration. For specific concentration determination methods, refer to the instruction manual of the kit.

[0112] (2) Place 20 μL of the reaction system (20 mmol / L HEPES-KOH, 150 mmol / L KCl, 1 mg enzyme, 20×SYPROOrange fluorescent dye (purchased from Hunan Aikerui Biotechnology Co., Ltd., catalog number AG31002), pH 8.0) in a fluorescence quantitative PCR instrument, adjust the excitation and emission wavelengths to the corresponding wavelengths of the fluorescent dye, set the heating rate to 1°C / 10s, and change the temperature range from 25°C to 99°C. Measure the fluorescence intensity every 1 to 3°C. After the reaction is completed, the curve of fluorescence intensity versus temperature is plotted using the data processing software Protein Thermal Shift Software, and the Tm value and related parameters of the protein sample are calculated.

[0113] The results are as follows Figure 3 shown.

[0114] The Tm value of RNase R-wt was 51.12°C, the Tm value of RNase R-w1 was 53.48°C, the Tm value of RNase R-w2 was 53.11°C, and the Tm value of RNase R-w3 was 55.29°C. The Tm values ​​of RNase R mutants RNase R-w1 to RNase R-w3 were all increased compared with RNase R-wt, indicating that the thermal stability of RNase R mutants RNase R-w1 to RNase R-w3 was higher than that of RNase R-wt.

[0115] Test Example 2

[0116] The optimal reaction temperature for wild-type RNase R to exert its degradation performance is 37°C. This test example tests the optimal reaction temperature for RNase R mutants to degrade linear RNA.

[0117] (1) The total RNA of Escherichia coli JM109 was extracted using the SteadyPure Universal RNA Extraction Kit (purchased from Hunan Aikerui Bioengineering Co., Ltd., catalog number AG21017). The total RNA of JM109 was used as a template, and the same gradient protein amount of RNase R-wt and RNase R mutants (RNase R-w1 to RNase R-w3) were added for the same reaction time, and the performance was determined by the degradation degree of the electrophoretic band of the reaction product. The specific steps are as follows:

[0118] Use enzyme storage solution to dilute RNase R-wt and RNase R mutants (RNase R-w1 to RNase R-w3) to about 10 ng / μL respectively. Prepare 50 μL of reaction system containing 500 ng template for reaction. The specific reaction system is shown in Table 1:

[0119] Table 1:

[0120]

[0121]

[0122] The 1× reaction buffer contained 20 mM Tris-HCl, 0.1 mM MgCl2 and 100 mM KCl, pH 8.0. The reaction conditions were: 37°C for 10 min, 70°C for 10 min. The reaction system without enzyme addition was used as the negative control group. After the reaction, the reaction product was detected by electrophoresis using 2% agarose gel.

[0123] The results are as follows Figure 4 shown.

[0124] RNase R-wt, RNase R-w1 to RNase R-w3 can all degrade linear RNA at 37°C. Among them, RNase R-wt is more suitable for linear RNA degradation at 37°C.

[0125] (2) Refer to the steps and results in (1) and adjust the reaction conditions appropriately. Specifically: RNase R-wt: 37℃10min, 70℃10min; RNase R-w1: 40℃10min, 70℃10min; RNase R-w2: 40℃10min, 70℃10min; RNase R-w3: 50℃10min, 70℃10min. The reaction system without enzyme addition was used as the negative control group. After the reaction was completed, the reaction products were detected by electrophoresis using 2% agarose gel.

[0126] The results are as follows Figure 5 shown.

[0127] When adjusted to the corresponding reaction temperature, the degradation degree of linear RNA by each RNase R mutant was basically the same as that of RNase R-wt, indicating that the optimal reaction temperature of each RNase R mutant was increased relative to RNase R-wt. Among them, the optimal reaction temperature of RNase R-w1 and RNase R-w2 was increased to 40℃, while the optimal reaction temperature of RNase R-w3 was increased to 50℃.

[0128] Test Example 3

[0129] This test example verifies the thermal stability of RNase R mutants.

[0130] Take the RNase R-wt and RNase R mutants (RNase R-w1 to RNase R-w3) obtained in Example 1, dilute the RNase R-wt and RNase R mutants (RNase R-w1 to RNase R-w3) to about 10 ng / μL using enzyme preservation solution, and heat-treat them at 37°C and 55°C for 30 min at the same time, and then detect the changes in the linear RNA degradation experiment of each sample. The method is consistent with the experiment (2) in the detection example 2. After the reaction is completed, the reaction product is detected by electrophoresis using 2% agarose gel.

[0131] The results are as follows Figure 6 and Figure 7 shown.

[0132] The results showed that after heat treatment at 37℃ for 30min, the degradation degree of linear RNA by RNase R-wt and RNase R mutants was basically the same, and both had good degradation performance. After heat treatment at 55℃ for 30min, the degradation degree of linear RNA by RNase R-wt decreased significantly, and there were still obvious RNA bands at the highest enzyme concentration. The degradation degree of linear RNA by RNase R-w1 and RNase R-w2 decreased partially, but the performance was better than RNase R-wt. RNase R-w3 had basically no change, and its degradation performance was roughly the same as that after heat treatment at 37℃ for 30min, and its performance was significantly better than RNase R-wt. This shows that RNase R mutants (RNase R-w1 to RNase R-w3) have good thermal stability, especially RNase R–w3.

[0133] Test Example 4

[0134] This test example tests the selective degradation performance of RNase R mutants on linear RNA. The specific experimental operation process is as follows:

[0135] Hunan Aikerui Biotechnology Co., Ltd. was commissioned to synthesize single-stranded RNA (AUGCCGUUCAAGUUAAACCUUG (SEQID NO: 10)), and circular RNA without RNase R purification treatment was prepared using this RNA. Take the RNase R-wt and RNase R mutants (RNase R-w1 to RNase R-w3) obtained in Example 1, dilute each enzyme to about 100 ng / μL using enzyme preservation solution, and use the same concentration of single-stranded RNA, circular RNA, and a mixture of single-stranded RNA and circular RNA as substrate templates to detect the degradation of linear RNA by each mutant. The method is basically the same as experiment (2) in detection example 2 (the only difference is that the final template concentration is 5 μM and the final enzyme content is 100 ng). After the reaction, the product is detected by electrophoresis using 15% 7M urea gel.

[0136] The results are as follows Figure 8 shown.

[0137] The results showed that after adding each RNase R mutant, the linear single-stranded RNA was completely degraded, while the circular RNA band remained basically unchanged and was not degraded, and some of its byproducts were removed well. This shows that RNase R-w1 to RNaseR-w3 still retain the ability to not degrade circular RNA after mutation, laying an experimental foundation for subsequent practical applications.

[0138] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge scope of ordinary technicians in the relevant technical field without departing from the purpose of the present invention.

Claims

1. An RNase R mutant, characterized in that: Compared with the wild-type RNase R, the RNase R mutant comprises a mutation site H486Q; the amino acid sequence of the wild-type RNase R is shown in SEQ ID NO:

1.

2. The RNase R mutant according to claim 1, characterized in that Compared to the wild-type RNase R, the RNase R mutant further comprises at least one of the mutation sites M188E and K385Q; Preferably, compared to the wild-type RNase R, the RNase R mutant comprises any one of the mutation sites A1) to A3): A1), H486Q; A2), K385Q, H486Q; A3), M188E, K385Q, H486Q.

3. A recombinant protein, characterized in that The method comprises a tag and the RNase R mutant according to claim 1 or 2.

4. A biological material related to the RNase R mutant according to claim 1 or 2 or the recombinant protein according to claim 3, characterized in that: The biological material is any one of B1) to B4): B1), a nucleic acid molecule encoding the RNase R mutant according to claim 1 or 2 or the recombinant protein according to claim 3; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

5. The biomaterial according to claim 4, characterized in that The nucleic acid molecule has any one of B11) to B14): B11), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 4; B12), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 6; B13), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 8; B14), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in B11), B12) or B13), and encoding the RNase R mutant; B15), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B13) under stringent conditions and encodes the RNase R mutant.

6. An enzyme preparation, characterized in that The invention comprises the RNase R mutant according to claim 1 or 2 or the recombinant protein according to claim 3.

7. A method for preparing the RNase R mutant according to claim 1 or 2 or the recombinant protein according to claim 3, characterized in that: include: The RNase R mutant according to claim 1 or 2 or the coding gene of the recombinant protein according to claim 3 is introduced into a biological cell to express the coding gene, thereby obtaining the RNase R mutant.

8. Use of the RNase R mutant according to claim 1 or 2, the recombinant protein according to claim 3 or the enzyme preparation according to claim 6 in any one of C1) to C3), C1), purification of circular RNA; C2), degrading linear RNA; C3), identification of circular RNA and / or linear RNA.

9. Use of any of D1) to D4) in any of E1) to E3), D1), the RNase R mutant according to claim 1 or 2; D2), the recombinant protein according to claim 3; D3), ​​the biological material according to claim 4 or 5; D4), the enzyme preparation according to claim 6; E1) Preparation of purified circular RNA products E2), preparing products for degrading linear RNA; E3), preparing products for identifying circular RNA and / or linear RNA.

10. A kit, characterized in that: It comprises the RNase R mutant according to claim 1, the recombinant protein according to claim 2 or the enzyme preparation according to claim 5.

Images