A citrus CsMYB62 gene and its application in citrus thorn softening

Abstract

This invention discloses a citrus CsMYB62 gene and its application in citrus thorn softening, belonging to the field of citrus breeding. This invention discovers that the citrus CsMYB62 gene is a key gene regulating the hardening of citrus thorn tips, and its nucleotide sequence is shown in SEQ ID NO: 1, or a nucleotide sequence in SEQ ID NO: 1 with one or more nucleotides substituted, deleted, or added, encoding a protein of equivalent activity. This invention finds that knocking out the citrus CsMYB62 gene through gene editing can make citrus thorns shorter and softer; therefore, this gene can serve as an important candidate gene for breeding citrus varieties with weakened thorns. This invention provides an important theoretical basis and gene resource for the genetic improvement of citrus thorn traits.

Description

Technical Field

[0001] This invention belongs to the field of citrus breeding, specifically relating to a citrus CsMYB62 gene and its application in softening citrus thorns. Background Technology

[0002] Thorns are a physical defense strategy for plants against herbivores, which benefits from the hardening of the thorn tip. Citrus thorns are modified branches; unlike the continuous growth at the branch tip, cell division at the tip of citrus thorns stops. After these cells complete elongation, the primary cell walls gradually deposit lignified secondary cell walls, leading to thickening and hardening of the cell walls, eventually forming hard, sharp thorn tips.

[0003] Citrus trees are diverse, yet most varieties possess thorns, especially some rootstock varieties. Citrus thorns cause significant inconvenience in agricultural operations such as grafting, pruning, and fruit harvesting; they also easily injure fruit and leaves, and spread pests and diseases. However, the regulatory mechanism of thorn tip hardening remains unclear. Therefore, developing citrus scions and rootstocks with weakened or thornless thorns is one of the important goals of citrus breeding.

[0004] In view of the above, this application is hereby submitted. Summary of the Invention

[0005] The purpose of this invention is to provide a citrus CsMYB62 gene and its application in softening citrus thorns.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] A citrus CsMYB62 gene, wherein the nucleotide sequence of the citrus CsMYB62 gene is as shown in SEQ ID NO: 1 or a nucleotide sequence of SEQ ID NO: 1 with one or more nucleotides substituted, deleted or added and having a nucleotide sequence encoding an equivalent active protein.

[0008] This invention also provides an application of the citrus CsMYB62 gene in citrus thorn softening, which is achieved by reducing or eliminating the activity of the citrus CsMYB62 gene. Further, the application is achieved by knocking down or eliminating the citrus CsMYB62 gene.

[0009] The present invention also provides a method for softening citrus thorns, which involves reducing or eliminating the activity of the citrus CsMYB62 gene.

[0010] Furthermore, the method for softening citrus thorns involves knocking down or eliminating the citrus CsMYB62 gene.

[0011] Furthermore, the method for softening citrus thorns includes the following steps:

[0012] (1) Design target sequences targeting the citrus CsMYB62 gene;

[0013] (2) Construct a gene editing vector targeting the citrus CsMYB62 gene;

[0014] (3) Transform citrus with gene editing vector targeting the citrus CsMYB62 gene, and after screening, obtain citrus plants with the citrus CsMYB62 gene knocked out, that is, citrus plants with short and soft thorns.

[0015] Furthermore, in step (1), the target sites for the citrus CsMYB62 gene are target site 1 with nucleotide sequence SEQ ID NO: 2 and target site 2 with nucleotide sequence SEQ ID NO: 3. The primers for gRNA1 targeting target site 1 are gRNA1-F and gRNA1-R with nucleotide sequences as shown in SEQ ID NO: 4 and 5, respectively, and the primers for gRNA2 targeting target site 2 are gRNA2-F and gRNA2-R with nucleotide sequences as shown in SEQ ID NO: 6 and 7, respectively.

[0016] Furthermore, step (2) includes annealing the two target primers from step (1) and then ligating them into a gene editing vector to obtain a gene editing vector targeting the citrus CsMYB62 gene. The gene editing vector is preferably pCAMBIA1300-pYAO-cas9.

[0017] Further, step (3) includes: transforming the gene editing vector targeting the citrus CsMYB62 gene obtained in step (2) into Agrobacterium, preparing Agrobacterium bacterial solution containing the gene editing vector, infecting the epicotyl of sterile citrus seedlings with Agrobacterium bacterial solution, and obtaining csmyb62 plants with the citrus CsMYB62 gene knocked out by fluorescence screening and Hi-Tom detection, thus obtaining citrus plants with short and soft thorns.

[0018] This invention also provides the application of the citrus CsMYB62 gene in the breeding of citrus varieties with weakened thorns. The citrus varieties with weakened thorns are those with reduced or inactivated CsMYB62 gene activity.

[0019] Advantages and beneficial effects of this invention: This invention discovers that the CsMYB62 gene in citrus is a key gene regulating the hardening of citrus thorn tips. Knocking out the CsMYB62 gene through gene editing can significantly reduce the length and hardness of citrus thorns without affecting the normal growth of transgenic plants. Therefore, this gene can serve as an important candidate gene for breeding citrus varieties with weakened thorns. This invention provides an important theoretical basis and gene resource for the genetic improvement of citrus thorn traits. Attached Figure Description

[0020] Figure 1The expression pattern of the citrus CsMYB62 gene; a: relative expression level of the citrus CsMYB62 gene in various citrus tissues; b: in situ hybridization of the citrus CsMYB62 gene in the citrus apical bud (scale bar = 300 μm).

[0021] Figure 2 Phenotypic characteristics of csmyb62 plants after gene editing of the CsMYB62 gene in citrus: a: Overall morphology of wild-type control (WT) and csmyb62 plants; b: Comparison of leafless branches of WT and csmyb62 plants; c: Gene editing status detected by Hi-Tom in csmyb62 plants.

[0022] Figure 3 Results of thorn length and hardness measurements in csmyb62 citrus plants after CsMYB62 gene editing: a: Comparison of thorn length between WT and csmyb62 plants (scale bar = 1 cm); b: Stroke length measurements of 50 thorns from each of WT and csmyb62 plants; c: Thoroughness measurements of thorns from each of WT and csmyb62 plants; d: Thoroughness measurements of 9 thorns from each of WT and csmyb62 plants.

[0023] Figure 4 Results of physiological index determination of branch thorns of citrus CsMYB62 plants after gene editing: a: determination of lignin content in branch thorns of WT and csmyb62 plants; b: determination of cellulose content in branch thorns of WT and csmyb62 plants; c: determination of lignin monomer content in branch thorns of WT and csmyb62 plants.

[0024] Figure 5 Comparison of secondary cell walls of thorns in citrus plants after CsMYB62 gene editing (csmyb62) and WT plants; a: lignin staining of transverse sections of WT plant thorns; b: lignin staining of csmyb62 plant thorns; c: transmission electron microscopy observation of thorn tips in WT and csmyb62 plants; d: statistical results of secondary cell wall thickness of 50 cells in thorn tips of WT and csmyb62 plants. Detailed Implementation

[0025] To clearly and completely describe the objectives, technical solutions, and advantages of this invention, the details of the invention are further described below in conjunction with embodiments. The described embodiments are only a part of the embodiments of this invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0026] The citrus CsMYB62 gene in this invention is based on the gene number Cs2g_pb012390 of the second-generation reference genome of sweet orange. It contains 2 introns and 3 exons, encoding 316 amino acids.

[0027] The coding nucleotide sequence of the citrus CsMYB62 gene is: ATGCACACAATGAGAGCAGCAAGGGCTG CTGGTACAAAGAGAGAGTGCAATTCCAGTGAAGAAGATCAACAAGAGCTGAGAAGAGGGCCATGGACTCTTGAAGAAGACACACTTCTTACTCATTACATACATCAACACGGCGAAGGTCGTTGGAATATGGTAGCTAAATGTGCAGGACTCAAAAGAACTGGAAAGAGTTGCAGATTGAGATGGCTAAATTATTTGAAACCCGACATTAAACGCGGGAACCTAACTCCACAGGAGCAGTTCTTGATTCTTGAACTCCATTCTAAGTGGGGTAACAGGTGGTCAAAAATTGCACAATGTCTGCCTGGAAGAACAGACAATGAAATCAAGAATTATTGGAGAACAAGGGTGCAGAAACAAGCTCGCCAGCTTAATATTGAGTCTAACAGTGAGACATTTTTCGAAGCTGTTCGATGTTATTGGATGCCAAGATTGCTGCAAAAGATGGAGCAGAATTCTGCTTCTCCTAATACTCTTTTGACAAATTCTAGTGCTCAATCATCCAACTTTTCTATTATCCCTTCTGTTTCGTCATCAACATTATCCCCTCTGCCAAGCACAATACTTTACAACTCAAATCAAACCATTAATGAAAACTCAAGTTCAGAGACTAGCCCTAACTTTTTCCCTGGAGATTTTTCAAAAATCTCACAGCTGCAGCAGCCTGGAATTACTCAACAGCCAACAAGTCCACATGCGTATGGCAACAATGTCTGCAGCAACCAAATAGTCCCAAACGACAGTTACTATGTGGACTGTTGTGGCTTTGACATGGAAGGTTACAGTCTAACTGATCCAATAGCAGAAATGAGCTCTTATGACATATCCTCGTCCGAATGCCAGATGGCGGAAGCTGATTGGATGTCCAATGACATGTCAGATGCTTTGTGGAACATGGATGACATATGGCAGCTTAGGGAGTAA(SEQ ID NO: 1).

[0028] Example 1: Expression pattern analysis of the citrus CsMYB62 gene

[0029] (1) To determine the expression location and pattern of the citrus CsMYB62 gene, qRT-PCR primers CsMYB62-RT-F (SEQ ID NO: 8) and CsMYB62-RT-R (SEQ ID NO: 9) were designed based on the specific region of the citrus CsMYB62 gene. The qRT-PCR reaction conditions were: 95℃ for 3 min; 95℃ for 10 s, 55℃ for 10 s, 72℃ for 20 s, 40 cycles; 72℃ for 10 min. Using 2... -△△Ct The relative expression levels of the citrus CsMYB62 gene in six different tissues of Carrizo orange were calculated in six different tissues: lateral buds, shoot tips, roots, leaves, thorn tips, and thorn bases.

[0030] Primer CsMYB62-RT-F: CAGTTCTTGATTCTTGAACTCC (SEQ ID NO: 8);

[0031] Primer CsMYB62-RT-R: ATATTAAGCTGGCGAGCTTG (SEQ ID NO: 9).

[0032] Analysis of the relative expression levels of the citrus CsMYB62 gene in different tissues revealed that the citrus CsMYB62 gene was specifically highly expressed only in the citrus thorn tip. Figure 1 a).

[0033] (2) At the same time, based on the full length of the CDS of the citrus CsMYB62 gene, an in situ hybridization probe for the CsMYB62 gene was prepared. Primers CsMYB62-ISH-F (SEQ ID NO: 10) and CsMYB62-ISH-R (SEQ ID NO: 11) were designed. Using the primers and Carrillo orange cDNA as a template, PCR amplification was performed using Phanta enzyme in a 100 μL system. After gel testing confirmed the DNA was correct, the DNA was recovered, and the volume of the DNA was increased to 600 μL. An equal volume of chloroform was added, and the mixture was centrifuged at 12000 rpm for 10 min. 500 μL of the supernatant was collected, and 50 μL of 3M NaAc and 1 mL of anhydrous ethanol were added. The mixture was then incubated at -20℃. After 2 h, the mixture was centrifuged at 12000 rpm at 4℃ for 10 min, the supernatant was discarded, and 1 mL of 75% ethanol was added to wash the DNA. The mixture was then centrifuged at 12000 rpm at 4℃ for 10 min, the supernatant was discarded, and the DNA was dried in a fume hood for 10 min. Finally, 20 μL of DEPC-treated sterile water was added to fully dissolve the DNA, which was then transferred to a new tube, and the DNA concentration was measured.

[0034] Prepare the in vitro transcription reaction system in an RNase-free PCR tube:

[0035]

[0036] After incubating the PCR machine at 37°C for 2 hours, aspirate 1 μL for gel testing. Add 2 μL of DNase to the transcription system, incubate at 37°C for 15 minutes, and aspirate another 1 μL for gel testing. The presence of 1-2 bright bands indicates a correct gel test. Transfer the remaining RNA to a 1.5 mL centrifuge tube, add 1.6 μL of 0.5 M EDTA to terminate the transcription reaction, and add DEPC H2O to a final volume of 100 μL. Purify the RNA using the Jianshi BioRNA Purification Kit and determine the RNA concentration.

[0037] The purified RNA was transferred to a PCR tube, and an equal volume of 2× hydrolysis solution (0.2M NaHCO3, pH = 10.2) was added. The RNA was hydrolyzed at 60°C for 65 min in a PCR instrument. After hydrolysis, 10 μL of 5% acetic acid was added to terminate the reaction. The hydrolyzed RNA was then purified again using the Jian Shi Bio RNA Purification Kit. The purified product was collected in a new centrifuge tube, and an equal volume of deionized formamide was added.

[0038] An RNA in situ hybridization probe targeting the CsMYB62 gene in citrus was prepared. The probe sequence is ISH-CsMYB62 (SEQ ID NO: 12). RNA in situ hybridization experiments were performed by cross-sectioning and longitudinal sectioning of young apical buds of trifoliate orange. Figure 1 As shown in b, the citrus CsMYB62 gene is highly expressed specifically in the citrus thorn tip and mainly near the vascular bundles.

[0039] Primer CsMYB62-ISH-F: ATTTAGGTGACACTATAGAATGCACACAATGAGAGCAGCAA G (SEQ IDNO: 10;)

[0040] Primer CsMYB62-ISH-R: TGTAATACGACTCACTATAGGGCGATTACTCCCTAAGCTGCC ATATGTC (SEQ ID NO: 11).

[0041] ISH-CsMYB62: UUACUCCCUAAGCCUGCCAUAUGUCAUCCAUGUUCCACAAAGCAU (SEQ ID NO: 12).

[0042] Example 2: Obtaining citrus plants with CsMYB62 gene-edited csmyb62

[0043] (1) Construction of gene editing vector targeting the citrus CsMYB62 gene: The target sequence of the CsMYB62 gene was designed using the CRISPR-P 2.0 website of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ). A total of two target sites were selected for gene editing. The nucleotide sequence of target site 1 is: ATGAGAGCAGCAAGGGCTGC (SEQ ID NO: 2), and the nucleotide sequence of target site 2 is: GATCAACAAGAGCTGAGAAG (SEQ ID NO: 3).

[0044] The method for constructing a gene-editing vector targeting the citrus CsMYB62 gene is as follows:

[0045] The primers for target 1 were designed as gRNA1-F and gRNA1-R. The nucleotide sequence of gRNA1-F is: ATTGATGAGAGCAGCAAGGGCTGC (SEQ ID NO: 4), and the nucleotide sequence of gRNA1-R is: AAACGCAGCCCTTGCTGCTCTCAT (SEQ ID NO: 5).

[0046] Primers for target 2 were designed as gRNA2-F and gRNA2-R. The nucleotide sequence of gRNA2-F is: ATTGGATCAACAAGAGCTGAGAAG (SEQ ID NO: 6), and the nucleotide sequence of gRNA2-R is: AAACCTTCTCAGCTCTTGTTGATC (SEQ ID NO: 7).

[0047] The target primers were dissolved in water to prepare a 10 μM stock solution. 10 μL of each primer was added to 80 μL of 0.5×TE (pH = 8.0), and the mixture was heated at 98 °C for 3 min in a PCR instrument. The PCR tubes were immediately removed and allowed to cool naturally to room temperature to anneal the primers. After obtaining the annealed products of the two target primers, they were ligated with the pBlue vector digested with Bsa I using T4 ligase and transformed into competent E. coli cells. Plasmids were extracted to obtain the pBlue-gRNA1 and pBlue-gRNA2 vectors.

[0048] The pBlue-gRNA1 vector was digested with Nhe I and Spe I. After electrophoresis, a fragment of approximately 650 bp was recovered and ligated with the pCAMBIA1300-pYAO:Cas9 vector digested with Spe I. The ligation was performed using T4 ligase, and the resulting vector was transformed into competent E. coli cells. The plasmid was extracted to obtain the pCAMBIA1300-pYAO:Cas9-gRNA1 vector. Similarly, the pBlue-gRNA2 vector was digested with Nhe I and Spe I. After electrophoresis, a fragment of approximately 650 bp was recovered and ligated with the pCAMBIA1300-pYAO:Cas9-gRNA1 vector digested with Spe I. The ligation was performed using T4 ligase, and the resulting vector was transformed into competent E. coli cells. The plasmid was extracted to obtain the final pCAMBIA1300-pYAO:Cas9-gRNA1-gRNA2 gene editing vector.

[0049] (2) Citrus genetic transformation: The obtained pCAMBIA1300-pYAO:Cas9-gRNA1-gRNA2 gene editing vector was transformed into Agrobacterium. Before infection, Agrobacterium carrying the pCAMBIA1300-pYAO:Cas9-gRNA1-gRNA2 gene editing vector was streaked twice on LB medium containing 50 mg / mL kanamycin (10 g / L trypsin + 5 g / L yeast extract + 10 g / L sodium chloride (solid LB with 15 g / L agar powder)) to activate Agrobacterium. The activated Agrobacterium was scraped into suspension medium (MT + 0.5 g / L malt extract + 1.5 g / L glutamine), and 50 mg / mL acetylsylphenone was added to the suspension medium to adjust the bacterial concentration to OD. 600=0.6-0.8, and incubated statically at 28℃ for 1 hour. For infection, the epicotyl of sterile citrus (Carizzo orange) seedlings was cut into stem segments of approximately 1 cm. The stem segments were placed in a suspension containing Agrobacterium, shaken for 10 minutes, and then allowed to stand for 10 minutes. The bacterial suspension was discarded, and the surface of the stem segments was blotted dry with sterile filter paper. The stem segments were then transferred to co-culture medium (MT + BA 0.5 mg / L + KT 0.5 mg / L + NAA 0.1 mg / L + acetylsylgenone 50 mg / mL) and co-cultured at 23℃ for 3 days. After co-culture, the stem segments were transferred to selection medium (MT + BA 0.5 mg / L + KT 0.5 mg / L + NAA 0.1 mg / L + kanamycin 50 mg / mL) and incubated in the dark at 28℃ for 7 days, followed by incubation under light. Once the regenerated shoots have grown at least two leaves, positive plants displaying GFP fluorescence are selected based on fluorescence screening. These positive shoots can then be cut off for further rooting culture or grafting. When the positive seedlings reach a certain height, DNA is extracted from some leaves for Hi-Tom analysis to detect gene editing at the target site. The fully edited positive plants are selected as csmyb62 plants with the citrus CsMYB62 gene knocked out.

[0050] Example 3: Phenotypic evaluation of citrus plants with csmyb62 gene editing after CsMYB62 gene editing

[0051] A total of 10 positive plants were obtained, of which 6 were csmyb62 plants in citrus where the CsMYB62 gene was completely edited. Figure 2 As shown, the thorns of citrus branches with the CsMYB62 gene completely knocked out become short and soft, while the development of other parts of the plant is normal and does not affect the other growth and development of the plant.

[0052] To further quantify the thorn phenotype of csmyb62 plants, the thorn lengths of 50 csmyb62 plants from 6 independent transgenic lines were analyzed. Figure 3 As shown in a and b, the average length of the thorns from 50 csmyb62 plants was 6.28 mm, significantly shorter than the average length of WT thorns (15.35 mm). Simultaneously, the hardness of the csmyb62 plant thorns was measured using a texture analyzer, and a total of 9 thorns from 3 independent transgenic lines were analyzed. The average hardness of the csmyb62 plant thorns was 1.06 N, significantly lower than the average hardness of WT thorns (3.05 N). Figure 3 c, d). This indicates that the thorns of citrus branches with the CsMYB62 gene completely knocked out are shorter and softer compared to WT.

[0053] Example 4: Determination of physiological indicators of branch thorns in citrus plants after gene editing of the CsMYB62 gene (csmyb62).

[0054] Branches and thorns from 6-month-old csmyb62 plants and WT plants were collected. The lignin and cellulose content of the branches and thorns of both WT and csmyb62 plants was determined using a lignin and cellulose assay kit. Figure 4 As shown in a and b, the lignin and cellulose contents in the thorns of csmyb62 plants were significantly lower than their corresponding WT values. Simultaneously, the lignin monomer content in the WT and thorns of csmyb62 plants was measured, and the results were... Figure 4 c) shows that in csmyb62 plants, the content of H-lignin monomers remained almost unchanged compared to WT, while the contents of G- and S-lignin monomers decreased by 4-5 times compared to WT. This indicates that the softening of the thorns in csmyb62 plants is partly due to the decrease in lignin and cellulose content in the thorns.

[0055] Example 5: Comparison of secondary cell walls of thorns in citrus plants with CsMYB62 gene editing (csmyb62) and WT plants.

[0056] Spurs of 1-2 cm in length from csmyb62 and WT plants were collected and sectioned into 50 μm thick sections using a vibratory microtome. The sections were stained in 2% phloroglucinol solution (dissolved in 95% ethanol) for 2 min before observation under a microscope. Figure 5 As shown in a and b, the tips of the thorns of the WT plant accumulated a large amount of lignin, appearing bright red, while the lignin accumulation at the base was relatively small. In contrast, the lignin accumulation in the thorns of the csmyb62 plant was significantly reduced, the accumulation of lignin in the interfascicular fibers disappeared, and lignin only accumulated in some vessel locations.

[0057] Further transmission electron microscopy (TEM) observations were performed on the tips of the thorns of csmyb62 and WT plants. More than 30 fields of view were captured for each material, and 50 cell wall thicknesses were measured for each material. Figure 5 As shown in c and d, the secondary cell wall of the spine tips in WT plants is significantly thickened, with an average cell wall thickness of approximately 1.1 μm; while in the spines of csmyb62 plants, the cell wall thickness at the spine tips is approximately 0.2 μm, significantly lower than that in WT. This indicates that the softening of the spines in csmyb62 plants is due to a decrease in the thickness of the secondary cell wall at the spine tips.

[0058] In summary, this invention utilizes gene editing to knock out the CsMYB62 gene, which significantly reduces the length and stiffness of citrus thorns without affecting the normal growth of transgenic plants. Therefore, this gene can serve as an important candidate gene for breeding citrus varieties with weakened thorns. This invention provides an important theoretical basis and gene resource for the genetic improvement of citrus thorn traits.

Claims

1. The application of the citrus CsMYB62 gene in citrus thorn softening, characterized by: The nucleotide sequence of the citrus CsMYB62 gene is shown in SEQ ID NO: 1; the application is achieved by knocking down or knocking out the citrus CsMYB62 gene.

2. A method for softening citrus branch thorns, characterized in that: The method involves knocking down or eliminating the citrus CsMYB62 gene; the nucleotide sequence of the citrus CsMYB62 gene is shown in SEQ ID NO:

1.

3. The method for softening citrus branch thorns according to claim 2, characterized in that: The method includes the following steps: (1) Design target sequences targeting the citrus CsMYB62 gene; (2) Construct a gene editing vector targeting the citrus CsMYB62 gene; (3) Transform citrus with gene editing vectors targeting the citrus CsMYB62 gene, and screen to obtain citrus plants in which the citrus CsMYB62 gene is knocked out.

4. The method according to claim 3, characterized in that: In step (1), the target sites for the citrus CsMYB62 gene are target site 1 with nucleotide sequence SEQ ID NO: 2 and target site 2 with nucleotide sequence SEQ ID NO: 3; the primers for gRNA1 targeting target site 1 are gRNA1-F and gRNA1-R with nucleotide sequences as shown in SEQ ID NO: 4 and 5, respectively, and the primers for gRNA2 targeting target site 2 are gRNA2-F and gRNA2-R with nucleotide sequences as shown in SEQ ID NO: 6 and 7, respectively.

5. The application of the citrus CsMYB62 gene in the breeding of citrus varieties with weakened thorns, characterized by: The nucleotide sequence of the citrus CsMYB62 gene is shown in SEQ ID NO: 1; the citrus variety with weakened thorns is a citrus variety with the citrus CsMYB62 gene knocked down or knocked out.

Images