Application of wheat RING type ubiquitin ligase protein gene TaRZFP34 in gibberellic disease resistance

Abstract

The invention discloses application of a wheat RING type ubiquitin ligase protein gene TaRZFP34 in resisting gibberellic disease, and belongs to the technical field of gene engineering. The wheat RING type ubiquitin ligase protein TaRZFP34 is manipulated by fusarium graminearum core pathogenic secretory protein Osp24, a disease-resistant protein TaSnRK1 alpha is modified in a targeting and ubiquitination manner, and the resistance of wheat to gibberellic disease is negatively regulated. After the TaRZFP34 is edited by utilizing a CRISPR-Cas9 gene editing technology, the resistance of the wheat to the gibberellic disease is obviously improved. Therefore, the wheat RING type ubiquitin ligase protein gene TaRZFP34 can be used as a candidate gene for wheat gibberellic disease-resistant breeding, and the disease resistance of wheat to gibberellic disease is effectively improved. The invention not only solves the problem of scarcity of wheat scab resistance resources to a certain extent, but also provides a new scheme for designing and breeding of scab-resistant molecules.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to application of wheat RING ubiquitin ligase protein gene TaRZFP34 in resistance to scab. Background Art

[0002] Wheat is one of the most important food crops in the world, and its safe production is of great significance to my country's national economic development and social stability. Wheat head blight caused by a complex population of Fusarium with Fusarium graminearum as the dominant species is a major fungal disease of crops worldwide. Fusarium graminearum mainly infects during the flowering period, which not only leads to a large-scale reduction in crop yields or even crop failure, but more seriously, the fungal toxins produced during the infection process will remain in wheat and wheat products, harming the health of humans and animals. Therefore, the scientific prevention and control of head blight is related to national food and food safety.

[0003] Breeding disease-resistant varieties is the most economical, long-lasting and effective strategy for preventing and controlling wheat fusarium head blight. However, there is a serious lack of wheat fusarium head blight-resistant varieties, and the main cultivated varieties are generally susceptible to the disease, which makes the current prevention and control of fusarium head blight in my country face a severe situation. Discovering and utilizing genes related to fusarium head blight resistance in wheat is a new idea for creating disease-resistant materials. However, the current resources of wheat fusarium head blight resistance genes are extremely limited, which has seriously restricted the prevention and control of fusarium head blight to a large extent. Summary of the invention

[0004] In view of the shortcomings of the existing technology, the present invention aims to further explore the susceptible genes in wheat that are targeted and manipulated by Fusarium graminearum, and based on the understanding of its susceptibility mechanism, use CRISPR-Cas9 gene editing technology to transform it to destroy its susceptibility pathway and improve wheat disease resistance. The present invention provides a new strategy for enriching disease resistance gene resources, improving crop resistance and creating disease-resistant materials.

[0005] In order to achieve the above objectives, the present invention provides the following solutions:

[0006] The present invention provides a wheat RING-type ubiquitin ligase protein gene TaRZFP34, whose encoded protein is utilized by the core pathogenic secretory protein Osp24 of Fusarium graminearum, targets and ubiquitinates the disease-resistant protein TaSnRK1α, and negatively regulates the resistance of wheat to fusarium head blight. The wheat RING-type ubiquitin ligase protein gene TaRZFP34 has three copies in the wheat genome, which are respectively located on chromosomes 1A, 1B and 1D of the wheat genome.

[0007] The open reading frame of the TaRZFP34 gene located on chromosome 1A of the wheat genome has the nucleotide sequence shown in SEQ ID NO:1; the open reading frame of the TaRZFP34 gene located on chromosome 1B of the wheat genome has the nucleotide sequence shown in SEQ ID NO:2; the open reading frame of the TaRZFP34 gene located on chromosome 1D of the wheat genome has the nucleotide sequence shown in SEQID NO:3.

[0008] On the other hand, the present invention provides an application of the wheat RING-type ubiquitin ligase protein gene TaRZFP34, wherein the application is to inactivate the gene TaRZFP34 to enhance the disease resistance of wheat to fusarium head blight.

[0009] Furthermore, the application is: inactivating the gene TaRZFP34 through gene editing technology to enhance the disease resistance of wheat to ergot.

[0010] Furthermore, the gene editing technology includes CRISPR-Cas9 gene editing technology.

[0011] Furthermore, the application is: by transforming the CRISPR-Cas9 gene editing vector targeting the gene TaRZFP34 into wheat plants, the gene TaRZFP34 is inactivated, thereby improving the disease resistance of wheat to ergot.

[0012] Furthermore, the CRISPR-Cas9 gene editing vector targeting the gene TaRZFP34 comprises a fragment for editing the gene TaRZFP34; the nucleotide sequence of the fragment is shown in SEQ ID NO:7 and SEQ ID NO:8.

[0013] Furthermore, the pathogens of the fusarium wilt include Fusarium graminearum.

[0014] On the other hand, the present invention provides a CRISPR-Cas9 gene editing vector, comprising a fragment for editing the gene TaRZFP34, the nucleotide sequence of the fragment is shown in SEQ ID NO:7 and SEQ ID NO:8.

[0015] On the other hand, the present invention provides a method for breeding disease-resistant wheat varieties, specifically: using Agrobacterium genetic transformation technology to transform the CRISPR-Cas9 gene editing vector into wheat plants, and screening out wheat plants in which the TaRZFP34 genes on wheat chromosomes 1A, 1B, and 1D are all edited.

[0016] Furthermore, the disease-resistant wheat is ergot-resistant wheat.

[0017] Beneficial effects of the present invention:

[0018] The present invention found that the wheat RING-type ubiquitin ligase protein TaRZFP34 was used by the core pathogenic secretory protein of Fusarium graminearum to target and ubiquitinate the disease-resistant protein TaSnRK1α, negatively regulating the resistance of wheat to fusarium head blight. On this basis, the inventors further used CRISPR-Cas9 gene editing technology to edit and transform the TaRZFP34 gene so that its function was lost, which effectively improved the resistance of wheat to fusarium head blight, indicating that the wheat RING-type ubiquitin ligase gene TaRZFP34 can be used as a candidate gene for genetic improvement of wheat disease resistance, providing a new idea for cultivating wheat germplasm resistant to fusarium head blight.

[0019] At present, there is no report on improving wheat resistance to Fusarium graminearum using susceptible genes. The present invention uses the interaction between Fusarium graminearum and wheat as an entry point, discovers the wheat RING-type ubiquitin ligase protein TaRZFP34 that is targeted and manipulated by Fusarium graminearum, and transforms it. This provides a solution to the problem of lack of resistance sources to Fusarium graminearum. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the gel electrophoresis result of wheat RING ubiquitin ligase protein gene TaRZFP34. Figure 1 The marker band is on the left in the middle, and the target gene band is on the right, with a size of 798 kd.

[0021] Figure 2 This is a Western Blot result diagram of the interaction between Osp24 and TaRZFP34 using in vivo co-immunoprecipitation (Co-IP) in tobacco. GFP and mCherry antibodies were used to detect the protein expression of TaRZFP34 and Osp24, respectively. After GFP beads enriched TaRZFP34-GFP, Osp24-mCherry was detected, and empty mCherry was not enriched, indicating that TaRZFP34 and Osp24 interacted.

[0022] Figure 3 This is a Western Blot result diagram of the Co-IP experiment verifying the interaction between TaRZFP34 and TaSnRK1α. GFP and mCherry antibodies were used to detect the protein expression of TaRZFP34 and TaSnRK1α, respectively. After GFP beads enriched TaRZFP34-GFP protein, TaSnRK1α-mCherry protein was detected, and empty mCherry protein was not enriched, indicating that TaRZFP34 and TaSnRK1α interacted in plants.

[0023] Figure 4This is a Western Blot result of the tobacco in vivo ubiquitination experiment to verify that TaRZFP34 enhances the ubiquitination level of TaSnRK1α. GFP and ubiquitination antibodies (UBI) were used to detect the GFP beads-enriched TaSnRK1α protein and its ubiquitination level, respectively. When GFP beads enriched the same amount of TaSnRK1α protein, the ubiquitination band of TaSnRK1α protein became significantly stronger after the addition of TaRZFP34.

[0024] Figure 5 This is a schematic diagram of the TaRZFP34 gene editing vector. The maize ubiquitin promoter ZmUbi is used to drive the spCas9 gene, and gRNA1 and gRNA2 are driven by TaU6.1 and TaU6.3, respectively.

[0025] Figure 6 This is the gel electrophoresis result of PCR amplification of gRNA1 and gRNA2 of TaRZFP34 gene editing target in TaRZFP34 gene editing plants. "M" represents Marker; "L1-L8" represents 8 TaRZFP34 gene editing lines; "Fielder" represents wild-type wheat material, which is used as a positive control.

[0026] Figure 7 The figure shows the ear inoculation phenotype and disease statistics of the wheat RING ubiquitin ligase protein gene TaRZFP34 edited strain. Fielder represents the wild-type wheat material; TaRZFP34-KO represents the wheat RING ubiquitin ligase protein gene TaRZFP34 edited strain. DETAILED DESCRIPTION

[0027] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0028] Example 1

[0029] This example describes the molecular cloning of the wheat RING ubiquitin ligase protein gene TaRZFP34 and the verification of its interaction with the secretory protein Osp24 of Fusarium graminearum. Pathogen secretory proteins often assist infection by interfering with or manipulating the functions of key regulatory factors of the host immune response. When identifying the host target targeted by the core pathogenic secretory protein Osp24 of Fusarium graminearum during infection of wheat, a RING-type ubiquitin ligase protein TaRZFP34 was discovered.

[0030] In the Fielder wheat variety, the nucleotide sequences of the three copies of the wheat RING ubiquitin ligase protein gene TaRZFP34 in the wheat genome are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, and the amino acid sequences of the encoded proteins are shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively. The nucleotide sequence of the wheat RING ubiquitin ligase protein gene TaRZFP34 used in this example is based on the sequence shown in SEQ ID NO: 1, and the nucleotide sequence encodes the amino acid sequence shown in SEQ ID NO: 4.

[0031] Fielder wheat varieties grown in normal soil in the greenhouse were used as materials. The wheat ears were inoculated with Fusarium graminearum during the flowering period. The spikelets were taken out 3 days later, the total RNA was extracted, and it was reverse transcribed into cDNA as a template for PCR amplification.

[0032] Based on SEQ ID NO: 1 of wheat RING ubiquitin ligase protein gene TaRZFP34, specific primers TaRZFP34-F (5'ATGGATTTGGGAGCAGAGCAGC 3') and TaRZFP34-R (5'TCAGACTCTGGAGCACGCC3') were designed and used FastPfu DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.) was used to PCR amplify the full-length coding sequence of wheat RING ubiquitin ligase protein gene TaRZFP34. The PCR reaction system is shown in Table 1.

[0033] Table 1. TaRZFP34 gene PCR reaction system

[0034]

[0035] The PCR reaction program is: 95℃ pre-denaturation for 5min; 95℃ for 30sec, 58.5℃ for 40sec, 72℃ for 1min, 35 cycles; 72℃ extension for 10min. Store at 4℃. The gel electrophoresis results are as follows: Figure 1 As shown, the band sizes are as expected.

[0036] The PCR product was subjected to Sanger sequencing to confirm that the nucleotide sequence of the obtained wheat RING ubiquitin ligase protein gene TaRZFP34 was consistent with SEQ ID NO:1, and the encoded amino acid sequence was consistent with SEQ ID NO:4.

[0037] Using the Agrobacterium transient expression system, Co-IP experiments were carried out in tobacco to verify that the core pathogenic secretory protein Osp24 of Fusarium graminearum targets the wheat RING ubiquitin ligase protein TaRZFP34. Figure 2 , TaRZFP34-GFP and Osp24-mCherry proteins were co-expressed in tobacco as the experimental group, and TaRZFP34-GFP and empty mCherry were co-expressed as the control group. After enriching TaRZFP34-GFP protein with GFP-beads (Tian Di Ren He Biotechnology Co., Ltd.), Osp24-mCherry was detected, while empty mCherry was not enriched, indicating that Osp24 and TaRZFP34 interacted in tobacco.

[0038] Example 2

[0039] This example describes the targeted ubiquitination modification of the disease resistance protein TaSnRK1α by the wheat RING ubiquitin ligase protein TaRZFP34.

[0040] TaSnRK1α is a positive regulator of wheat fusarium resistance. The in vivo Co-IP experiment in tobacco as described in Example 1 was carried out to prove that TaRZFP34 also interacted with TaSnRK1α. Figure 3 shown.

[0041] E3 ubiquitin ligase promotes protein degradation by ubiquitinating substrates. Combined with Agrobacterium transient expression technology, ubiquitination experiments were carried out in tobacco, confirming that TaRZFP34 can enhance the ubiquitination level of TaSnRK1α. Figure 4 As shown, after adding the proteasome inhibitor Mg132 to inhibit protein degradation, the ubiquitin antibody (Ubiquitin Rabbit PolyclonalAntibody, Beyotime Biotechnology Co., Ltd.) was used to detect the ubiquitination band of TaSnRK1α protein enriched in GFP-beads. Compared with the empty control, the ubiquitination band of TaSnRK1α became stronger after adding TaRZFP34, indicating that TaRZFP34 enhances the ubiquitination level of TaSnRK1α in plants.

[0042] Example 3

[0043] This example describes the construction of a gene editing vector for wheat RING ubiquitin ligase protein gene TaRZFP34 and the acquisition of gene-edited plants.

[0044] Through sequence analysis, two gRNAs targeting the conserved region of the RING ubiquitin ligase protein gene TaRZFP34 on wheat chromosomes 1A, 1B and 1D were designed (gRNA1 5'GCTGCGAGCATTACACGAGG 3', gRNA2 5'TAGCTTGGTTATGGCAATGC 3'), and the primer sequences gRNA1-F (5'GCTGCGAGCATTACACGAGG 3', SEQ ID NO:9) and gRNA1-R (5'CCTCGTGTAATGCTCGCAGC 3', SEQ ID NO:10) of gRNA1, and the primer sequences gRNA2-F (5'TAGCTTGGTTATGGCAATGC 3', SEQ ID NO:11) and gRNA2-R (5'GCATTGCCATAACCAAGCTA3', SEQID NO:12) of gRNA2 were synthesized at Sangon Biotechnology Co., Ltd. After diluting gRNA1-F and gRNA1-R to 100 mM, the dimerization reaction of gRNA1 primer was carried out according to Table 2. The treatment method was: boiling water bath for 10 min, cooling at room temperature for 1-2 h. The dimerization reaction method of gRNA2 primer was the same.

[0045] Table 2. gRNA1 dimerization reaction system

[0046] Components volume gRNA1-F primer 2μl gRNA1-R primer 2μl 1×TE 8μl <![CDATA[ddH2O]]> 10μl

[0047] The pENTR4 intermediate vector was cut with BtgZI restriction endonuclease, and the dimerization product of gRNA1 was constructed into the pENTR4 intermediate vector using T4 DNA Ligase (Bao Ri Yi Yi Biotechnology Co., Ltd.) according to Table 3. The treatment method was: react at 16°C for 12-16h to obtain the gRNA1-pENTR4 vector.

[0048] Table 3. gRNA1 and pENTR4 T4 ligation reaction system

[0049] Components volume gRNA1-F primer 2μl gRNA1-R primer 2μl 1×TE 8μl <![CDATA[ddH2O]]> 10μl

[0050] Similarly, the gRNA1-pENTR4 vector was cut with BsaI restriction endonuclease, and the dimerization product of gRNA2 was constructed into the gRNA1-pENTR4 vector with reference to Table 4 to obtain the gRNA1-gRNA2-pENTR4 vector.

[0051] Table 4. gRNA2 and gRNA1-pENTR4 T4 ligation reaction system

[0052]

[0053]

[0054] use LR Clonase TM II enzyme mix (Invitrogen), the core elements in the gRNA1-gRNA2-pENTR4 vector were cloned into the gene editing vector Cas9 using Gateway cloning technology to obtain the gRNA1-gRNA2-Cas9 vector. The vector structure is shown in Figure 5 shown.

[0055] The gRNA1-gRNA2-Cas9 vector plasmid was transformed into Agrobacterium, and the Fielder wheat variety was used as the recipient. TaRZFP34 gene-edited immature wheat embryos were obtained through Agrobacterium genetic transformation. After single plant transplantation, rooting and regeneration, T0 generation regenerated plants were obtained. The genomic DNA of the leaves of the T0 generation regenerated plants was extracted, and the sequencing primers gRNA-check-F (5'GGAGTGAGTACGGTGTGCCTGATTCGTGGTTTCCGGGTG 3', SEQ ID NO: 13) and gRNA-check-F (5'GAGTTGGATGCTGGATGGGCGAAATCGCGCGGCATGG 3', SEQ ID NO: 14) were designed near the editing target sites gRNA1 and gRNA2 of TaRZFP34. The leaf DNA was amplified by PCR, and the gel electrophoresis detection results were as follows: Figure 6 The amplified products were sent to the Hi-TOM platform (China National Rice Research Institute, Chinese Academy of Agricultural Sciences) for sequencing. T1 plants in which the wheat RING ubiquitin ligase protein gene TaRZFP34 was edited in wheat chromosomes 1A, 1B, and 1D were selected for Fusarium head blight resistance analysis.

[0056] Example 4

[0057] This example describes the identification of resistance to Fusarium fusarium in wheat edited with the wheat RING ubiquitin ligase protein gene TaRZFP34.

[0058] The wild-type strain PH-1 of Fusarium graminearum with strong pathogenicity was selected, and the wheat ears of the TaRZFP34 gene-edited plants (TaRZFP34-KO) and wild-type Fielder wheat plants obtained above were inoculated at the flowering stage by single flower drip method. Photos were taken 12 days after inoculation to record the disease situation, and the number of diseased grains was calculated to compare the resistance of the two to fusarium head blight. Figure 7 As shown in the figure on the left, compared with wild-type Fielder wheat plants, TaRZFP34 gene-edited wheat plants had significantly fewer diseased spikes after inoculation with wild-type strain PH-1 of Fusarium graminearum. Figure 7As shown in the figure on the right, compared with Fielder, the number of diseased grains in wheat plants edited with the TaRZFP34 gene was reduced by about 60%, indicating that the deletion of the wheat RING ubiquitin ligase protein gene TaRZFP34 can significantly improve wheat resistance to Fusarium head blight.

[0059] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. Application of gene TaRZFP34, wherein the gene TaRZFP34 has a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, characterized in that: The application is to inactivate the gene TaRZFP34 and enhance the disease resistance of wheat to fusarium head blight.

2. The use according to claim 1, characterized in that: The gene TaRZFP34 is inactivated through gene editing technology to improve the disease resistance of wheat to ergot.

3. The use according to claim 2, characterized in that: The gene editing technology includes CRISPR-Cas9 gene editing technology.

4. The use according to claim 1, characterized in that: By transforming the CRISPR-Cas9 gene editing vector targeting the gene TaRZFP34 into wheat plants, the gene TaRZFP34 is inactivated, thereby improving the wheat's resistance to ergot.

5. The use according to claim 3, characterized in that: The CRISPR-Cas9 gene editing vector targeting the gene TaRZFP34 comprises a fragment for editing the gene TaRZFP34; the nucleotide sequence of the fragment is shown in SEQ ID NO:7 and SEQ ID NO:

8.

6. The use according to claim 1, characterized in that: The pathogens of the fusarium wilt include Fusarium graminearum.

7. A CRISPR-Cas9 gene editing vector, characterized in that: It comprises a fragment for editing the gene TaRZFP34 according to claim 1, and the nucleotide sequence of the fragment is shown in SEQ ID NO:7 and SEQ ID NO:

8.

8. A method for breeding disease-resistant wheat varieties, characterized in that: The CRISPR-Cas9 gene editing vector according to claim 7 is transformed into wheat plants by using Agrobacterium genetic transformation technology, and wheat plants in which the TaRZFP34 genes on wheat chromosomes 1A, 1B, and 1D are all edited are screened; the TaRZFP34 gene on the wheat chromosome 1A has a nucleotide sequence as shown in SEQ ID NO: 1, the TaRZFP34 gene on the wheat chromosome 1B has a nucleotide sequence as shown in SEQ ID NO: 2, and the TaRZFP34 gene on the wheat chromosome 1D has a nucleotide sequence as shown in SEQ ID NO:

3.

9. The cultivation method according to claim 8, characterized in that: The disease-resistant wheat is ergot-resistant wheat.

Images