Application of wheat ring finger ubiquitin ligase protein gene TaRZFP34 in resistance to scab
By targeting the inactivated wheat RING-type ubiquitin ligase protein TaRZFP34 using CRISPR-Cas9 gene editing technology, the problem of scarce wheat scab resistant varieties has been solved, significantly improving wheat resistance to scab and providing a new method for creating resistant materials.
Patent Information
- Application Number
- CN202510233836.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2045-02-28
AI Technical Summary
There is a lack of wheat varieties resistant to Fusarium head blight, and existing technologies are insufficient to effectively improve wheat resistance to the disease.
By using CRISPR-Cas9 gene editing technology to target and inactivate the wheat RING ubiquitin ligase protein gene TaRZFP34, the disease-susceptibility pathway was disrupted, thereby enhancing wheat disease resistance.
By inactivating the TaRZFP34 gene, wheat resistance to Fusarium head blight was significantly improved, providing a new approach to the creation of disease-resistant materials and offering an effective strategy for the control of Fusarium head blight.
Smart Images

Figure BDA0005292212540000052 
Figure BDA0005292212540000071 
Figure BDA0005292212540000081
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of a wheat RING ubiquitin ligase protein gene TaRZFP34 in resistance to scab. BACKGROUND
[0002] Wheat is one of the most important crops in the world, and its safe production is of great significance to the development of China's national economy and social stability. Wheat scab caused by Fusarium graminearum as the dominant species of Fusarium complex species is a major crop fungal disease in the world. F. graminearum mainly invades during the flowering stage, which not only leads to a large area of crop yield reduction or even absolute loss, but more seriously, the mycotoxins produced during the invasion process will remain in wheat and wheat products, harming human and animal health. Therefore, scientific prevention and control of scab is related to national food and food safety.
[0003] Breeding disease-resistant varieties is the most economical, sustainable and effective strategy for preventing and controlling wheat scab, but at present, there is a serious lack of wheat scab-resistant varieties, and the main cultivars are generally susceptible to the disease, which makes the current prevention and control of scab in China face a severe situation. Exploring scab-resistant and susceptible genes in wheat and utilizing them is a new idea for creating disease-resistant materials. However, the resources of scab-resistant and susceptible genes in wheat are extremely limited, which has seriously restricted the prevention and control of scab to a great extent. SUMMARY
[0004] In view of the deficiencies of the prior art, the present application aims to further explore the susceptible genes in wheat targeted and manipulated by F. graminearum, and on the basis of understanding the disease susceptibility mechanism, to use CRISPR-Cas9 gene editing technology to modify the susceptible genes to destroy the disease susceptibility pathway and improve the disease resistance of wheat. The present application provides a new strategy for enriching disease-resistant and susceptible gene resources, improving crop resistance and creating disease-resistant materials.
[0005] In order to achieve the above purpose, the present application provides the following scheme:
[0006] The present application provides a wheat RING ubiquitin ligase protein gene TaRZFP34, the encoded protein of which is utilized by the core pathogenic secretory protein Osp24 of F. graminearum, targets and ubiquitinates the disease-resistant protein TaSnRK1a, and negatively regulates the resistance of wheat to scab. The wheat RING ubiquitin ligase protein gene TaRZFP34 has three copies in the wheat genome, which are located on chromosome 1A, chromosome 1B and chromosome 1D of the wheat genome, respectively.
[0007] The open reading frame of the TaRZFP34 gene on the 1A chromosome of the wheat genome has a nucleotide sequence as shown in SEQ ID NO: 1; the open reading frame of the TaRZFP34 gene on the 1B chromosome of the wheat genome has a nucleotide sequence as shown in SEQ ID NO: 2; and the open reading frame of the TaRZFP34 gene on the 1D chromosome of the wheat genome has a nucleotide sequence as shown in SEQ ID NO: 3.
[0008] In another aspect, the application provides an application of the wheat RING-type ubiquitin ligase protein gene TaRZFP34, which is inactivating the gene TaRZFP34 to improve the disease resistance of wheat to the Gibberella disease.
[0009] Further, the application is inactivating the gene TaRZFP34 by a gene editing technology to improve the disease resistance of wheat to the Gibberella disease.
[0010] Further, the gene editing technology includes the CRISPR-Cas9 gene editing technology.
[0011] Further, the application is inactivating the gene TaRZFP34 by transforming a CRISPR-Cas9 gene editing vector targeting the gene TaRZFP34 to a wheat plant to improve the disease resistance of wheat to the Gibberella disease.
[0012] Further, the CRISPR-Cas9 gene editing vector targeting the gene TaRZFP34 comprises a fragment for editing the gene TaRZFP34; the nucleotide sequence of the fragment is shown in SEQ ID NO: 7 and SEQ ID NO: 8.
[0013] Further, the pathogenic bacteria of the Gibberella disease include Fusarium graminearum.
[0014] In another aspect, the application provides a CRISPR-Cas9 gene editing vector comprising a fragment for editing the gene TaRZFP34, and the nucleotide sequence of the fragment is shown in SEQ ID NO: 7 and SEQ ID NO: 8.
[0015] In another aspect, the application provides a breeding method of a disease-resistant wheat variety, which is transforming the CRISPR-Cas9 gene editing vector to a wheat plant by using the Agrobacterium genetic transformation technology, and screening a wheat plant in which the TaRZFP34 genes on the 1A, 1B and 1D chromosomes are edited.
[0016] Further, the disease-resistant wheat is the Gibberella disease-resistant wheat.
[0017] The application has the following beneficial effects:
[0018] The application finds that the wheat RING-type ubiquitin ligase protein TaRZFP34 is utilized by the Fusarium graminearum core pathogenic secreted protein, targets and ubiquitinizes the disease resistance protein TaSnRK1a, and negatively regulates the resistance of wheat to scab. On this basis, the inventors further edit and transform the TaRZFP34 gene to lose its function by using the CRISPR-Cas9 gene editing technology, which effectively improves the resistance of wheat to scab, indicating that the wheat RING-type ubiquitin ligase gene TaRZFP34 can be used as a candidate gene for genetic improvement of wheat disease resistance, and provides a new idea for breeding wheat scab-resistant germplasm.
[0019] At present, there is no report on improving the resistance of wheat to scab by using disease genes. The present application takes Fusarium graminearum and wheat as the starting point, finds the wheat RING-type ubiquitin ligase protein TaRZFP34 targeted and manipulated by Fusarium graminearum, and transforms it. This provides a solution to the problem of lack of scab-resistant resources. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 is a gel electrophoresis result diagram of the wheat RING-type ubiquitin ligase protein gene TaRZFP34. Figure 1 The left side of the marker band is the Marker band, and the right side is the target gene band, and the size is 798 kd.
[0021] Figure 2 is a Western Blot result diagram of verifying the interaction of Osp24 and TaRZFP34 by in vivo immunoprecipitation (Co-IP) of tobacco. The protein expression of TaRZFP34 and Osp24 is detected by using GFP and mCherry antibodies. After TaRZFP34-GFP is enriched by GFP beads, Osp24-mCherry can be detected, and empty mCherry is not enriched, indicating that TaRZFP34 and Osp24 exist interaction relationship.
[0022] Figure 3 is a Western Blot result diagram of verifying the interaction of TaRZFP34 and TaSnRK1a by Co-IP experiment. The protein expression of TaRZFP34 and TaSnRK1a is detected by using GFP and mCherry antibodies. After TaRZFP34-GFP protein is enriched by GFP beads, TaSnRK1a-mCherry protein can be detected, and empty mCherry protein is not enriched, indicating that TaRZFP34 and TaSnRK1a interact in plants.
[0023] Figure 4Figure 6 is a Western Blot result diagram of the ubiquitination experiment in vivo of tobacco to verify that TaRZFP34 enhances the ubiquitination level of TaSnRK1a. The GFP beads were used to enrich the TaSnRK1a protein and its ubiquitination level was detected by GFP and ubiquitination antibody (UBI). After adding TaRZFP34, the ubiquitination band of TaSnRK1a protein was significantly stronger under the condition of enriching equal amount of TaSnRK1a protein in GFP beads.
[0024] Figure 5 Figure 7 is a schematic diagram of the result of TaRZFP34 gene editing vector. The maize ubiquitin promoter ZmUbi was used to drive the start of spCas9 gene, and gRNA1 and gRNA2 were respectively driven by TaU6.1 and TaU6.3.
[0025] Figure 6 Figure 8 is a gel electrophoresis result diagram of PCR amplification of TaRZFP34 gene editing strains in TaRZFP34 gene editing strains gRNA1 and gRNA2. "M" represents Marker; "L1-L8" represents 8 TaRZFP34 gene editing strains; "Fielder" represents wild type wheat material as a positive control.
[0026] Figure 7 Figure 9 is a wheat RING type ubiquitin ligase protein gene TaRZFP34 gene editing strain spike inoculation phenotype diagram and disease incidence statistics. Fielder represents wild type wheat material; TaRZFP34-KO represents wheat RING type ubiquitin ligase protein gene TaRZFP34 gene editing strain. DETAILED DESCRIPTION
[0027] In order to better understand the technical content of the present application, the present application will be further described below in combination with specific examples and drawings.
[0028] Example 1
[0029] This example describes the molecular cloning of wheat RING type ubiquitin ligase protein gene TaRZFP34 and the verification of the interaction with Osp24 secreted protein of Fusarium graminearum. Pathogenic secreted proteins often interfere or manipulate the function of key regulatory factors of host immune response to assist in infection. In identifying the host target targeted by Osp24, a core pathogenic secreted protein of Fusarium graminearum, during the process of infecting wheat, a RING type ubiquitin ligase protein TaRZFP34 was found.
[0030] In the Fielder wheat variety, the nucleotide sequences of three copies of the wheat RING ubiquitin ligase protein gene TaRZFP34 in the wheat genome are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, and the amino acid sequences of the encoded protein are shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively. The nucleotide sequence of the wheat RING ubiquitin ligase protein gene TaRZFP34 used in this embodiment is based on the sequence shown in SEQ ID NO:1, which encodes the amino acid sequence shown in SEQ ID NO:4.
[0031] Using Fielder wheat cultivar grown in soil under normal conditions in a greenhouse as material, Fusarium graminearum was inoculated into the wheat spike during the flowering stage. After 3 days, spikelets were harvested, total RNA was extracted, and it was reverse transcribed into cDNA as a template for PCR amplification.
[0032] Based on SEQ ID NO:1 of the wheat RING ubiquitin ligase protein gene TaRZFP34, specific primers TaRZFP34-F (5'ATGGATTTGGGAGCAGAGCAGC 3') and TaRZFP34-R (5'TCAGACTCTGGAGCACGCC 3') were designed. FastPfu DNA Polymerase (Beijing TransGen Biotech Co., Ltd.) was used to amplify the full-length coding sequence of the wheat RING ubiquitin ligase protein gene TaRZFP34 by PCR. The PCR reaction system is shown in Table 1.
[0033] Table 1. PCR reaction system for TaRZFP34 gene
[0034]
[0035] The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ for 30 sec, 58.5℃ for 40 sec, 72℃ for 1 min, 35 cycles; 72℃ extension for 10 min. Storage at 4℃. Gel electrophoresis results are shown below. Figure 1 As shown, the band size is as expected.
[0036] The PCR product was subjected to Sanger sequencing, which confirmed that the nucleotide sequence of the wheat RING ubiquitin ligase protein gene TaRZFP34 was consistent with SEQ ID NO:1, and the encoded amino acid sequence was consistent with SEQ ID NO:4.
[0037] Co-IP test was carried out in tobacco by means of Agrobacterium transient expression system to verify that the core pathogenic secretory protein Osp24 of F. graminearum targets the wheat RING ubiquitin ligase protein TaRZFP34. Figure 2 TaRZFP34-GFP and Osp24-mCherry were co-expressed in tobacco as an experimental group, and TaRZFP34-GFP and empty mCherry were co-expressed as a control group. After the TaRZFP34-GFP protein was enriched by GFP-beads (Tian Di Renhe Biotechnology Co., Ltd.), Osp24-mCherry could be detected, while empty mCherry was not enriched, indicating that Osp24 interacts with TaRZFP34 in tobacco.
[0038] Example 2
[0039] This example describes that the wheat RING ubiquitin ligase protein TaRZFP34 targets ubiquitination modification of the disease resistance protein TaSnRK1a.
[0040] TaSnRK1a is a positive regulator of wheat scab resistance. Co-IP test in tobacco as described in Example 1 showed that TaRZFP34 also interacts with TaSnRK1a. The results are shown in Figure 3 .
[0041] E3 ubiquitin ligase promotes protein degradation by ubiquitinating substrates. In combination with Agrobacterium transient expression technology, ubiquitination experiments were carried out in tobacco to determine that TaRZFP34 can enhance the ubiquitination level of TaSnRK1a. As shown in Figure 4 , after adding the proteasome inhibitor Mg132 to inhibit protein degradation, the ubiquitination band of TaSnRK1a protein enriched by GFP-beads was detected using ubiquitin antibody (Ubiquitin Rabbit Polyclonal Antibody, Biyun Tian Biotechnology Co., Ltd.). Compared with the empty control, after adding TaRZFP34, the ubiquitination band of TaSnRK1a became stronger, indicating that TaRZFP34 enhances the ubiquitination level of TaSnRK1a in plants.
[0042] Example 3
[0043] This example describes the construction of the wheat RING ubiquitin ligase protein gene TaRZFP34 gene editing vector and the obtaining of the gene editing plant.
[0044] Through sequence analysis, two gRNAs (gRNA1 5'GCTGCGAGCATTACACGAGG 3', gRNA2 5'TAGCTTGGTTATGGCAATGC 3') targeting the conserved region of the RING class ubiquitin ligase protein gene TaRZFP34 on the 1A, 1B and 1D chromosomes of wheat were designed, and the primer sequences gRNA1-F (5'GCTGCGAGCATTACACGAGG 3', SEQ ID NO: 9) and gRNA1-R (5'CCTCGTGTAATGCTCGCAGC 3', SEQ ID NO: 10) of gRNA1 and the primer sequences gRNA2-F (5'TAGCTTGGTTATGGCAATGC 3', SEQ ID NO: 11) and gRNA2-R (5'GCATTGCCATAACCAAGCTA 3', SEQ ID NO: 12) of gRNA2 were synthesized by Sheng Wu Bioengineering Co., Ltd. After diluting gRNA1-F and gRNA1-R to 100 mM, the dimerization reaction of the gRNA1 primer was carried out according to Table 2, and the treatment method was: boiling water bath for 10 min, cooling at room temperature for 1-2 h. The dimerization reaction method of gRNA2 primer is the same as that.
[0045] Table 2. gRNA1 dimerization reaction system
[0046] Components Volume gRNA1-F primer 2 μl gRNA1-R primer 2 μl 1 x TE 8 μl ddH2O 10 μl
[0047] The gRNA1 dimerization product was constructed into the pENTR4 intermediate vector using BtgZI restriction endonuclease to cut the pENTR4 intermediate vector, and T4 DNA Ligase (Bodipy Biotechnology Co., Ltd.) was used according to Table 3, and the treatment method was: 16°C reaction for 12-16 h. The gRNA1-pENTR4 vector was obtained.
[0048] Table 3. gRNA1 and pENTR4 T4 ligation reaction system
[0049] Components Volume gRNA1-F primer 2 μl gRNA1-R primer 2 μl 1 x TE 8 μl ddH2O 10 μl
[0050] Similarly, the gRNA1-pENTR4 vector was cut using BsaI restriction endonuclease, and the gRNA2 dimerization product was constructed into the gRNA1-pENTR4 vector according to Table 4 to obtain the gRNA1-gRNA2-pENTR4 vector.
[0051] Table 4. gRNA2 and gRNA1-pENTR4 T4 ligation reaction system
[0052]
[0053]
[0054] Utilizing LR Clonase TM II enzyme mix (Invitrogen), the core elements in gRNA1-gRNA2-pENTR4 vector were cloned into gene editing vector Cas9 using Gateway cloning technology to obtain gRNA1-gRNA2-Cas9 vector, and the structure of the vector is shown in Figure 5 .
[0055] The gRNA1-gRNA2-Cas9 vector plasmid was transformed into Agrobacterium, and immature wheat embryos edited by TaRZFP34 were obtained by Agrobacterium genetic transformation using Fielder wheat as the receptor. After single plant transplanting, rooting and regeneration, T0 generation regenerated plants were obtained. The genomic DNA of the T0 generation regenerated plants was extracted, and sequencing primers gRNA-check-F (5'GGAGTGAGTACGGTGTGCCTGATTCGTGGTTTCCGGGTG 3', SEQ ID NO: 13) and gRNA-check-F (5'GAGTTGGATGCTGGATGGGCGAAATCGCGCGGCATGG 3', SEQ ID NO: 14) were designed near the editing target gRNA1 and gRNA2 of TaRZFP34. The leaf DNA was PCR amplified, and the gel electrophoresis detection results are shown in Figure 6 . The amplification product was sent to the Hi-TOM platform (China National Rice Research Institute, Chinese Academy of Agricultural Sciences) for sequencing. T1 generation plants in which the wheat RING ubiquitin ligase protein gene TaRZFP34 on chromosomes 1A, 1B and 1D were all edited were selected for analysis of resistance to scab.
[0056] Example 4
[0057] This example describes the identification of the resistance of wheat RING ubiquitin ligase protein gene TaRZFP34 gene edited wheat to scab.
[0058] The pathogenicity of the wild type strain PH-1 of Fusarium graminearum was selected, and the single flower drop injection method was used to inoculate the wheat spike of the above obtained TaRZFP34 gene edited plant (TaRZFP34-KO) and wild type Fielder wheat plant at the flowering stage. After 12 days of inoculation, the disease incidence was recorded by taking pictures, and the number of diseased grains was calculated to compare the resistance of the two to scab. The results are shown in Figure 7 . Compared with the wild type Fielder wheat plant, the number of diseased spikes of the TaRZFP34 gene edited wheat plant was significantly reduced after inoculation with the wild type strain PH-1 of Fusarium graminearum. The number of diseased grains was counted, and the results are shown in Figure 7As shown (right panel), the number of diseased kernels of TaRZFP34 gene edited wheat plants was reduced by about 60% compared to Fielder. This indicates that the deletion of the wheat RING E3 ubiquitin ligase protein gene TaRZFP34 can significantly improve the resistance of wheat to scab.
[0059] The above merely illustrates some embodiments of the present application, and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall fall within the protection scope of the present application.
Claims
1. A method of increasing the resistance of wheat to scab, characterized in that, The nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3 were all edited using gene editing technology. The nucleotide sequence shown in SEQ ID NO:1 is located on wheat chromosome 1A. TaRZFP34 The gene, SEQ ID NO:2, shows a nucleotide sequence on wheat chromosome 1B. TaRZFP34 The gene, SEQ ID NO:3, shows a nucleotide sequence on wheat chromosome 1D. TaRZFP34 Genes, making the TaRZFP34 All genes are inactivated, thereby enhancing wheat's resistance to Fusarium head blight; the pathogen of Fusarium head blight is Fusarium graminearum.
2. The method of claim 1, wherein, The gene editing technology includes a CRISPR-Cas9 gene editing technology.
3. The method of claim 1, wherein, By targeting TaRZFP34 The CRISPR-Cas9 gene-editing vector was transformed into wheat plants, enabling the aforementioned gene to be edited. TaRZFP34 Gene inactivation enhances wheat's resistance to Fusarium head blight.
4. The method of claim 3, wherein, The targeting TaRZFP34 The CRISPR-Cas9 gene editing vector of the gene comprises a fragment for editing the gene; the nucleotide sequence of the fragment is shown as SEQ ID NO: 7 and SEQ ID NO:
8. TaRZFP34 The CRISPR-Cas9 gene editing vector of the gene comprises a fragment for editing the gene; the nucleotide sequence of the fragment is shown as SEQ ID NO: 7 and SEQ ID NO:
8.
5. A method of breeding a scab resistant wheat variety, characterized by, Using Agrobacterium genetic transformation technology, the CRISPR-Cas9 gene editing vector is transformed into a wheat plant, and a wheat plant in which the genes on the 1A, 1B and 1D chromosomes are all inactivated is screened out; the nucleotide sequence of the gene on the 1A chromosome of the wheat is as shown in SEQ ID NO:1, the nucleotide sequence of the gene on the 1B chromosome of the wheat is as shown in SEQ ID NO:2, and the nucleotide sequence of the gene on the 1D chromosome of the wheat is as shown in SEQ ID NO:
3. TaRZFP34 TaRZFP34 TaRZFP34 TaRZFP34 The CRISPR-Cas9 gene editing vector comprises a fragment for editing the gene of claim 1, the nucleotide sequence of the fragment being as shown in SEQ ID NO: 7 and SEQ ID NO:
8. TaRZFP34 The CRISPR-Cas9 gene editing vector comprises a fragment for editing the gene of claim 1, the nucleotide sequence of the fragment being as shown in SEQ ID NO: 7 and SEQ ID NO:
8. The pathogenic bacteria of the scab is Fusarium graminearum.