Method for synthesizing citicoline by using biological enzyme

Abstract

The invention discloses a method for synthesizing citicoline by a biological enzyme, and belongs to the technical field of biosynthesis. According to the process, cytidine monophosphate, choline chloride phosphate calcium salt and acetyl diammonium phosphate are used as raw materials, and the target product citicoline is synthesized under the catalytic action of cytidine monophosphate kinase and cytidylphosphorylcholine transferase. Compared with other processes, the method has the advantages that the acetyl diammonium phosphate and the choline chloride phosphate calcium salt are used as raw materials for synthesis reaction, the concentration of the produced target product reaches 89.26 g / L, and the synthesis process is simple, easy to operate and easy to industrialize and has obvious market competitiveness.

Description

Technical Field

[0001] The invention relates to the field of biochemical engineering, and in particular to the field of enzyme-catalyzed synthesis of citicoline. Background Art

[0002] Cytidine Diphosphate Choline (CDPC) is an important intermediate in the biosynthesis of lecithin. Its sodium salt is white or off-white powder, odorless and hygroscopic. It is easily soluble in water, but insoluble in ethanol, acetone and chloroform. It belongs to the nucleoside compound with a boiling point of 851.4℃at 760mmHg and a molecular formula of C 14 H 26 N 4 O 11 P 2 , molecular weight 488.324, mainly used for metabolic disorders after craniocerebral trauma and brain surgery, impaired consciousness, tremor paralysis, neurological deafness and tinnitus, as well as sleeping pill poisoning. It also has good therapeutic effects on Parkinson's syndrome and hemiplegia caused by cerebral thrombosis. In the brain, citicoline is a precursor of an important neurotransmitter, acetylcholine, which plays a key role in memory and learning. Therefore, citicoline is believed to be helpful in improving memory and cognitive function.

[0003] In the 1950s, Kennedy et al. discovered Citicoline, which was then chemically synthesized and its molecular structure determined. In 1957, Rossiter discovered that Citicoline is closely related to phospholipid metabolism and is an important coenzyme in the biosynthesis of phosphatidylcholine (lecithin). Research and development of Citicoline as a neuroprotective drug began in 1963, when Nicholin (Citicoline) was first developed by Takeda Company of Japan and successfully used to treat disorders of consciousness.

[0004] Its synthesis method is mainly chemical synthesis: using CMP (5'-cytidylic acid) and choline phosphate as reactants, p-toluenesulfonyl chloride as a condensing agent, and condensing into sodium cytidine diphosphate choline in the presence of N-dimethylformamide. The disadvantages of chemical synthesis are low reaction conversion rate, high production cost, many by-products, and easy to cause environmental pollution. Microbial fermentation method: using yeast or ammonia-producing bacteria and other microorganisms to utilize glucose, and adding CMP and other pre-fermented products to generate sodium cytidine diphosphate choline. The disadvantages are low product concentration and unstable yield. Enzymatic synthesis method: extracting cell fluid and using cytidine triphosphate and choline phosphate to biosynthesize sodium cytidine diphosphate choline, but the substrate CTP is required, resulting in a high synthesis cost. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a method for synthesizing citicoline by bioenzymatic method. The method uses cytidylic acid, calcium chloride phosphorylcholine salt, and diammonium acetylphosphate as raw materials, and reacts to obtain citicoline under the catalysis of cytidylic acid kinase and cytidylic acid phosphorylcholine transferase. The raw materials required by the process are widely available, cheap, simple in reaction steps, high in yield, and mild in reaction process.

[0006] The invention discloses a method for synthesizing citicoline by bioenzymatic method, comprising the following steps: using cytidylic acid, calcium chloride phosphorylcholine salt and diammonium acetylphosphate as raw materials, reacting under the catalysis of cytidylic acid kinase and cytidylic acid phosphorylcholine transferase to obtain citicoline.

[0007] Furthermore, in the above technical solution, the sequence of the cytidine kinase is the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing.

[0008] SEQ ID NO.1

[0009] ATGACGGCAATTGCCCCGGTTATTACCATTGATGGCCCAAGCGGGTGCAGGGAAAGGCACCTTG

[0010] TGTAAGGCTATGGCGGAAGCGTTGCAATGGCATCTGCTGGACTCGGGTGCAATTTATCGCGTAC

[0011] TGGCATTGGCGGCATTACATCACCATGTTGATGTTGCGTCGGAAGATGCGCTGGTACCGCTGGC

[0012] ATCCCATCTGGATGTACGTTTTGTGTCGACCAATGGCAATCTGGAAGTGATCCTCGAAGGGGAA

[0013] GATGTCAGCGGCGAAATTCGTACTCAGGAAGTGGCGAATGCAGCTTCACAAGTCGCGGCATTC

[0014] CCACGCGTTCGTGAAGCATTATTGCGTCGCCAACGCGCGTTTCGCGAATTACCAGGTCTGATTG

[0015] CCGATGGCCGCGACATGGGAACGGTGGTATTCCCTGATGCACCAGTGAAAATTTTCCTTGACGC

[0016] CTCCTCGGAAGAACGTGCGCATCGCCGCATGCTACAGTTGCAGGAGAAGGGCTTTAGTGTTAA

[0017] CTTTGAGCGCCTTTTTGGCCGAGATCAAAGAACGCGACGACCGCGATCGTAACCGAGCGGTAGC

[0018] GCCACTGGTTCCGGCAGCCGATGCTTTAGTGTTGGATTCCACCACCTTAAGCATTGAGCAAGTG

[0019] ATTGAAAAAGCGCTACAATACGCGCGCCAGAAATTGGCTCTCGCATAA

[0020] Furthermore, in the above technical solution, the sequence of the cytidylylphosphocholine transferase is the nucleotide sequence shown in SEQ ID NO.2 in the sequence table.

[0021] SEQ ID NO.2

[0022] ATGGTAGTTAAAGTACGTTCGGTTCAAAACTTGGAGGTAAAAATTAAAAAAAATTCGTGAACT

[0023] TAAGAATATTTCCTTTTTAACATTTGTATATTGCATGAACAGTTTTTGATAAATATATGTAAATT

[0024] TTATTTTAAAAATAAAAATTATAAAAATATTATTTACAAGTATTTTCATTTACAAAAATATAAG

[0025] GGTATTTATCAATAAAAAAAAAAATGTACAGATTTATTTGAAAATTTTTTTTTTACTTGTATAAA

[0026] TATCTTAATAAAATATGTATTTATTTTATTGGATTCTATTTTTTTTATTAAATTTATCATTTCTAA

[0027] ATACTATATGCACATAAACGTATTTTAAGATAACTTTTTTTGTTACATCAATAAATATTTTAATT

[0028] TTAGAACCAAGACCCTGAACTTTTTATTAATGGAAATTTAAATAATGAAAATAGGAGCGAACA

[0029] AACTATAAGAATATATGCAGATGGTAAAAAAAAAAATAAAAAATAAATAAATAAATAATAAA

[0030] ATAAAAAATAGAAATAAATTTTATGGTAGAATAACGACTTTTTTTTTAAAAAAAAATGTATTATT

[0031] TTTCATTTAGGTGTTTATGACCTTCTACATTTAGGTCATATGAAACAGCTAAAACAAGCAAAAT

[0032] ATATGGAAAAAAATGTCACTTTAATTGTAGGAGTATCTAGTGATTATGAAACAAAAAAATTCA

[0033] AAGGTCAAATTGTTCAATCATTAGAAGAAAGAACTGAAACATTAAAAACATATTCGATGGGTAG

[0034] ATGAAATAATTTCACCTTGCCCATGGATAATTACACCTGAGTTTATGGAAGAGCATAAAATTGA

[0035] TTACGTTGCTCATGATGATATACCATATACTAATAATCAAAAAAAAAAAAAAAAAAAAAAAA

[0036] AAGTAAATCAAATAATAACGAAGATGCAAACGATGATGTATATGCTTGGTTAAAAAAAAGCAGG

[0037] AAAATTTAAAGCTACTCAGAGAACAGAAGGAGTATCTACAACGGATTTAATTGTAAGAATATT

[0038] AAAAAACTATGAAGATTATATAGAAAGATCACTGCAAAGAGGTATACACCCGAATGAGTTGAA

[0039] TTAGGTGTAAAAAAAAAATTAGATGAATGAAAAAAATTAATTAGATGGGGGGAGA

[0040] AAGTTACTACHATTAACAAAAGTAACACTCHAPTERAGCCTTTGGGTACHAPTERTTTCGATC

[0041] AAGGATAGATATATAGAGATAAAGTGCATGGATTATTAGCTGGAGATATCACTCAA

[0042] AAAAACTTTTAAAGATTTTGCAAAATCATTTGACCCTATGTTTATTGATTAGAAAAAAAAG

[0043] TAAAAAGATATTTCAATATGTATTTCTGATTCTAATTATTTGTCAATAGTGAAA

[0044] GATCAAAAAAAAAAAAATATATATATTAGATTCCTTCATAGTTGTTGATTATATTATTATT

[0045] CTGCCGATGAGATTGCCCTAGGGTTAATATGTTTTTAGTGTAATAAGTAAAAATTGCTAATGA

[0046] TTCATATATATAGCHATTGATTACTATGAAACATGTTTTGATTATAGTGTGCCTTAGAT

[0047] AAAAAAAAAAAAAAAAAAATTGATTTAACCTGACGAAATGATTGATTTCATTGAT

[0048] CCTTTGGATGTAAAAAAAATGAGGAATATATAGTAATGATGAATAAATGAGATATTAGAATTA

[0049] AATAAAAATATTATTAAAAAATTATTATTATCATCHATAAAAAATTATTATCAT

[0050] GATGCAAATGATGGAAAATATCATACTTTAGGTAGTAGAAAAAACAATATTGATTATAAAAAT

[0051] AGTAATAAGGAAAATAACATTAACAATAATAATAATGATAAAGATGATTATAAAAGTTGTGTG

[0052] GATGTTTATATGGATAATAAATATAATCACATTATTTTAAATAAAAAATATAGTAATAGTGAAG

[0053] ACACAATAAAAAAGAGTGAAGTAATAAAAGTAACTAACTTAATTAATAAA

[0054] Furthermore, in the above technical solution, the reaction temperature is 25-35°C, and the reaction is carried out under the condition of pH=6.0-8.0.

[0055] Further, in the above technical solution, the reaction is carried out in Mg 2+ Under the existing conditions.

[0056] Furthermore, in the above technical solution, cytidylate kinase is prepared by activating the strain to prepare a seed solution, which is inoculated into a fermentation tank at an inoculation rate of 2-10%, and then subjected to continuous flow high-density fermentation culture.

[0057] Furthermore, in the above technical solution, the preparation of cytidylylphosphocholine transferase is as follows: the strain is activated to prepare a seed solution, which is inoculated into a fermentation tank at an inoculation amount of 2-10%, and a continuous flow high-density fermentation culture is performed.

[0058] Furthermore, in the above technical solution, the entire synthesis process specifically includes the preparation of cytidylate kinase, the preparation of cytidylylphosphocholine transferase, and a coupled conversion reaction.

[0059] Furthermore, in the above technical solution, the cytidine monophosphate is 80-100 g / L, the acetyl phosphate diammonium salt is 100-200 g / L, the phosphorylcholine chloride calcium salt is 100-200 g / L, and the magnesium chloride is 1-5.5 g / L.

[0060] Furthermore, in the above technical solution, the diammonium acetylphosphate is a liquid reagent.

[0061] Furthermore, in the above technical solution, the forms of the cytidylate kinase and cytidylic acid choline transferase include but are not limited to enzyme solution, enzyme lyophilized powder, enzyme-containing cells, and various immobilized enzymes and immobilized enzyme cells. For example, they can also be in the form of unpurified crude enzymes, partially purified or completely purified forms.

[0062] Beneficial effects of the present invention

[0063] 1. Biotransformation reaction substrate

[0064] The substrate for the biotransformation synthesis of Citicoline is cytidylic acid, and the substrate raw materials are acetyl phosphate diammonium salt and phosphorylcholine chloride calcium salt, which greatly reduces the production cost.

[0065] 2. Conversion reaction system

[0066] The reaction system used in this process to synthesize the target product cytidine diphosphate is a direct bioconversion reaction using purified water as the reaction system, which is low-cost, environmentally friendly, easy to operate, and easy to industrialize.

[0067] 3. High production efficiency

[0068] This synthesis technology uses purified water as solvent and does not require a buffer system to directly carry out biotransformation reactions to synthesize the product, citicoline. Compared with literature reports, the accumulation concentration of the target product of this process is high, with CDPC reaching 89.26 g / L in the synthetic liquid. The process is simple, the raw material source is convenient, the cost is low, the production cycle is short, the product yield is high, the operability is strong, and it is easy to industrialize. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 The reaction flow chart of the co-catalytic reaction of two enzymes to obtain citicoline in the present invention;

[0070] Figure 2 is the relationship between temperature and citicoline conversion rate;

[0071] Figure 3 is the relationship diagram between pH value and citicoline conversion rate;

[0072] Figure 4 This is the high performance liquid chromatography detection spectrum of the citicoline reaction system. Specific embodiments

[0073] Example 1 Preparation of Cytidylate Kinase

[0074] The CMK bacteria in the glycerol tube were streaked onto the LB solid plate, and the monoclonal colony was picked and streaked again to obtain the pure CMK strain. The CMK strain was picked and inoculated into the LB liquid culture medium and cultured at 37°C and 200rpm for 6h. The activated bacterial solution was transferred to the secondary culture medium at a 2% inoculation volume and cultured at 37°C and 200rpm until the bacterial concentration OD 600 =0.6, and then inoculated into a 4L fermenter at a 10% inoculation amount, and the bacterial concentration OD 600 =16, the inducer IPTG was added, and after 8h of induction culture, 236g of CMK wet bacteria were collected by centrifugation.

[0075] Example 2 Preparation of cytidylylphosphocholine transferase

[0076] The CTT bacteria in the glycerol tube were streaked onto the LB solid plate, and the monoclonal colony was picked and streaked again to obtain the pure CTT strain. The CTT strain was picked and inoculated into the LB liquid medium and cultured at 37°C and 200 rpm for 6 hours. The activated bacterial solution was transferred to the secondary culture medium at a 2% inoculation volume and cultured at 37°C and 200 rpm until the bacterial concentration OD 600 =0.6, and then inoculated into a 4L fermenter at a 10% inoculation amount, and the bacterial concentration OD 600 =16, the inducer IPTG was added, and after 8h of induction culture, 250g of CTT wet bacteria were collected by centrifugation.

[0077] Example 3 Temperature Optimization Reaction

[0078] According to the substrate ratio, accurately weigh: 3g of cytidine, 4g of diammonium acetylphosphate, 4g of calcium choline chloride, and 0.165g of magnesium chloride, adjust the pH to 7.2 with alkali, add 0.6g of CMK enzyme and 0.6g of CTT enzyme, and dilute to 30mL with purified water. React at 20, 30, 40, 50, and 60℃ for 3-9h, and detect the amount of CDPC generated by HPLC. Finally, it was determined that the amount of CDPC generated was better at a reaction temperature of 30℃ ( Figure 2 ), the amount of citicoline produced reached 53.66 g / L at 7 h, and the substrate molar conversion rate was 38.77%.

[0079] Example 4 pH Optimization Reaction

[0080] According to the substrate ratio, accurately weigh: 3g of cytidylic acid, 4g of diammonium acetylphosphate, 4g of calcium choline chloride, and 0.165g of magnesium chloride. Use alkali to adjust the pH to 5.0, 6.0, 7.0, 8.0, and 9.0, respectively. Add 0.6g of CMK enzyme and 0.6g of CTT enzyme, and adjust the volume to 30mL with purified water. Stir the reaction at 30°C and 500rpm for 3-9h, and detect the amount of CDPC produced by HPLC. Finally, it was determined that the conversion rate of the product CDPC reached 45.75% and 46.21% at pH 6.0 and 7.0, and the substrate concentration reached 62.2g / L and 63.7g / L. It is significantly higher than other pH levels, that is, the reaction effect is best when the initial pH of the reaction is in the range of 6.0-7.0 ( Figure 3 ).

[0081] Example 5 3L Amplification Reaction

[0082] According to the substrate ratio, accurately weigh: 300 g of cytidylic acid, 16.5 g of magnesium chloride, 600 g of acetyl phosphate diammonium salt, and 600 g of phosphorylcholine chloride calcium salt, adjust the pH to 7.2 with alkali, add 60 g of CMK enzyme and 60 g of CTT enzyme respectively in proportion, and adjust the volume to 3 L with purified water.

[0083] The reaction was carried out at 30°C for 9-12 hours, and the amount of CDPC generated was detected by high performance liquid chromatography ( Figure 4 ). Finally, after the reaction lasted for 10 hours, the highest Citicoline concentration was 82.33 g / L, and the substrate molar conversion rate could reach 80%.

[0084] Example 6 100L Amplification Reaction

[0085] According to the substrate ratio, accurately weigh: 10 kg of cytidylic acid, 0.55 kg of magnesium chloride, 20 kg of acetyl phosphate diammonium salt, and 20 kg of phosphorylcholine chloride calcium salt. Adjust the pH to 7.2 with alkali, add 2 kg of CMK enzyme and 2 kg of CTT enzyme in proportion, and adjust the volume to 100 L with purified water.

[0086] The reaction was carried out at 30°C for 9-12 hours, and the amount of CDPC produced was detected by high performance liquid chromatography. Finally, the reaction was carried out for 10 hours, and the highest concentration of Citicoline was 89.26 g / L, and the substrate molar conversion rate could reach 83%.

[0087] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A method for synthesizing citicoline by bioenzyme, characterized in that: The method comprises the following steps: using cytidylic acid, acetyl phosphate diammonium salt and choline chloride calcium salt as raw materials, reacting under the catalysis of cytidylic acid kinase and cytidylic acid choline phosphorylation transferase to prepare citicoline.

2. The method for synthesizing citicoline by bioenzyme according to claim 1, characterized in that: The sequence of the cytidylate kinase is the nucleotide sequence shown in SEQ ID NO.

1.

3. The method for synthesizing citicoline by bioenzyme according to claim 1, characterized in that: The sequence of the cytidylylphosphocholine transferase is the nucleotide sequence shown in SEQ ID NO.

2.

4. The method for synthesizing citicoline by bioenzyme according to claim 1, characterized in that: The preparation of cytidylate kinase is as follows: after the strain is activated, a seed solution is prepared, and the seed solution is inoculated into a fermentation tank at an inoculation amount of 2-10%, and continuous flow high-density fermentation culture is performed.

5. The method for synthesizing citicoline by bioenzyme according to claim 1, characterized in that: The preparation of cytidine acylphosphocholine transferase is as follows: the bacterial strain is activated to prepare a seed solution, which is inoculated into a fermentation tank at an inoculation amount of 2-10%, and continuous flow high-density fermentation culture is performed.

6. The method for synthesizing citicoline by bioenzyme according to claim 1, characterized in that: The entire synthesis process specifically includes the preparation of cytidylate kinase, the preparation of cytidylylphosphocholine transferase, and a coupling conversion reaction.

7. The method for synthesizing citicoline by bioenzyme according to claim 1, characterized in that: The reaction temperature is 25-35°C and the reaction is carried out under the condition of pH=6.0-8.

0.

8. The method for synthesizing citicoline by bioenzyme according to claim 1, characterized in that: The reaction was carried out in Mg 2+ Under the existing conditions.

9. The method for synthesizing citicoline by bioenzyme according to claim 1, characterized in that: Cytidine 80-100g / L, magnesium chloride 1-5.5g / L, cytidylate kinase 2-20g / L, cytidylylphosphocholine transferase 2-20g / L, acetylphosphate diammonium salt 100-200g / L, phosphorylcholine chloride calcium salt 100-200g / L.

Images