ELISA (enzyme-linked immunosorbent assay) detection kit for bovine nodular skin disease virus P32 protein obtained based on eukaryotic cell expression system and application of ELISA detection kit

Abstract

The invention belongs to the technical field of immunodetection, and particularly relates to an ELISA (enzyme-linked immunosorbent assay) detection kit for bovine nodular skin disease virus P32 protein obtained based on a eukaryotic cell expression system and application of the ELISA detection kit. The P32 protein obtained on the basis of eukaryotic expression has good antigenicity, so that the ELISA kit and the ELISA detection method which are established on the basis of the P32 protein and are used for detecting the bovine nodular skin disease virus have the characteristics of sensitivity, specificity and high efficiency, the operation is simple, the consumed time is short, the cost is low, cattle infected by the bovine nodular skin disease virus (LSDV) can be detected in a high-throughput manner, and the kit and the method have good application prospects. The kit is suitable for large-scale epidemiological investigation and the like, and a simple and effective diagnostic tool is provided for veterinary clinical diagnosis.

Description

Technical Field

[0001] The invention belongs to the technical field of immune detection, and specifically relates to an ELISA detection kit for bovine nodular dermatosis virus P32 protein obtained based on a eukaryotic cell expression system and an application thereof. Background Art

[0002] Bovine lumpy skin disease (LSD) is a highly contagious bovine viral disease caused by the bovine lumpy skin disease virus (LSDV). Its main clinical symptoms include fever, formation of necrotic skin nodules, systemic lymphadenitis, swelling of the limbs, and damage to the eyes and mucous membranes of the respiratory, reproductive and digestive organs. Currently, LSD is prevalent worldwide and poses a serious threat to the cattle industry and related industries. Therefore, accurate, rapid and efficient diagnosis of LSD is the basis for the successful control and eradication of LSD.

[0003] Currently, a variety of conventional laboratory diagnostic techniques have been used for the detection of LSDV, including virus isolation, culture and identification, polymerase chain reaction (PCR), fluorescence quantitative PCR, protein blot analysis and virus neutralization test (VNT). However, the above methods have the disadvantages of long experimental cycles, strict operation requirements and being unfavorable for promotion at the grassroots level, and cannot meet the needs of high-throughput detection of LSDV. The World Organization for Animal Health (WOAH) recommends the use of ID vet's ELISA kit (ID The sheep pox Doμble Antigen multi-component ELISA) can be used for serological diagnosis, which can be used to detect sheep pox virus-specific antibodies in serum, plasma and milk samples of goats, sheep and cattle, with a specificity of 99.7% compared with VNT. However, the kit is expensive and it is difficult to produce the large amount of whole virus antigen required for serological testing. In addition, there are many quality control issues related to the production of whole virus antigens.

[0004] P32 protein is a major structural protein located on the surface of the LSDV envelope, containing major antigenic epitopes and strong immunogenicity. At present, P32 protein is one of the most immunogenic LSDV proteins that have been discovered. Establishing an ELISA method with P32 protein as an antigen is an important prerequisite for LSDV serological monitoring. However, due to the strong hydrophobicity of P32 protein, the P32 protein obtained by the existing prokaryotic expression technology mostly exists in the form of inclusion bodies, the amount of soluble protein is small, the processing process of the expression product is complicated, and the purity is insufficient, which affects its biological application. As a result, the ELISA detection method using P32 protein as a coating antigen has low detection sensitivity and poor specificity, and is prone to false positive detection problems, which makes the industrialization of ELISA kits based on P32 protein one of the technical bottlenecks. Summary of the invention

[0005] The object of the present invention is to provide an ELISA detection kit for bovine nodular dermatitis virus P32 protein obtained based on a eukaryotic cell expression system and its application. The ELISA detection kit has high detection sensitivity and specificity and accurate detection results.

[0006] The present invention provides the use of one or more of the following four items in preparing an ELISA kit for detecting bovine nodular skin disease virus:

[0007] 1) Bovine lumpy skin disease virus P32 protein obtained based on eukaryotic cell expression system;

[0008] 2) a eukaryotic expression cassette containing a nucleotide sequence encoding the bovine nodular skin disease virus P32 protein;

[0009] 3) a eukaryotic expression vector containing a nucleotide sequence encoding the bovine nodular skin disease virus P32 protein;

[0010] 4) a eukaryotic engineered cell containing the nucleotide sequence encoding the bovine nodular skin disease virus P32 protein, the eukaryotic expression cassette described in 2) or the expression vector described in 3);

[0011] The amino acid sequence of the bovine nodular dermatitis virus P32 protein is shown in SEQ ID NO:1.

[0012] Preferably, the nucleotide sequence of the eukaryotic expression cassette is as shown in SEQ ID NO:2.

[0013] Preferably, the initial cells in the eukaryotic engineering cells include CHO-K1 cells; and the initial vector in the eukaryotic expression vector is a plasmid vector.

[0014] Preferably, the ELISA kit comprises an indirect ELISA kit.

[0015] The present invention also provides an indirect ELISA kit for detecting bovine nodular skin disease virus. The indirect ELISA kit uses the bovine nodular skin disease virus P32 protein obtained based on a eukaryotic cell expression system as a coating antigen; the amino acid sequence of the bovine nodular skin disease virus P32 protein is shown in SEQ ID NO: 1.

[0016] Preferably, the indirect ELISA kit further comprises one or more of an enzyme-labeled plate, a blocking solution, a sample diluent, a washing solution, a negative control, a positive control, an enzyme-labeled secondary antibody, a color developing solution and a stop solution.

[0017] Preferably, the blocking solution includes skim milk; the sample diluent includes PBST buffer containing 1% skim milk; the washing solution includes PBST buffer; the enzyme-labeled secondary antibody includes rabbit anti-bovine IgG labeled with horseradish peroxidase; the color developing solution includes TMB color developing solution; the stop solution includes sulfuric acid solution, and the concentration of the sulfuric acid solution is 2M.

[0018] The present invention also provides the use of the indirect ELISA kit described in the above technical solution in the preparation of a diagnostic product for bovine nodular dermatosis.

[0019] The present invention also provides a method for detecting bovine nodular dermatitis virus for non-diagnostic purposes based on the indirect ELISA kit described in the above technical solution, comprising the following steps:

[0020] 1) The bovine nodular skin disease virus P32 protein obtained based on the eukaryotic cell expression system is coated on an ELISA plate;

[0021] 2) blocking and washing the coated ELISA plate to obtain a blocked ELISA plate;

[0022] 3) diluting the test sample serum and the negative control serum with diluent, respectively, and adding them to the blocked ELISA plate, incubating and washing, respectively, to obtain a primary ELISA plate;

[0023] 4) diluting the enzyme-labeled secondary antibody with a diluent and adding it to the primary enzyme-labeled plate strip for incubation and washing to obtain an intermediate enzyme-labeled plate containing the secondary antibody;

[0024] 5) adding the color developing solution to the intermediate ELISA plate containing the secondary antibody to develop color in the dark, thereby obtaining a color developing ELISA plate;

[0025] 6) Add the stop solution to the colorimetric plate to stop the color development, and measure the OD of the diluted sample and the negative control respectively. 450nm The absorbance value at the position is used to determine the result:

[0026] When the OD of the diluted sample 450nm ≥ negative control mean + negative control standard deviation × 3, the sample is judged to be positive. 450nm It is considered negative when the value is less than the standard deviation of negative control × 3 + the mean value of negative control.

[0027] Preferably, the coating concentration of the bovine nodular dermatitis virus P32 protein obtained based on the eukaryotic cell expression system is 1-10 μg / mL; the dilution factor of the test sample serum is 1:(100-1000); and the dilution factor of the enzyme-labeled secondary antibody is 1:(1000-10000).

[0028] Beneficial effects:

[0029] The present invention provides the use of one or more of the following four items in preparing an ELISA kit for detecting bovine nodular skin disease virus: 1) a bovine nodular skin disease virus P32 protein obtained based on a eukaryotic cell expression system; 2) a eukaryotic expression cassette containing a nucleotide sequence encoding the bovine nodular skin disease virus P32 protein; 3) a eukaryotic expression vector containing a nucleotide sequence encoding the bovine nodular skin disease virus P32 protein; 4) a eukaryotic engineered cell containing a nucleotide sequence encoding the bovine nodular skin disease virus P32 protein, containing the eukaryotic expression cassette described in 2) or containing the expression vector described in 3); the amino acid sequence of the bovine nodular skin disease virus P32 protein is shown in SEQ ID NO: 1. The present invention uses a eukaryotic expression system to express P32 protein, and provides post-translational modifications such as methylation, glycosylation, phosphorylation, and translation folding for the obtained recombinant P32 protein, so that the structure and biological activity of the expressed P32 protein are closer to the natural structural protein of the virus, and solves the problem that the P32 inclusion body antigen expressed by prokaryotic expression systems such as Escherichia coli cannot well identify and affinity neutralizing antibodies in animals, resulting in low detection sensitivity or increased false positive samples due to non-specific reactions. It was found through experiments that the P32 protein obtained by eukaryotic expression prepared by the present invention has good antigenicity, and thus the ELISA kit and ELISA detection method for detecting bovine nodular skin disease virus established based on the P32 protein have the characteristics of sensitivity, specificity, and high efficiency, simple operation, short time consumption, low cost, and can detect cattle infected by LSDV with high throughput, suitable for large-scale epidemiological surveys and other applications, and provide a simple and effective diagnostic tool for veterinary clinical diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0031] Figure 1 The results of double enzyme digestion of the recombinant plasmid in Example 2 are as follows;

[0032] Figure 2 The SDS-PAGE analysis results of the recombinant P32 protein expression in Example 3, wherein M: protein molecular weight standard, 1: before cooling, 2: 1 day after cooling, 3: 2 days after cooling, 4: 3 days after cooling, 5: 4 days after cooling, 6: 5 days after cooling, 7: 6 days after cooling, 8: 7 days after cooling;

[0033] Figure 3 The Western blot analysis results of the recombinant P32 protein in Example 3, wherein M: protein molecular weight standard, 1: before cooling, 2: 1 day after cooling, 3: 3 days after cooling, 4: 5 days after cooling, 5: 7 days after cooling;

[0034] Figure 4 The SDS-PAGE analysis results of the recombinant P32 protein purified by the nickel affinity chromatography method in Example 3, wherein M: protein molecular weight standard, 1: before loading, 2: binding flow-through, 3: 50mM imidazole eluent, 4: 200mM imidazole eluent, 5: 250mM imidazole eluent, 6: 300mM imidazole eluent, 7: 500mM imidazole eluent;

[0035] Figure 5 The SDS-PAGE analysis results of the purified recombinant P32 protein in Example 3, wherein M: protein molecular weight standard, 1: blank control, 2: purified recombinant P32 protein;

[0036] Figure 6 The Western blot analysis results of the purified recombinant P32 protein in Example 3, wherein M: protein molecular weight standard, 1: blank control, 2: purified recombinant P32 protein;

[0037] Figure 7 This is the optimization diagram of the indirect ELISA method in Example 4, where the horizontal axis is the optimized conditions and the left vertical axis is OD 450nm Value, the right vertical axis is the P / N value;

[0038] Figure 8 The critical value determination diagram in Example 5, wherein the horizontal axis is the number of serum samples and the vertical axis is P / N (sample OD 450nm )value;

[0039] Fig. 9 This is a graph of the indirect ELISA specificity experiment in Example 6, wherein the abscissa is the name of the positive and negative serum viruses, and the ordinate is the P / N value;

[0040] Fig.10 The indirect ELISA sensitivity test results in Example 7 are shown in the figure. The horizontal axis is the dilution multiple of the bovine LSDV positive serum, and the vertical axis is the P / N value. DETAILED DESCRIPTION

[0041] The present invention provides the use of one or more of the following four items in preparing an ELISA kit for detecting bovine nodular skin disease virus:

[0042] 1) Bovine lumpy skin disease virus P32 protein obtained based on eukaryotic cell expression system;

[0043] 2) a eukaryotic expression cassette containing a nucleotide sequence encoding the bovine nodular skin disease virus P32 protein;

[0044] 3) a eukaryotic expression vector containing a nucleotide sequence encoding the bovine nodular skin disease virus P32 protein;

[0045] 4) a eukaryotic engineered cell containing the nucleotide sequence encoding the bovine nodular skin disease virus P32 protein, the eukaryotic expression cassette described in 2) or the expression vector described in 3);

[0046] The amino acid sequence of the bovine nodular dermatitis virus P32 protein is shown in SEQ ID NO:1.

[0047] The amino acid sequence of the bovine nodular skin disease virus P32 protein shown in SEQ ID NO: 1 of the present invention is: ADIPLYVIPIVGREISDVVPELKSDNDIFYKKVDTVKDFKNSDVNFFFKDKKDISLSYKFLIWEKVEKSGGVENFTEYFSGLCNALCTKEAKSSIAKHFSLWKSYADADIKNSENKFIVVIEDDNTLKDLITIHNIIIEMQEKNIDIFQLRETFHNSNSRILFNQENNNFMYSYTGGYDFTLSAYVIRLSSAIKIINEIIKNKGISTSLSFEMYKLEKELKLNRQVLNDSSKYILHNTKYLSKKRANEMKNGIWNRVGKWMAHRFPDFSYYVSHPLVSFFGIFDISI.

[0048] As an embodiment, the nucleotide sequence of the eukaryotic expression cassette of the present invention is shown in SEQ ID NO: 2, specifically: 5'-AAGCTTGCCACCATGACTCGACTAACTGTGCTAGCACTACTAGCTGGCCTGCTGGCCTCTTCCAGAGCTGCTGATATCCCCCTGTATGTTATCCCTATTGTGGGCAGAGAGATCAGCGACGTGGTGCCAGAGCTGAAGTCCGATAACGATATCTTCTACAAGAAAGTGGACACCGTGAAGGACTTCAAAAATTCTGATGTCAACTTCTTCTTCAAGGACAAGAAGGATATCTCTCTGTCCTATAAGTTCCTGATCTGGGAGAAGGTGGAAAAATCTGGAGGAGTGGAAAATTTTACCGAGTACTTCTCCGGCCTGTGCAACGCCCTGTGTACCAAAGAGGCTAAGAGCTCCATCGCCAAGCACTTCTCTCTGTGGAAGTCTTACGCCGACGCCGATATCAAGAACTCCGAGAACAAGTTCATTGTGGTGATCGAGGACGACAACACACTCAAGGACCTGATCACCATCCACAACATCATCATCGAGATGCAAGAGAAGAACATCGACATCTTCCAGCTGAGAGAGACATTTCATAATTCCAACTCCCGGATCCTGTTCAACCAGGAAAACAACAACTTCATGTACTCCTACACCGGCGGCTACGACTTCACCCTGTCTGCCTACGTGATCCGGCTGTCTTCTGCTATCAAGATCATCAACGAGATCATCAAGAACAAGGGCATCTCCACCTCCCTGAGCTTCGAGATGTACAAGCTGGAAAAAGAACTGAAGCTCAACCGGCAGGTGCTGAACGACTCCTCCAAGTACATCCTGCACAACACCAAGTACCTGTCTAAGAAGCGCGCCAACGAAATGAAAAACGGCATCTGGAACAGAGTGGGTAAGTGGATGGCCCACAGATTCCCTGACTTTAGCTACTACGTCTCCCACCCTCTGGTGTCCTTTTTCGGCATCTTCGACATCAGCATCGGCGGCGGCTCTCACCATCACCATCACCACCACCACTGATAAGAATTC-3'. The eukaryotic expression cassette of the present invention is Hind from the 5'-end to the 3'-endIII-kozak sequence-signal peptide coding sequence-codon optimized sequence of P32 protein-His tag coding sequence-stop codon-EcoR I. The eukaryotic expression cassette of the present invention facilitates better expression of P32 protein.

[0049] As an embodiment, the initial cell in the eukaryotic engineering cell is a CHO-K1 cell. As an embodiment, the initial vector in the eukaryotic expression vector is a plasmid vector; as another embodiment, the plasmid vector can be a PEE12.4 vector.

[0050] The present invention utilizes a eukaryotic expression system to express P32 protein, and provides post-translational modifications such as methylation, glycosylation, phosphorylation, and translation folding for the obtained recombinant P32 protein, thereby making the structure and biological activity of the expressed P32 protein closer to the natural structural protein of the virus, and solving the problem that the P32 inclusion body antigen expressed by a prokaryotic expression system such as Escherichia coli cannot well recognize and have affinity with neutralizing antibodies in animals, resulting in low detection sensitivity or an increase in false positive samples due to nonspecific reactions.

[0051] As an embodiment, the ELISA kit may be an indirect ELISA kit.

[0052] The present invention also provides an indirect ELISA kit for detecting bovine nodular skin disease virus. The indirect ELISA kit uses the bovine nodular skin disease virus P32 protein obtained based on a eukaryotic cell expression system as a coating antigen; the amino acid sequence of the bovine nodular skin disease virus P32 protein is shown in SEQ ID NO: 1.

[0053] As one embodiment, the indirect ELISA kit also includes one or more of an ELISA plate, a blocking solution, a sample diluent, a washing solution, a negative control, a positive control, an enzyme-labeled secondary antibody, a color developing solution, and a stop solution; as another embodiment, the indirect ELISA kit also includes an ELISA plate, a blocking solution, a sample diluent, a washing solution, a negative control, a positive control, an enzyme-labeled secondary antibody, a color developing solution, and a stop solution.

[0054] As an embodiment, the blocking solution of the present invention is skim milk; as another embodiment, the concentration of the skim milk is 5%. In order to facilitate the use and improve the repeatability of the indirect ELISA kit, as an embodiment, the present invention encapsulates the bovine nodular skin disease virus P32 protein obtained based on the eukaryotic cell expression system in an ELISA plate, and replaces the ELISA plate and the blocking solution in the kit with the ELISA plate encapsulated with the bovine nodular skin disease virus P32 protein obtained based on the eukaryotic cell expression system.

[0055] As an embodiment, the washing liquid of the present invention can be a PBST buffer, i.e., a phosphate buffer containing 0.05% Tween-20 and 0.01 mol / L, with a pH of 7.4; as another embodiment, the washing liquid can be concentrated for use; as another embodiment, the washing liquid can be used after being concentrated 10 times. As an embodiment, the diluent of the present invention can be a PBST buffer containing 1% skim milk; the diluent can be used to dilute the sample to be tested, the negative control, the positive control, and the enzyme-labeled secondary antibody.

[0056] As an embodiment, the enzyme-labeled secondary antibody includes rabbit anti-bovine IgG labeled with horseradish peroxidase. As an embodiment, the color developing solution can be TMB color developing solution. As an embodiment, the stop solution can be a sulfuric acid solution, and the concentration of the sulfuric acid solution is 2M.

[0057] As an embodiment, the negative control can be a bovine lumpy skin disease virus negative serum. As an embodiment, the positive control can be a bovine lumpy skin disease virus positive serum.

[0058] The present invention also provides the use of the indirect ELISA kit described in the above technical solution in the preparation of a diagnostic product for bovine nodular dermatosis.

[0059] Specifically, the present invention also provides a method for detecting bovine nodular dermatitis virus for non-diagnostic purposes based on the indirect ELISA kit described in the above technical solution, comprising the following steps:

[0060] 1) The bovine nodular skin disease virus P32 protein obtained based on the eukaryotic cell expression system is coated on an ELISA plate;

[0061] 2) blocking and washing the coated ELISA plate to obtain a blocked ELISA plate;

[0062] 3) diluting the test sample serum and the negative control serum with diluent, respectively, and adding them to the blocked ELISA plate, incubating and washing, respectively, to obtain a primary ELISA plate;

[0063] 4) diluting the enzyme-labeled secondary antibody with a diluent and adding it to the primary enzyme-labeled plate strip for incubation and washing to obtain an intermediate enzyme-labeled plate containing the secondary antibody;

[0064] 5) adding the color developing solution to the intermediate ELISA plate containing the secondary antibody to develop color in the dark, thereby obtaining a color developing ELISA plate;

[0065] 6) Add the stop solution to the colorimetric plate to stop the color development, and measure the OD of the diluted sample and the negative control respectively. 450nm The absorbance value at the position is used to determine the result:

[0066] When the OD of the diluted sample 450nm≥ negative control mean + negative control standard deviation × 3, the sample is judged to be positive. 450nm It is considered negative when the value is less than the standard deviation of negative control × 3 + the mean value of negative control.

[0067] As an embodiment, the coating concentration of the bovine nodular skin disease virus P32 protein obtained by the eukaryotic cell expression system can be 1-10 μg / mL; as another embodiment, the coating concentration of the bovine nodular skin disease virus P32 protein can be 4 μg / mL. As an embodiment, the coating temperature is 4°C and the time is 12h. As an embodiment, the sealing temperature is 37°C and the time is 12h.

[0068] As an embodiment, the incubation temperature in step 3) is 37°C and the time is 2h. As an embodiment, the dilution factor of the test sample serum is 1:(100-1000); as another embodiment, the dilution factor of the test sample serum is 1:200.

[0069] As an embodiment, the incubation temperature in step 4) is 37°C and the time is 1 hour. As an embodiment, the dilution factor of the enzyme-labeled secondary antibody is 1:(1000-10000); as another embodiment, the dilution factor of the enzyme-labeled secondary antibody is 1:3000.

[0070] As an embodiment, the temperature for light-proof color development is 37° C. and the time is 20 minutes.

[0071] The method for detecting bovine nodular skin disease virus established based on the indirect ELISA kit of the present invention has a sensitivity of up to 1:6400; there is no cross reaction with bovine rotavirus (BRV), bovine infectious rhinotracheitis virus (IBRV), bovine viral diarrhea virus (BVDV), and bovine Brucella (Brμcellar) positive serum; repeatability tests show that the coefficient of variation of the detected samples within the same batch is 2.67% to 5.15%, all less than 10%; and the coefficient of variation within different batches is between 3.53% and 8.27%, all less than 10%, indicating that the method has good intra-batch and inter-batch repeatability.

[0072] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0073] Example 1

[0074] Optimization of LSDVP32 gene codons

[0075] In this embodiment, based on the gene sequence of the LSDV epidemic strain published by NCBI GenBank, part of the transmembrane region was intercepted and the LSDVP32 gene sequence was optimized and synthesized by Shanghai Shenggong Biotechnology Co., Ltd. in combination with CHO-K1 codon preference.

[0076] Example 2

[0077] Construction of recombinant expression vector PEE12.4-P32

[0078] Hind III (AAGCTT) and EcoR I (GAATTC) restriction site sequences were added to both ends of the optimized P32 gene nucleotide sequence, and a kozak sequence (GCCA CC) and a signal peptide (ATGACTCGACTAACTGTGCTAGCACTACTAGCTGGCCTGCT GGCCTCTTCCAGAGCT, SEQ ID NO: 3) were added to the 5' end, and an 8×His tag sequence (CACCATCACCATCACCACCACCAC, SEQ ID NO: 4) and a stop codon (TGATAA) were added to the 3' end. The strategy is as follows:

[0079] HindIII-kozak sequence-signal peptide-coding gene sequence of P32 protein-His tag-stop codon-EcoR I;

[0080] After the design was completed, the sequence was submitted to Shanghai Shenggong Biotechnology Co., Ltd. for artificial synthesis, and an artificially synthesized P32 gene sequence was obtained. The synthesized nucleic acid sequence is shown in SEQ ID NO: 2;

[0081] The artificially synthesized P32 gene and PEE12.4 vector were double-digested with HindIII and EcoR I, respectively, and then recovered from the gel, ligated and transformed into DH5α competent cells, and identified by double-digestion with HindIII and EcoR I. Figure 1 ,exist Figure 1 Middle: The leftmost lane M represents DL2000 DNA Marker; 1 represents the recombinant plasmid double-enzyme digestion product 1; 2 represents the recombinant plasmid double-enzyme digestion product 2; 3 represents the recombinant plasmid double-enzyme digestion product 3; the rightmost lane M represents DL10000 DNA Marker.

[0082] It can be seen that after double enzyme digestion of the recombinant plasmid, gene fragments of about 1000bp and 8000bp were obtained respectively. PEE12.4-LSDVP32-2 was selected for sequencing, and the results showed that there was no base mutation compared with the target sequence.

[0083] Example 3

[0084] Establishment of CHO-K1 cell line stably expressing recombinant P32 protein

[0085] The positive bacterial solution was inoculated into LB liquid culture medium containing 100 μg / mL ampicillin at a volume ratio of 1:1000, and cultured overnight at 37°C and 220 r / min. The plasmid was extracted according to the instructions of the endotoxin-free plasmid extraction kit, and the plasmid mass concentration was determined and stored in a -80°C refrigerator.

[0086] 6.25×10 CHO-K1 cells in the logarithmic growth phase were taken 6 After centrifugation, resuspend with 1 mL CHO-K1 medium, take 0.8 mL of cell suspension and 50 μg of plasmid (filtered with 0.22 μm filter) in an EP tube, mix well, and transfer to a pre-cooled electroporation cup for electrotransfection. After electrotransfection, draw 0.6 mL of liquid from the electroporation cup into a T-25 cm 2 The culture was incubated in the flask for 24 h.

[0087] After 24 hours, take an appropriate amount of T-25cm 2 The cells in the culture flask were 0.5×10 4 The cells were plated in a 96-well plate at a density of 100 μL / well and 200 μL / well of culture medium for static culture. When the cell confluence reached 80%, the cells were passaged at a ratio of 1:4. The supernatant was taken for preliminary detection by SDS-PAGE method ( Figure 2 The selected positive wells were transferred into 24-well plates, and then transferred into T-25cm when the cell confluence reached 80%. 2 When the viable cell density is higher than 0.5×10 6 / mL, then expand to T-75cm 2 The viable cell density is higher than 0.5×10 6 When the number of cells / mL increases, transfer to a 125 mL shake flask for culture.

[0088] The selected CHO-K1 cell lines stably expressing LSDV P32 protein were expanded and cultured at 1×10 6 The initial density of cells / mL is expressed when the cell density is (10~12)×10 6 / mL, the expression was carried out under the conditions of 130r / min, 33℃, and culture in a carbon dioxide incubator; during the cooling and culture process, sugar was added every day, feed was added every other day, samples were taken every day, and counted, and the supernatant was collected for SDS-PAGE and Western blot detection ( Figure 2 , Figure 3 ). When the cell viability is lower than 50%, the cell supernatant is collected by centrifugation and filtered with a 0.22 μm filter.

[0089] Purify the target protein using nickel affinity chromatography. After the filtered protein is loaded on nickel affinity chromatography, it is washed with PBS buffer containing 50mM imidazole, and then eluted with PBS buffer containing 200mM, 250mM, 300mM and 500mM imidazole respectively. The results show that 200mM imidazole can elute the target protein better ( Figure 4 ).

[0090] Protein expression was detected by SDS-PAGE and Western-Blot. Figure 5 and Figure 6 ), it can be seen that P32 protein was successfully expressed in CHO-K1 cells ( Figure 5 and Figure 6 )

[0091] Example 4

[0092] Establishment and optimization of indirect ELISA method for bovine lumpy skin disease virus

[0093] The optimal antigen coating concentration and serum dilution were determined by the square array titration method. The P32 protein prepared in Example 3 was diluted to (4, 2, 1, 0.5, 0.25, 0.125 μg / mL) and coated on a 96-well ELISA plate. LSDV-positive serum and LSDV-negative serum of different dilutions (1:50-1:400) were incubated. The OD was measured by a microplate reader according to the conventional ELISA procedure. 450nm Value, compare P / N (LSDV positive serum OD 450nm / LSDV negative serum OD 450nm ) value, and select the antigen coating concentration and serum dilution multiple corresponding to the maximum P / N value as the optimal conditions.

[0094] Determine the best coating solution for coating LSDVP32 protein: optimize the coating solution according to the optimized antigen coating concentration and serum dilution. Fix other experimental conditions, use pH 9.6 carbonate buffer (CBS) and pH 7.3 phosphate buffer (PBS) as coating solution, follow the conventional ELISA steps, and measure OD with a microplate reader. 450nm Values ​​were compared and the P / N values ​​were compared to select the best coating solution for coating LSDVP32 protein.

[0095] Determine the conditions for coating LSDVP32 protein: optimize the coating conditions according to the optimized antigen coating concentration, coating solution and serum dilution. Fix other experimental conditions, coat LSDVP32 protein at 37℃ for 1h, 37℃ for 2h, 4℃ for 12h, 4℃ for 16h, and 4℃ for 18h, and operate according to the conventional ELISA steps, and measure OD with a microplate reader.450nm Values ​​were compared and the P / N values ​​were compared to select the optimal coating conditions for coating LSDVP32 protein.

[0096] Determine the best blocking conditions: optimize the blocking conditions according to the optimized antigen coating concentration, coating solution and serum dilution. Fix other experimental conditions and block at 37℃ for 1h, 37℃ for 2h and 37℃ for 3h. Follow the routine ELISA steps and measure OD with an enzyme reader. 450nm Numerical values, compare the size of P / N values, and select the best sealing conditions.

[0097] Determine the best blocking solution: optimize the blocking solution according to the optimized antigen coating concentration, coating solution, coating conditions, blocking conditions and serum dilution. Fix other experimental conditions and test oμtblock blocking solution, thermo blocking solution, 1% gelatin, 5% BSA, 5% skim milk and 10% horse serum. Follow the routine ELISA steps and measure OD with an enzyme reader 450nm Values, compare the P / N values, and select the best blocking solution.

[0098] Optimal serum incubation conditions: Optimize serum incubation conditions according to the optimized antigen coating concentration, coating solution, coating conditions, blocking conditions, blocking solution and serum dilution. Fix other experimental conditions and incubate the serum at 37℃ for 1h, 37℃ for 2h and 37℃ for 3h. Follow the routine ELISA steps and measure OD with an enzyme-labeled instrument. 450nm Values, compare the P / N values, and select the optimal serum incubation conditions.

[0099] Optimization of the best enzyme-labeled secondary antibody incubation conditions: According to the optimized antigen coating concentration, coating solution, coating conditions, blocking conditions, blocking solution, serum dilution and serum incubation conditions, the enzyme-labeled secondary antibody incubation conditions were optimized. Other experimental conditions were fixed, and the enzyme-labeled secondary antibody was incubated at 37℃ for 0.5h, 37℃ for 0.75h, 37℃ for 1h and 37℃ for 1.5h. According to the conventional ELISA steps, the OD was measured with an enzyme-labeled instrument. 450nm Values ​​were compared and the P / N values ​​were compared to select the best enzyme-labeled secondary antibody incubation conditions.

[0100] Optimization of the best serum and enzyme-labeled secondary antibody dilution: Optimize the serum and enzyme-labeled secondary antibody dilution according to the optimized antigen coating concentration, coating solution, coating conditions, blocking conditions, blocking solution, serum dilution, serum incubation conditions and enzyme-labeled secondary antibody incubation conditions. Fix other experimental conditions, and test PBS, PBST containing 5% BSA, PBST containing 1% BSA, PBST containing 5% skim milk, and PBST containing 1% skim milk. Follow the routine ELISA steps and use a microplate reader to measure OD 450nmValues, compare the P / N values, and select the best serum and enzyme-labeled secondary antibody dilution.

[0101] Optimization of the best enzyme-labeled secondary antibody incubation ratio: According to the optimized antigen coating concentration, coating solution, coating conditions, blocking conditions, blocking solution, serum dilution, serum incubation conditions and the best conditions of serum and enzyme-labeled secondary antibody dilution solution, the enzyme-labeled secondary antibody incubation ratio was optimized. Fix other experimental conditions and dilute the enzyme-labeled secondary antibody at a ratio of 1:1000, 1:3000, 1:5000, and 1:8000 respectively. Follow the conventional ELISA steps and use a microplate reader to measure OD 450nm Values, compare the P / N values, and select the optimal enzyme-labeled secondary antibody incubation ratio.

[0102] Optimization of the best color development time: Optimize the color development time according to the optimized antigen coating concentration, coating solution, coating conditions, blocking conditions, blocking solution, serum dilution, serum incubation conditions, serum and enzyme-labeled secondary antibody dilution solution and enzyme-labeled secondary antibody incubation ratio. Fix other experimental conditions and incubate at 37°C in the dark for 5, 10, 15 and 20 minutes respectively. Follow the routine ELISA steps and measure OD with a microplate reader 450nm value, compare the size of P / N value and select the best color development time.

[0103] By square titration, it was determined that when the antigen and serum dilutions were 4 μg / mL and 1:200, respectively, the OD values ​​of positive (P) and negative (N) sera were the largest (P / N value was 7.768) (Table 1). Therefore, the optimal antigen coating concentration and serum dilution were 4 μg / mL and 1:200, respectively. Under the conditions of the optimal antigen and serum dilution, the optimal coating solution, optimal coating conditions, optimal blocking conditions, optimal blocking solution, optimal serum reaction time, optimal enzyme-labeled secondary antibody reaction time, optimal serum and enzyme-labeled secondary antibody dilution, optimal enzyme-labeled secondary antibody dilution ratio, and optimal color development time were optimized in turn. Finally, the optimal conditions for indirect ELISA were determined to use CBS to coat P32 protein at 4°C for 12h, and then blocked with 5% skim milk at 37°C for 2h. The optimal incubation time of serum was 37°C for 2h. The reaction time of enzyme-labeled secondary antibody was 37°C for 1h. The optimal dilution of serum and enzyme-labeled secondary antibody was PBST+1% skim milk. The optimal dilution of enzyme-labeled secondary antibody is 1:3000. The optimal color development time is 20 minutes at 37°C in the dark. Figure 7 ).

[0104] Table 1 Determination of optimal antigen coating concentration and serum dilution

[0105]

[0106] Example 5

[0107] Determination of the critical value of indirect ELISA for detection of bovine lumpy skin disease virus

[0108] According to the indirect ELISA method established in Example 4, 33 bovine serum samples with known negative background were tested and the OD 450nm OD was calculated by statistical analysis. 450nm The mean value (X) = 0.149, standard deviation (SD) = 0.055, the critical value is determined to be X + 3SD = 0.314 ( Figure 8 ). That is, the OD of the sample to be tested 450nm ≥0.314 is considered positive, and the OD of the sample to be tested is 450nm When <0.314, it was judged as negative.

[0109] Example 6

[0110] Determination of the sensitivity of indirect ELISA for bovine lumpy skin disease virus

[0111] According to the indirect ELISA method established in Example 4, the LSDV positive serum was diluted from 1:10 to 1:12800, and the OD was read. 450nm The value was observed to change with the increase of serum dilution. The test results showed that the maximum dilution that could detect positive was 1:6400 ( Fig. 9 ).

[0112] Example 7

[0113] Determination of the specificity of indirect ELISA for bovine lumpy skin disease virus

[0114] According to the indirect ELISA method established in Example 4, the positive serum and negative serum of bovine rotavirus, bovine infectious rhinotracheitis virus, bovine viral diarrhea virus, bovine Brucella, bovine nodular skin disease virus antibody provided by China Veterinary Drug Administration were diluted and tested using the optimized LSDV indirect ELISA detection method, and the OD was read. 450nm The results showed that only the OD of LSDV positive serum 450nm Values ​​in the positive range (OD 450nm ≥0.314), OD of other virus-positive sera 450nm All of them were less than 1.0%, indicating that the established indirect ELISA method would not cross-react with positive sera of other viruses and had good specificity ( Fig.10 ).

[0115] Example 8

[0116] Determination of the repeatability of indirect ELISA for bovine lumpy skin disease virus

[0117] According to the indirect ELISA method established in Example 4, the intra- and inter-batch repeatability of the detection method was determined using 5 negative and 5 positive sera with known backgrounds. For intra-batch repeatability, each serum was tested 5 times on the ELISA plate coated with the same batch of P32 protein. For inter-batch repeatability, each serum was tested 5 times on the ELISA plate coated with different batches of P32 protein, and the OD was read. 450nm The coefficient of variation (CV), i.e., the ratio of SD to X of each group of serum, was calculated. The results are shown in Table 2.

[0118] It can be concluded from Table 2 that the intra-batch coefficient of variation is between 2.67% and 5.15%, and the inter-batch coefficient of variation is between 3.53% and 8.27%. Both the intra-batch and inter-batch coefficients of variation are less than 10%, indicating that the method has good repeatability.

[0119] Table 2 Indirect ELISA repeatability test

[0120]

[0121] Example 9

[0122] Determination of the coincidence rate of indirect ELISA method for bovine lumpy skin disease virus

[0123] The indirect ELISA method established in Example 4 and the commercialized double antigen ELISA kit (IDVET) were used. Capripox Double Antigen Multi-species) was used to test 93 serum samples at the same time, and the coincidence rate between the two was (89 / 93) 95.70%, which was a good coincidence rate.

[0124] Example 10

[0125] Comparative analysis of the sensitivity, repeatability and consistency of the indirect ELISA antibody detection method based on the P32 protein of bovine lumpy skin disease virus stably expressed in CHO-K1 cells and the indirect ELISA antibody detection method based on the P32 protein expressed in prokaryotes:

[0126] In the early stage of this laboratory, the entire transmembrane region of the LSDV P32 protein was intercepted and the P32 gene synthesized according to the codon preference of E. coli was cloned into the pET30a vector. The nucleotide sequence of the P32 gene is shown in SEQ ID NO:3, specifically: 5'-ATGGCAGATATTCCATTATATGTTATACCAATCGTTGG -3'. Then it was transformed into E. coli BL21 (DE3), and positive clones were obtained by kanamycin screening and cultured at 37°C with shaking until OD 600 When the p32 protein was 0.6-0.8, 0.5 mM IPTG solution was then added to induce the culture for 4 h, and finally the recombinant p32 protein was obtained by cell disruption and affinity chromatography.

[0127] The indirect ELISA method was established by using the prokaryotic expressed P32 protein as the coating antigen, and the experiments of Example 6, Example 7, Example 8, and Example 9 were repeated. The results showed that the maximum dilution of the prokaryotic expressed P32 protein that could detect positive results was 1:800; it would not cross-react with positive sera of other viruses; the intra-batch coefficient of variation was between 4.14% and 8.67%, and the inter-batch coefficient of variation was between 6.87% and 10.45%; the coincidence rate of the test results of 93 serum samples and the commercialized dual antigen ELISA kit of IDVET Company was (84 / 93) 90.32%.

[0128] After comparative analysis, the indirect ELISA antibody detection method based on the bovine lumpy skin disease virus P32 protein stably expressed in CHO-K1 cells has better sensitivity and repeatability and a higher consistency rate in the test results.

[0129] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of one or more of the following four items in the preparation of an ELISA kit for detecting bovine nodular skin disease virus: 1) Bovine lumpy skin disease virus P32 protein obtained based on eukaryotic cell expression system; 2) a eukaryotic expression cassette containing a nucleotide sequence encoding the bovine nodular skin disease virus P32 protein; 3) a eukaryotic expression vector containing a nucleotide sequence encoding the bovine nodular skin disease virus P32 protein; 4) a eukaryotic engineered cell containing the nucleotide sequence encoding the bovine nodular skin disease virus P32 protein, the eukaryotic expression cassette described in 2) or the expression vector described in 3); The amino acid sequence of the bovine lumpy skin disease virus P32 protein is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the eukaryotic expression cassette is shown in SEQ ID NO:

2.

3. The use according to claim 1, characterized in that: The initial cells in the eukaryotic engineering cells include CHO-K1 cells; the initial vector in the eukaryotic expression vector is a plasmid vector.

4. The use according to any one of claims 1 to 3, characterized in that: The ELISA kit includes an indirect ELISA kit.

5. An indirect ELISA kit for detecting bovine nodular skin disease virus, characterized in that: The indirect ELISA kit uses the bovine nodular skin disease virus P32 protein obtained based on a eukaryotic cell expression system as a coating antigen; the amino acid sequence of the bovine nodular skin disease virus P32 protein is shown in SEQ ID NO:

1.

6. The indirect ELISA kit according to claim 5, characterized in that The indirect ELISA kit also includes one or more of an enzyme-labeled plate, a blocking solution, a sample diluent, a washing solution, a negative control, a positive control, an enzyme-labeled secondary antibody, a color developing solution and a stop solution.

7. The indirect ELISA kit according to claim 6, characterized in that The blocking solution includes skim milk; the sample diluent includes PBST buffer containing 1% skim milk; the washing solution includes PBST buffer; the enzyme-labeled secondary antibody includes rabbit anti-bovine IgG labeled with horseradish peroxidase; the color developing solution includes TMB color developing solution; the stop solution includes sulfuric acid solution, and the concentration of the sulfuric acid solution is 2M.

8. Use of the indirect ELISA kit according to any one of claims 5 to 7 in the preparation of a diagnostic product for bovine nodular dermatosis.

9. A method for detecting bovine lumpy skin disease virus for non-diagnostic purposes based on the indirect ELISA kit according to any one of claims 5 to 7, characterized in that: The steps include: 1) The bovine nodular skin disease virus P32 protein obtained based on the eukaryotic cell expression system is coated on an ELISA plate; 2) blocking and washing the coated ELISA plate to obtain a blocked ELISA plate; 3) diluting the test sample serum and the negative control serum with diluent, respectively, and adding them to the blocked ELISA plate, incubating and washing, respectively, to obtain a primary ELISA plate; 4) diluting the enzyme-labeled secondary antibody with a diluent and adding it to the primary enzyme-labeled plate strip for incubation and washing to obtain an intermediate enzyme-labeled plate containing the secondary antibody; 5) adding the color developing solution to the intermediate ELISA plate containing the secondary antibody to develop color in the dark, thereby obtaining a color developing ELISA plate; 6) Add the stop solution to the colorimetric plate to stop the color development, and measure the OD of the diluted sample and the negative control respectively. 450nm The absorbance value at the position is used to determine the result: When the OD of the diluted sample 450nm ≥ negative control mean + negative control standard deviation × 3, the sample is judged to be positive. 450nm It is considered negative when the value is less than the standard deviation of negative control × 3 + the mean value of negative control.

10. The method according to claim 9, characterized in that The coating concentration of the bovine nodular dermatosis virus P32 protein obtained based on the eukaryotic cell expression system is 1-10 μg / mL; the dilution multiple of the test sample serum is 1:(100-1000); and the dilution multiple of the enzyme-labeled secondary antibody is 1:(1000-10000).

Images