Novel artificial enhancement subelement, assembly part and preparation method and application of novel artificial enhancement subelement

Abstract

The invention relates to a novel artificial enhancement subelement, an assembly and a construction method and application of the novel artificial enhancement subelement. The invention provides an artificial enhancer element capable of guiding high-level expression of a target gene as well as an assembly and application of the artificial enhancer element. Preferably, the artificial enhancer element and the assembly of the artificial enhancer element can guide the high expression level of an antibody gene and enhance the diversity of an antibody. The designed and assembled artificial enhancer element and assembly have the function of a super enhancer, can construct a targeting vector, guide high-level expression of a target gene, especially an antibody gene, and increase diversity of antibody gene expression products. Expression of luciferase in mouse myeloma cells is guided according to the artificial enhancer element and the composition thereof, but the artificial enhancer element and the composition thereof can be generally used for expression of target genes in mice, preferably expression of antibody genes.

Description

Technical Field

[0001] The present invention relates to the technical field of synthetic biology, and in particular to an artificial enhancer element, an assembly, and a preparation method and application thereof that can improve the expression level and diversity of antibody genes. Background Art

[0002] The following discussion of the background of the invention is provided only to assist the reader in understanding the present invention and is not intended to admit that it describes or constitutes prior art to the present invention.

[0003] Antibodies are produced by plasma cells after the proliferation and differentiation of mammalian bone marrow-derived B lymphocytes in response to antigen stimulation. They are a general term for a class of secretory immunoglobulins (Ig) that can specifically bind to corresponding antigens.

[0004] The basic structure of an antibody is composed of two identical heavy chains (IgH) and two identical light chains (Igλ or Igκ), including variable regions (V) and constant regions (C). The variable region (VH) of the antibody heavy chain locus is composed of variable (V), diversity (D) and joining (J) gene clusters; while the variable region (VL) of the antibody light chain locus only has V and J gene clusters.

[0005] The diversity of antibodies is the basis of adaptive immune response (i.e. humoral immunity), including diversity against different antigenic epitopes and different types of diversity against the same epitope. The diversity of antibodies is expressed by the rearrangement of the Ig gene (BCR) encoding the surface of B cells and antigen selection. The germline genes of Ig exist as separated V, D, J and C gene clusters. Only after gene rearrangement to form VDJ (LGH) or VJ (IGL) connection, and then connected to the C gene cluster, can a complete and functional BCR be encoded.

[0006] In the early development of B cells (from progenitor B cells to pre-B cells), after recombination activating enzymes (RAG) recognize the conserved rearrangement signal sequence (RSS) at both ends of the Ig germline gene locus V, D and J gene segments, they splice the variable region of the Ig germline gene into a single VDJ assembly (VDJ rearrangement) through DNA double-strand breaks and repair. After rearrangement, the VDJ segment is transcribed together with the downstream C segment (IGHM and IGHD) to form a diverse BCR clone. Therefore, VDJ rearrangement is the most important mechanism for the generation of BCR diversity, that is, antibody diversity, and is the basis for the body's immune system to produce specific antibodies against different antigens.

[0007] There is an intronic enhancer element (iEμ, referred to as Eμ) between the variable region and the constant region of the mouse germline Ig heavy chain locus (IgH). The Eμ enhancer is an important transcriptional regulatory element that can enhance the expression of antibody-encoding genes in a tissue-specific manner. Studies have shown that the Eμ enhancer mainly affects B cell development and antibody diversity formation by regulating germline IgH transcription and participating in V(D)J rearrangement, and participates in cohesin-mediated chromatin loop extrusion to further promote the generation of antibody diversity.

[0008] Enhancers are a type of cis regulatory elements (CREs) that work together with promoters to regulate the expression of target genes in a tissue-specific or non-tissue-specific manner. Generally speaking, enhancers have the following characteristics: (1) long-range effects; (2) non-directionality; (3) cis-regulation; and (4) tissue specificity. Super enhancers (SEs) are a recently discovered type of enhancer element. SEs are a large cluster of transcriptionally active enhancers. They are genomic regulatory elements with high binding density of key transcription factors and enriched gene-activating histone modifications. They can significantly regulate the expression of target genes and determine cell identity and fate.

[0009] Improving the expression level and diversity of mammalian antibodies will have an important impact on the host's humoral immune response, and is also the key to improving artificially prepared antibodies (including mouse-derived and humanized antibodies). Therefore, there is still a need in the art to develop key technologies and devices that can significantly enhance the expression level and diversity of antibodies for the development of antibodies and their derivative products that can prevent and treat diseases. Summary of the invention

[0010] Based on this, the purpose of the present invention is to provide an artificial enhancer element, an artificial enhancer element assembly, and a preparation method and application thereof that can improve the expression level and diversity of antibodies.

[0011] The first aspect of the present invention is to provide an artificial enhancer element, which can be used to prepare an enhancer assembly that can improve the expression level and diversity of antibodies.

[0012] The artificial enhancer element has a structure of A(n), wherein the sequence of A is shown in SEQ ID NO: 1, or is a sequence having at least 90% identity or homology with SEQ ID NO: 1; wherein n refers to the copy number of the A element, and n is an integer between 1-10.

[0013] In some of these embodiments, in A(n), n is 1, 2, 3, 4 or 5, preferably 2; for example, compared with the control, A(2) can guide the expression of firefly luciferase in the mouse myeloma P3X63Ag8 cell line, and its expression level is as high as 3-4 times.

[0014] The second aspect of the present invention is to provide an artificial enhancer element assembly having the following structure:

[0015] B1-A(n)-CDC-B2-E, where:

[0016] ① A is an artificial enhancer element, the sequence of which is as shown in SEQ ID NO: 1, or a sequence having at least 90% identity or homology to SEQ ID NO: 1, n refers to the number of copies of the A element, and n is an integer between 1 and 10;

[0017] ② B1 or B2 is the DNA sequence at both ends of the artificial enhancer element, including the mouse chromosome homologous sequence, with a length of 0.2-20kb, preferably 0.5-5kb; 1349bp

[0018] ③C is the loxP sequence, which can remove the positive selection gene after the introduction of Cre recombinase;

[0019] ④D is a positive selection marker gene element box, including a marker gene, a promoter element for directing the expression of the gene, and a polylysine signal poly (A);

[0020] ⑤E is a negative selection marker gene element box, including a marker gene, a promoter element that directs the expression of the gene, and a polylysine signal poly (A).

[0021] In some of the embodiments, the positive selection marker gene includes one or more conventional positive selection marker genes, such as neomycin phosphotransferase (NPT II) gene, hygromycin B phosphotransferase (Hpt) gene and PAC gene encoding puromycin N-acetyltransferase (Puro). These genes are not expressed in mammalian cells. Therefore, after adding corresponding drugs such as geneticin G418, they can be used for screening positive cells.

[0022] In some embodiments, the marker gene in the negative selection marker gene element box is, for example, herpes simplex virus thymidine kinase (HSV-TK), and negative selection is performed by using this selection marker.

[0023] The mouse chromosome homologous sequence in B1 or B2 preferably has a length of 0.5-5 kb, and more preferably 0.1-3 kb.

[0024] The artificial enhancer element A(n) of the present invention guides the expression of the target gene at the cellular level. Specifically, the artificial enhancer element disclosed in the present invention is cloned into a eukaryotic expression vector and placed upstream or downstream of the target gene, and guides the target gene to be expressed at a high level. For example, the artificial enhancer element A(n) disclosed in the present invention is cloned into a eukaryotic expression vector pGL3-SV40P, placed downstream of the firefly luciferase gene, and co-transfected with the control plasmid pRL-SV40P (expressing Renilla luciferase) into a mouse myeloma P3X63Ag8 cell line. The dual luciferase reporter system has the following characteristics:

[0025] (1) n A sequences can be seamlessly connected through iterative assembly, thereby improving the assembly efficiency and accuracy of the artificial enhancer element of the invention;

[0026] (2) Using Renilla luciferase as a reference, the efficiency of the artificial enhancer element in directing the expression of the target gene (firefly luciferase gene) was evaluated at the cellular level;

[0027] (3) Only a single A sequence needs to be sequenced, without the need to sequence A(n), which improves assembly efficiency and reduces costs.

[0028] The artificial enhancer element assembly described in the present invention has the following characteristics: through positive and negative screening of the above-mentioned marker gene, ES cells or fertilized egg cells with site-specific integration of A(n) can be obtained; (A)n is an artificial DNA element designed and assembled by the present invention, which has the function of a super enhancer and can guide the target gene to be expressed at a high level in eukaryotic cells.

[0029] The third aspect of the present invention is to provide the use of artificial enhancer elements or artificial enhancer components in constructing targeting vectors.

[0030] The fourth aspect of the present invention is to provide a targeting vector comprising any one of the above-mentioned artificial enhancer components.

[0031] The fifth aspect of the present invention is to provide a method for constructing the artificial enhancer component.

[0032] The method for constructing an artificial enhancer component comprises the following steps:

[0033] Construction of pUC19-Aa plasmid with artificial enhancer inserted;

[0034] Constructing a pGL3-SV40P-Ab plasmid into which the sequence shown in SEQ ID NO: 2 is inserted;

[0035] The pUC19-Aa plasmid was digested with Hind III to recover a 1047 bp DNA fragment; at the same time, the pGL3-SV40P-An plasmid was linearized to recover a 6012 bp DNA fragment, and pGL3-SV40P-A(n) was constructed by HiFi seamless assembly, where n refers to the number of copies of the A element, and n is an integer between 1 and 10;

[0036] The CDC product with a length of 1841 bp was obtained by PCR amplification and cloned into the pUC19 plasmid to construct pUC19-CDC;

[0037] The bacterial artificial chromosome RP11-154H17 was cloned as B2 into the pUC19-CDC plasmid to construct pUC19-CDC-B2;

[0038] The E fragment was cloned into the pUC19-B1-CDC-B2 plasmid to construct pUC19-B1-CDC-B2-E, which was linearized and the target DNA fragment was recovered;

[0039] pGL3-SV40P-A(n) was digested with enzymes, and the target DNA fragment was connected to construct the pUC19-B1-A(n)-CDC-B2-E targeting vector.

[0040] The design and assembly of gene targeting vectors in mice, i.e., constructing the B1-(A)nCDC-B2-E gene targeting vector, and introducing the element into embryonic stem cells (ES cells) or fertilized eggs of mice through gene targeting or microinjection technology to construct gene-modified mice; human immunoglobulin variable region functional genes can also be further introduced into these gene-modified mice to construct a new generation of humanized antibody mouse platform.

[0041] The targeting vector system has the following features:

[0042] (1) n A sequences can be seamlessly connected through iterative assembly, thereby improving the assembly efficiency and accuracy of the artificial enhancer element of the invention;

[0043] (2) site-specific integration through the upstream and downstream homology arms of the A sequence and positive and negative pressure screening of marker genes to increase the ratio of positive ES or fertilized egg cells, thereby improving the efficiency of preparing gene-modified mice;

[0044] (3) The Cre / loxP system can be used to quickly delete irrelevant genes such as introduced resistance genes.

[0045] The artificial enhancer element assembly with B1-(A)nCDC-B2-E of the present invention is a targeting vector (or gene knock-in box), which is introduced into mouse embryonic stem cells (ES cells) or fertilized eggs through gene targeting or microinjection technology to construct gene-modified mice; preferably, the targeting vector is introduced into ES cells to replace the mouse IgH gene locus Eμ element in situ to construct a gene-modified mouse that can significantly improve the antibody level and diversity. On the other hand, human immunoglobulin variable region functional genes can also be further introduced into this gene-modified mouse to construct a new generation of humanized antibody mouse platform.

[0046] The invention discloses an artificial enhancer element and one or more regulatory elements for directing the expression of a target gene. The term "regulatory element" is intended to include a promoter, an internal ribosome entry site (IRES), and other expression control components (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences). Regulatory elements include elements that direct the target gene to be constitutively expressed in many types of host cells or elements that direct the target gene to be expressed only in specific host cells.

[0047] Merely by way of example, the artificial enhancer element A(n) disclosed in the present invention is cloned into the eukaryotic expression vector pGL3-SV40P, placed downstream of the firefly luciferase gene, and co-transfected with the control plasmid pRL-SV40P (expressing Renilla luciferase) into the mouse myeloma P3X63Ag8 cell line or the 293T cell line derived from human embryonic kidney.

[0048] Compared with the prior art, the present invention has the following beneficial effects:

[0049] The present invention relates to an artificial enhancer element and its composition and application. According to the present invention, the new DNA element and its composition can be used to guide the high-level expression of target genes. The artificial enhancer element designed and assembled by the present invention has the function of a super enhancer, can guide the high-level expression of target genes, especially antibody genes, and increase the diversity of antibody gene expression products.

[0050] The artificial enhancer element of the present invention can also be generally used in other mammalian cells and mice, including the transformation of wild-type mice and the preparation of humanized antibody mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 A1 and A2 sequence comparison chart (NCBI BLAST).

[0052] Figure 2 This is the structure diagram of pGL3-A(n).

[0053] Figure 3 This is the structural diagram of the targeting vector-A(n).

[0054] Figure 4 (A) is a diagram showing the restriction enzyme digestion of pUC19-Aa.

[0055] FIG4(B) is a diagram showing the restriction enzyme digestion identification of pGL3-SV40P-A(n).

[0056] FIG4(C) is a diagram showing the restriction enzyme digestion identification of the targeting vector-A(n).

[0057] Figure 5 The relative fluorescence intensity results are shown in the bar graph. DETAILED DESCRIPTION

[0058] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0059] The experimental methods in the following examples where specific conditions are not specified are usually based on conventional conditions, "Molecular Cloning Experiment Guide" (4th edition) edited by J. Sambrook and MR Green, translated by He Fuchu et al., or the conditions recommended by the manufacturer's instructions.

[0060] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0061] Although the following description is based on the use of the artificial enhancer element in eukaryotic cells to increase the transcription level of the fluorescent reporter enzyme, the present invention is generally applicable to other mammalian cells and mice, including the transformation of wild-type mice and the preparation of humanized antibody mice.

[0062] The present invention is further described in detail below with reference to specific embodiments.

[0063] Example 1: Design and assembly of A(n) enhancer elements

[0064] 1. A 1085 bp Aa product was obtained from W129S mouse genomic DNA by PCR amplification, and the amplified product was cloned into pUC19 plasmid using HindIII restriction site. MaxDNA Polymerase standard reaction system, 50ul PCR reaction system includes: 10ng genomic DNA template, 25ul 2×PrimeSTAR Max Premix, 2ul PCR primers (1ul each of forward primer and reverse primer, concentration is 10uM), add dd water to 50ul. PCR reaction program: 98℃ denaturation 10sec, 55℃ renaturation 15sec, 72℃ extension 60sec, a total of 35 cycles. Construct pUC19-Aa plasmid. The positive pUC19-Aa plasmid identified by restriction endonuclease was sequenced, and the sequencing sequence is SEQID NO: 1.

[0065] 1. Eμ sequencing results

[0066] Ctagagaggtctggtggagcctgcaaaagtccagctttcaaaggaacacagaagtatgtgtatggaatattagaagatgttgcttttactcttaagttggttcctaggaaaaatagttaaatactgtgactttaaaatgtgagagggttttcaagtactcatttttttaaat gtccaaaatttttgtcaatcaatttgaggtcttgtttgtgtagaactgacattacttaaagtttaaccgaggaatgggagtgaggctctctcataccctattcagaactgacttttaacaataataaattaagtttaaaatatttttaaatgaattgagcaatgttgagttgg agtcaagatggccgatcagaaccagaa cacctgcagcagctggcaggaagcaggtcatgtggcaaggctatttggggaagggaaaataaaaccactaggtaaa cttgtagctgtggtttgaagaagtggttttgaaacactctgtccagccccaccaaaccgaaagtccaggctgagcaaaacaccacctgggtaatttgcatttctaaaataagttgaggatt cagccgaaactggagaggtcctcttttaacttattgagttcaaccttttaattttagcttgagtagttctagtttccccaaacttaagtttatcgacttctaaaatg tatttagaattcattttcaaaattaggttatgtaagaaattgaaggactttagtgtctttaatttctaatatatttagaaaacttcttaaaattactctattattctt ccctctgattattggtctccattcaattcttttccaatacccgaagcatttacagtgactttgttcatgatcttttttagttgtttgttttgccttactattaagact ttgacattctggtcaaaacggcttcacaaatctttttcaagaccactttctgagtattcattttaggagaaatactttttttttaaatgaatgcaattatctag(SEQ ID NO: 1).

[0067] Note: The total length of the Eμ sequence is 996 bp, of which the base sequence marked in yellow is the 220 bp core enhancer region (cEμ), which has been identified as being derived from 129S mice (NCBI Reference Sequence: NT_114985.3). Note: The bases marked in blue are inconsistent with the Eμ sequencing results (W129S mice), with a total of 6 bp.

[0068] The specific primers used in PCR are as follows:

[0069] Forward primer P-F1:

[0070] ACCTGCAGGCATGCAaagctttacaaatgtggtaaaatcgataaggatccctagagaggtctggtggagcc(SEQ ID NO.3)

[0071] Reverse Primer P-R1:

[0072] TGACCATGATTACGCCAaagcttcaccagacctctctagctagataattgcattcatttaaaaaaaaagtatttctcctaaaatgaa(SEQ ID NO.4)

[0073] 2. The Ab product with a length of 1045 bp was obtained from the genomic DNA of W129S mice by PCR amplification, and the amplified product was cloned into the pGL3-SV40P plasmid using BamHI and SalI restriction endonucleases. Max DNA Polymerase standard reaction system, 50ul PCR reaction system includes: 10ng genomic DNA template, 25μl 2×PrimeSTAR Max Premix, 2μl PCR primers (1ul each of forward primer and reverse primer, concentration is 10μM), supplemented with dd water to 50ul. PCR reaction program: 98℃ denaturation for 10sec, 55℃ renaturation for 15sec, 72℃ extension for 60sec, a total of 35 cycles. The pGL3-SV40P-Ab plasmid was constructed. The positive pGL3-SV40P-Ab plasmid identified by restriction endonuclease was sequenced, and the sequencing sequence was SEQ ID NO: 2.

[0074] 2. C57BL / 6J mouse Eμ sequence (NCBI Reference Sequence: NC_000078.7)

[0075] CTAGAGAGGTCTGGTGGAGCCTGCAAAAGTCCAGCTTTCAAAGGAACAGAAGTATGTGTATGGAATATTAGAAGATGTTGCTTTTACTCTTAAGTTGGTTCCTAGGAAAAATAGTTAAATACTGTGACTTTAAAATGTGAGAGGGTTTTCAAGTACTCATTTTTTTAAATGTCCAAAATT C TTGTCAATCA G TTTGAGGTCTTGTTTGTGTAGAACTGA T ATTACTTAAAGTTTAACCGAGGAATGGGAGTGAGGCTCTCTCATA A CCTATTCAGAACTGACTTTTAACAATAATAAATTAAGTTT C AAATATTTTAAATGAATTGAGCAATGTTGAGTTGG AGTCAAGATGGCCGATCAGAACCAGAA CACCTGCAGCAGCTGGCAGGAAGCAGGTCATGTGGCAAGGCTATTTGGGGAAGGGAAAATAAAACCACTAGGTAAA CTTGTAGCTGTGGTTTGAAGAAGTGGTTTTGAAACACTCTGTCCAGCCCCACCAAACCGAAAGTCCAGGCTGAGCA AAACACCACCTGGGTAATTTGCATTTCTAAAATAAGTTGAGGATTCAGCCGAAACTGGAGAGGTCCTCTTTTAACTTATTGAGTTCAACCTTTTAATTTTAGCTTGAGTAGTTCTAGTTTCCCCAAACTTAAGTTTATCGACTTCTAAAATGTATTTAGAATTCATTTTCAAAATTAGGTTATGTAAGAAATTGAAGGACTTTAGTGTCTTTAATTTCTAATATATTTAGAAAACTTCTTAAAATTACTCTATTATTCTTCCCTCTGATTATTGGTCTCCATTCAATTCTTTTCCAATACCCGAAGCATTTACAGTGACTTTGTTCATGATCTTTTTTAGTTGTTTGTTTTGCCTTACTATTAAGACTTTGACATTCTGGTCAAAACGGCTTCACAAATCTTTTTCAAGACCACTTTCTGAGTATTCATTTTAGGAGAAA G ACTTTTTTTTTAAATGAATGCAATTATCTAG(SEQ ID NO:2),

[0076] The specific primers used for PCR are as follows:

[0077] Forward primer P-F2:

[0078] tacaatgtggtaaaatcgataaggatccctagagaggtctggtggagcc(SEQ ID NO:5)

[0079] Reverse primer P-R2

[0080] tctcaagggcatcggtcgacctagataattgcattcatttaaaaaaaaagtatttctcctaaaat(SEQID NO:6).

[0081] 3. After sequence alignment, the identity of Aa and Ab sequences is 100%, and the identity with the published W129S mouse Eμ enhancer sequence (NCBI Reference Sequence: NT_114985.3) is 100%, and the identity with the published C57BL / 6J mouse Eμ sequence (NCBI Reference Sequence: NC_000078.7) is 99.6%. The 220bp Eμ core region sequence of the three is exactly the same. Therefore, the present invention amplified the 996bp Eμ enhancer element derived from the homozygous strain W129S mouse, that is, a single A.

[0082] 4. The pUC19-Aa plasmid was digested with Hind III to recover a 1047bp DNA fragment. At the same time, the pGL3-SV40P-Ab plasmid was linearized (BamHI), a 6012bp DNA fragment was recovered, and pGL3-SV40P-A(n) was constructed by HiFi seamless assembly strategy. The reaction system was: 100ng of each purified DNA fragment, 10μl 2×Seamless cloningMasterMix, and dd water was added to 20μl. The reaction conditions were: 50℃ for 20min.

[0083] By repeating the above steps, pGL3-SV40P-A(2), pGL3-SV40P-A(3) and pGL3-SV40P-A(n) can be efficiently assembled on the basis of pGL3-SV40P-Ab, where n refers to the number of copies of the A element, and pGL3-SV40P-Ab is pGL3-SV40P-A(1). Similarly, using this assembly strategy, A(n) can be efficiently cloned into any eukaryotic expression vector and assembled into Px-A(n), where n is the number of copies of A, which is an integer from 1 to 10.

[0084] Figure 4 (A) is the restriction enzyme digestion identification diagram of pUC19-Aa

[0085] The order of nucleic acid electrophoresis lanes from left to right:

[0086] The first lane is 10000bp DNA Marker;

[0087] The second lane is the pUC19-Aa original plasmid;

[0088] The third lane is the pUC19-Aa plasmid digested with Sma I enzyme, i.e., cut into a fragment with a size of 3735 bp;

[0089] The fourth lane is a single digestion of pUC19-Aa plasmid with Hind III enzyme, i.e., it is cut into two fragments with sizes of 2688 bp and 1047 bp respectively;

[0090] The fifth lane is a 5000 bp DNA Marker.

[0091] Figure 4(B) is a diagram showing restriction enzyme digestion identification of pGL3-SV40P-A(1), pGL3-SV40P-A(2), pGL3-SV40P-A(3), and pGL3-SV40P-A(4)

[0092] The order of nucleic acid electrophoresis lanes from left to right:

[0093] The first lane is 10000bp DNA Marker;

[0094] The second lane is the original plasmid pGL3-SV40P-A (1);

[0095] The third lane is the pGL3-SV40P-A (1) plasmid subjected to single restriction digestion with Hind III enzyme, i.e., cut into a fragment with a size of 6012 bp;

[0096] The fourth lane is pGL3-SV40P-A (1) plasmid double digested with Hind III and BamH I, i.e. cut into two fragments with sizes of 4061 bp and 1951 bp respectively;

[0097] The fifth lane is pGL3-SV40P-A (1) plasmid double digested with Sal I and BamH I, i.e. cut into two fragments with sizes of 5010 bp and 1002 bp respectively;

[0098] The sixth lane is the original plasmid pGL3-SV40P-A (2);

[0099] The seventh lane is the pGL3-SV40P-A (2) plasmid subjected to single restriction digestion with Hind III enzyme, i.e., cut into a fragment with a size of 7008 bp;

[0100] The eighth lane is pGL3-SV40P-A (2) plasmid double digested with Hind III and BamH I, i.e. cut into two fragments with sizes of 5057 bp and 1951 bp respectively;

[0101] The ninth lane is pGL3-SV40P-A(2) plasmid double-digested with Sal I and BamH I, i.e. cut into two fragments with sizes of 5010 bp and 1998 bp respectively;

[0102] The tenth lane is the original plasmid pGL3-SV40P-A (3);

[0103] Lane 11 shows the pGL3-SV40P-A (3) plasmid digested with Hind III, i.e., cut into a fragment with a size of 8004 bp;

[0104] Lane 12 shows pGL3-SV40P-A (3) plasmid was double-digested with Hind III and BamH I, i.e., cut into two fragments with sizes of 6053 bp and 1951 bp, respectively;

[0105] Lane 13 shows the pGL3-SV40P-A (3) plasmid double-digested with Sal I and BamH I, i.e., cut into two fragments with sizes of 5010 bp and 2994 bp, respectively;

[0106] Lane 14 is the original plasmid pGL3-SV40P-A (4);

[0107] Lane 15 shows the pGL3-SV40P-A (4) plasmid digested with Hind III, i.e., cut into a fragment with a size of 9000 bp;

[0108] Lane 16 shows pGL3-SV40P-A (4) plasmid was double-digested with Hind III and BamH I, i.e., cut into two fragments with sizes of 7049 bp and 1951 bp, respectively;

[0109] Lane 17 shows that the pGL3-SV40P-A (4) plasmid was double-digested with Sal I and BamH I, i.e., cut into two fragments with sizes of 5010 bp and 3990 bp, respectively;

[0110] The eighteenth lane is a 5000 bp DNA Marker.

[0111] Example 2. A(n) enhancer element directs in vitro expression of fluorescent reporter enzyme

[0112] (1) Culture and plating of mouse myeloma cells P3X63Ag8: When the cell density is greater than 90%, the cells are passaged, the original culture medium is discarded, and after washing with PBS buffer, 1640 culture medium (15% fetal bovine serum, 1% double antibody) is added, and the cells are blown off with a pipette. The cell suspension is collected, centrifuged at 800 rpm for 5 min, the supernatant is discarded, 1 ml of 1640 culture medium (15% fetal bovine serum, 1% double antibody) is added to resuspend the cells, and an appropriate amount of cells is inoculated in a 6-well plate, 2 ml of 1640 culture medium (15% fetal bovine serum, 1% double antibody) is added to each well, and cultured in a 37°C, 5% CO2 incubator.

[0113] (2) Transfection: Take 4ug of each of the plasmid DNA of pGL3-SV40P-A(1), pGL3-SV40P-A(2), pGL3-SV40P-A(3), pGL3-SV40P-A(4) and pGL3-SV40P, and add the internal reference plasmid pRL-SV40P to each tube. 400ng, diluted to 190ul with GibcoOPTI-MEM, and mixed by pipetting with a pipette; 10ul / tube of PEI (1ug / ul) was taken, mixed with the plasmid DNA solution by pipetting, and incubated for 15-25min; a P3X63Ag8 cell culture plate with a density of about 80% was taken, the original culture medium was discarded, and after washing with PBS buffer, the incubated solution was mixed with 1.8ml / tube of 1640 culture medium (15% fetal bovine serum), and the solution in each tube was added to each culture well and gently shaken to mix so that the mixture was in full contact with the cells, and then marked; after culturing in a 37°C, 5% CO2 incubator for 48h, the cells were collected for dual fluorescence detection.

[0114] (3) Dual luciferase assay: 48 hours after transfection, discard the original culture medium, wash the cells with 1 ml PBS / well and discard, add 200 ul / well of Beyotime luciferase lysis solution, shake the culture plate gently to completely cover the cells, and lyse at room temperature for 30 minutes. After the cells are completely lysed, collect the cell lysate and collect the supernatant by centrifugation; 100 ul / well, duplicate wells, take the cell lysate and add it to a white 96-well plate. Add 100 ul / well of Dual Lumi TM II Firefly Luciferase Detection Reagent, mix well and perform chemiluminescence detection; mix appropriate amount of Dual Lumi TM II Renilla luciferase assay substrate and Dual Lumi TM II Renilla luciferase assay buffer, prepare an appropriate amount of Dual Lumi TM II Renilla luciferase detection reagent; 100ul / well added to the prepared Dual Lumi TM II Renilla luciferase assay reagent, after proper mixing, perform chemiluminescence detection; divide the RLU value obtained by the firefly luciferase assay by the RLU value obtained by the Renilla luciferase assay. Compare the activation degree of the reporter gene between different plasmids based on the obtained ratio to evaluate the enhancement activity of the artificially constructed super enhancer.

[0115] The relative fluorescence intensity results are shown in the bar graph (to 2Eμ). Figure 5 .from Figure 5 It can be seen that

[0116] When n is 2, the RLU value is much greater than the value when n is 1, indicating that the artificial super enhancer and enhancer constructed by the present invention have good enhancement activity.

[0117] Example 3. Construction and identification of B1-A(n)-CDC-B2-E gene targeting vector

[0118] 1. Obtain and synthesize the CDC sequence from the public gene library. C is the loxP sequence. After the Cre recombinase is introduced, the positive selection gene can be removed.

[0119] D is a positive selection marker gene element cassette, which is a neomycin phosphotransferase (NPT II) gene in this embodiment;

[0120] A CDC product of 1841 bp in length was obtained by PCR amplification (primers were p-F3 / p-R3), and the amplified product was cloned into the pUC19 plasmid using Sal I and Kpn I restriction endonucleases to construct pUC19-CDC. A B2 product of 1364 bp in length was obtained from bacterial artificial chromosome RP11-154H17 by PCR amplification (primers were p-F4 / p-R4), and the amplified product was cloned into the pUC19-CDC plasmid using KpnI restriction endonuclease to construct pUC19-CDC-B2.

[0121] A 1349 bp B1 product was obtained from bacterial artificial chromosome RP11-154H17 by PCR amplification (primers: p-F5 / p-R5), and the amplified product was cloned into the pUC19-CDC-B2 plasmid using Sal I restriction endonuclease to construct pUC19-B1-CDC-B2.

[0122] B1 and B2 are the homology arm sequences upstream and downstream of the Eμ enhancer in the W129S mouse genome, respectively;

[0123] The E sequence was obtained and synthesized from a public gene library, and an E product with a length of 1877 bp was obtained by PCR amplification (primers: p-F6 / p-R6), and the amplified product was cloned into the pUC19-B1-CDC-B2 plasmid using EcoR I restriction endonuclease to construct pUC19-B1-CDC-B2-E.

[0124] E is a negative selection marker gene element cassette, which in this example is herpes simplex virus thymidine kinase (HSV-TK).

[0125] The specific primers used in PCR are as follows:

[0126] <h2 style=";text-align:left;direction:ltr">p-F3(62-mer):<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0127] <h2 style=";text-align:left;direction:ltr"> ttgcatgcctgcaggtcgacTCGACataacttcgtataatgtatgctatacgaagttataag(SEQIDNO:7)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0128] <h2 style=";text-align:left;direction:ltr"> p-R3(60-mer):<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0129] <h2 style=";text-align:left;direction:ltr"> gaattcgagctcggtaccGTACCataacttcgtatagcatacattatacgaagttatcc(SEQIDNO:8)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0130] <h2 style=";text-align:left;direction:ltr"> p-F4(47-mer):<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0131] <h2 style=";text-align:left;direction:ltr"> cgaagttatGGTACggtacacttatttcagttgaacatgctggttgg(SEQ ID NO:9)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0132] <h2 style=";text-align:left;direction:ltr"> p-R4(39-mer):<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0133] <h2 style=";text-align:left;direction:ltr"> gaattcgagctcggtacggtaccagcggcccagctcatt(SEQ ID NO:10)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0134] <h2 style=";text-align:left;direction:ltr"> p-F5(36-mer):<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0135] <h2 style=";text-align:left;direction:ltr"> ttgcatgcctgcaggtaccccagcattgccgctagg(SEQ ID NO:11)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0136] <h2 style=";text-align:left;direction:ltr"> p-R5(63-mer):<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0137] <h2 style=";text-align:left;direction:ltr"> cattatacgaagttatGTCGAgtcgactctagaggatccacagcaactacccttttgagaccg(SEQID NO:12)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0138] <h2 style=";text-align:left;direction:ltr"> p-F6(30-mer):<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0139] <h2 style=";text-align:left;direction:ltr"> ACCGTACCGAGCTCGGGGTACCGGGTAGGG(SEQ ID NO:13)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0140] <h2 style=";text-align:left;direction:ltr"> p-R6(29-mer):<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0141] <h2 style=";text-align:left;direction:ltr"> AAACGACGGCCAGTGCCCAGTCACGACGT(SEQ ID NO:14)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0142] 2. The pGL3-SV40P-A(n) constructed in Example 1 was subjected to BamHI and SalI restriction enzyme digestion reaction, and the A(n) fragment was recovered. The pUC19-B1-CDC-B2-E plasmid was linearized by BamHI and SalI restriction endonucleases at the same time, and the 8957bp DNA fragment was recovered. The pUC19-B1-A(n)-CDC-B2-E was constructed by restriction enzyme digestion and ligation. The reaction system was: 100ng of each purified DNA fragment, 1μl T4 ligase, and dd water was added to 20μl. The reaction conditions were: 16°C overnight reaction.

[0143] After successful transformation, the plasmid was digested and identified and named as targeting vector-A(n);

[0144] Figure 4 (C) is a targeting vector-A (1) 、 Targeting Vector-A(2) 、 Targeting Vector-A(3) 、 Targeting vector-A(4) enzyme digestion identification diagram.

[0145] The order of nucleic acid electrophoresis lanes from left to right:

[0146] The first lane is 5000 bp DNA Marker;

[0147] The second lane is the original plasmid of targeting vector-A(1);

[0148] The third lane is the targeting vector-A(1) plasmid subjected to single restriction digestion with Sal I enzyme, i.e., cut into a fragment with a size of 9947 bp;

[0149] The fourth lane is the targeting vector-A(1) plasmid double-digested with Sal I and BamH I, i.e. cut into two fragments with sizes of 8945 bp and 1002 bp respectively;

[0150] The fifth lane is the original plasmid of targeting vector-A(2);

[0151] The sixth lane is the targeting vector-A(2) plasmid subjected to single restriction digestion with Sal I enzyme, i.e., cut into a fragment with a size of 10943 bp;

[0152] The seventh lane is the targeting vector-A(2) plasmid double-digested with Sal I and BamH I, i.e. cut into two fragments with sizes of 8945 bp and 1998 bp respectively;

[0153] The eighth lane is 10000 bp DNA Marker;

[0154] The ninth lane is the original plasmid of targeting vector-A(3);

[0155] The tenth lane is the targeting vector-A (3) plasmid subjected to single restriction digestion with Sal I enzyme, i.e., cut into a fragment with a size of 11939 bp;

[0156] Lane 11 shows the targeting vector-A(3) plasmid double-digested with Sal I and BamH I, i.e., cut into two fragments with sizes of 8945 bp and 2994 bp, respectively;

[0157] Lane 12 is the original plasmid of targeting vector-A(4);

[0158] Lane 13 shows the targeting vector-A (4) plasmid subjected to single restriction digestion with Sal I enzyme, i.e., cut into a fragment with a size of 12935 bp;

[0159] Lane 14 shows the targeting vector-A(4) plasmid double-digested with Sal I and BamH I, i.e., cut into two fragments with sizes of 8945 bp and 3990 bp, respectively;

[0160] The fifteenth lane is a 15000bp DNA Marker. 3. Use SmaI restriction endonuclease to linearize the targeting vector-A(n) plasmid (n=1, 2, 3, 4), and introduce it into W129S mouse embryonic stem cells by electroporation. Use G418 and GANC positive and negative pressure screening to obtain ES cells with successful site-specific integration. Introduce the positive ES cells into the inner cell mass of the host blastocyst before implantation by microinjection, and then transplant the embryo into the uterus of a pseudopregnant mother mouse to obtain offspring chimeric mice. Hybridize the chimeric mice with specific Cre mice, knock out the marker gene D, and obtain homozygous mice of A(n) through parental inheritance.

[0161] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. An artificial enhancer element, characterized in that Its structure is A(n), wherein the sequence of A is shown in SEQ ID NO: 1, or is a sequence having at least 90% identity or homology with SEQ ID NO: 1; n is the copy number of A, and n is an integer between 1-10.

2. The artificial enhancer element according to claim 1, characterized in that In A(n), n is 1, 2, 3, 4 or 5, preferably 2.

3. An artificial enhancer element assembly, characterized in that It has the following structure: B1-(A)nCDC-B2-E, where: ① A is an artificial enhancer element, the sequence of which is as shown in SEQ ID NO: 1, or a sequence having at least 90% identity or homology with SEQ ID NO: 1, and n is an integer between 1 and 10; ② B1 or B2 is the DNA sequence at both ends of the artificial enhancer element, including the mouse chromosome homologous sequence, and its length is 0.2kb-20kb; ③C is the loxP sequence, which can remove the positive selection gene after the introduction of Cre recombinase; ④D is a positive selection marker gene element box, including a marker gene, a promoter element for directing the expression of the gene, and a polylysine signal poly (A); ⑤E is a negative selection marker gene element box, including a marker gene, a promoter element that directs the expression of the gene, and a polylysine signal poly (A).

4. The artificial reinforcement element assembly according to claim 3, characterized in that: In A(n), n is 1, 2, 3, 4 or 5, preferably 2.

5. The artificial reinforcement element assembly according to claim 3, characterized in that: The positive selection marker gene includes one or more of a neomycin phosphotransferase gene, a hygromycin B phosphotransferase gene and a PAC gene encoding puromycin N-acetyltransferase.

6. The artificial reinforcement element assembly according to claim 3, characterized in that: The length of the mouse chromosome homologous sequence is 0.5kb-5kb.

7. Use of the artificial enhancer element according to claim 1 or 2 or the artificial enhancer assembly according to any one of claims 4 to 6 in constructing a targeting vector.

8. A targeting vector comprising the artificial enhancer component according to any one of claims 4 to 6.

9. The method for constructing an artificial enhancer assembly according to claim 8, characterized in that: The following steps are involved: Construction of pUC19-Aa plasmid with artificial enhancer inserted; Constructing a pGL3-SV40P-Ab plasmid into which the sequence shown in SEQ ID NO: 2 is inserted; The pUC19-Aa plasmid was subjected to Hind III digestion reaction to recover a 1047 bp DNA fragment; at the same time, the pGL3-SV40P-An plasmid was linearized to recover a 6012 bp DNA fragment, and pGL3-SV40P-A(n) was constructed by HiFi seamless assembly, where n is the number of copies of A, and n is an integer between 1 and 10; The CDC product with a length of 1841 bp was obtained by PCR amplification and cloned into the pUC19 plasmid to construct pUC19-CDC; The bacterial artificial chromosome RP11-154H17 was cloned as B2 into the pUC19-CDC plasmid to construct pUC19-CDC-B2; The E fragment was cloned into the pUC19-B1-CDC-B2 plasmid to construct pUC19-B1-CDC-B2-E, which was linearized and the target DNA fragment was recovered; pGL3-SV40P-A(n) was digested with enzymes, and the target DNA fragment was connected to construct the pUC19-B1-A(n)-CDC-B2-E targeting vector.

Images