Long-chain RNA Lnc_012227 for inhibiting ovary transmission of salmonella enteritidis and application thereof in preventing and controlling salmonella enteritidis infection
By regulating the signaling pathway using a specific long RNA Lnc_012227, the problem of Salmonella enteritidis transmission and infection in avian ovaries was solved, thereby improving the safety and yield of duck eggs.
Patent Information
- Application Number
- CN202510054681.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-14
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2045-01-14
AI Technical Summary
Existing technologies are insufficient to effectively control the spread and infection of Salmonella enteritidis in poultry ovaries, leading to decreased egg production and increased risk of human infection. Traditional methods such as antibiotic treatment and vaccination have problems with drug resistance and limited protective effects.
By employing a specific long non-coding RNA, Lnc_012227, the expression of MAP3K8 is competitively regulated by miR-let-7g-5p, thereby activating the NF-κB and MAPK signaling pathways, enhancing the host's inflammatory response, and thus inhibiting the ovarian transmission of Salmonella enteritidis.
It effectively inhibits the spread of Salmonella enteritidis in duck ovaries, reduces duck egg contamination, provides new molecular mechanisms and diagnostic tools, and improves the reproductive performance of laying ducks and public health safety.
Smart Images

Figure CN119979533B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a long RNA Lnc_012227 that inhibits the ovarian transmission of Salmonella enteritidis and its application in the prevention and control of Salmonella enteritidis infection. Background Technology
[0002] Salmonella enteritidis is a widespread foodborne pathogen in poultry. It can colonize the pre-ovulatory follicles of avian eggs, leading to reduced egg production and increasing the risk of salmonellosis in humans through consumption of contaminated eggs. Vertical transmission and environmental contamination are the main pathways for Salmonella contamination in the duck egg industry, posing a serious threat to poultry farming and public health. Currently, traditional methods for controlling Salmonella infection mainly include antibiotic treatment and vaccination. However, these methods suffer from problems such as the development of drug resistance and limited vaccine protection. Studies have confirmed that Salmonella enteritidis can easily cause latent infection and colonize tissues such as the ovaries of adult poultry, not only causing a decrease in egg production but also easily leading to direct contamination of eggs and vertical transmission, making it difficult to eradicate and control. Therefore, finding new and effective strategies to control Salmonella infection and transmission is particularly important.
[0003] In recent years, the role of non-coding RNAs (ncRNAs), especially long non-coding RNAs (lncRNAs), in regulating host-pathogen interactions has been increasingly recognized. lncRNAs participate in regulating various biological processes, including immune responses and pathogen infection, by interacting with miRNAs or influencing gene expression. Studies have shown that specific lncRNAs can affect pathogen infection efficiency and transmission by regulating signaling pathways within host cells. Recent findings include: lncRNA NEAT1 interacting with the HIV-1 Rev protein, affecting viral mRNA nuclear export and translation, and regulating the viral replication cycle; lncRNA H19 participating in the regulation of host metabolism and inflammatory responses, affecting pathogen infection efficiency; lncRNA MALAT1 regulating the host's immune response to influenza virus by binding to miR-1246; lncRNA GAS5 regulating the glucocorticoid signaling pathway, affecting the host's inflammatory response; lncRNA PVT1 interacting with the HBV X protein, promoting viral replication; and lncRNA NAMEG3 affecting the viral life cycle by regulating the host cell apoptosis pathway. The regulatory roles of these lncRNAs demonstrate their complexity and diversity in host-pathogen interactions and provide potential targets for developing new therapeutic strategies.
[0004] However, current research on the transmission mechanisms of Salmonella enteritidis infection, particularly in the ovaries of laying ducks, and related long non-coding RNAs (lncRNAs) is relatively limited. Therefore, there is an urgent need to deepen research on lncRNAs in duck ovaries, especially those that may be involved in regulating Salmonella infection. Improving our understanding of these specific lncRNAs will not only help us gain a deeper understanding of the immune regulatory mechanisms by which duck ovaries resist Salmonella enteritidis infection, but also provide theoretical support for developing new strategies to inhibit the ovarian transmission of Salmonella and reduce egg contamination, thereby improving the reproductive performance of laying ducks and public health safety. Summary of the Invention
[0005] The purpose of this invention is to provide a specific long non-coding RNA (lncRNA) Lnc_012227, which plays an important role in inhibiting Salmonella enteritidis infection, ovarian transmission, and reducing duck egg contamination.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] This invention provides a long RNA Lnc_012227 that inhibits the ovarian transmission of Salmonella enteritidis, the nucleotide sequence of the cDNA encoded by the long RNA Lnc_012227 being shown in SEQ ID NO: 1.
[0008] This invention also provides the application of the long RNA Lnc_012227 in the prevention and control of Salmonella enteritidis infection.
[0009] Preferably, the prevention and control of Salmonella enteritis infection refers to the prevention and control of Salmonella infection in the ovaries of laying ducks.
[0010] The present invention also provides an expression vector, comprising an initial vector and the long RNA Lnc_012227 described herein.
[0011] Preferably, the expression vector is an overexpression vector.
[0012] Preferably, the initial vector is pcDNA3.1.
[0013] Preferably, the nucleotide sequence of the expression vector is shown in SEQ ID NO: 6.
[0014] The present invention also provides a host, which is transformed or transfected with the expression vector described above; the host is a microorganism.
[0015] The present invention also provides the application of the expression vector or the host in the prevention and control of Salmonella enteritidis infection.
[0016] Preferably, the prevention and control of Salmonella enteritis infection refers to the prevention and control of Salmonella infection in the ovaries of laying ducks.
[0017] Compared with the prior art, the present invention has the following beneficial effects:
[0018] (1) This invention reveals the role of a specific long non-coding RNA (lncRNA) Lnc_012227 in duck ovarian tissue infected with Salmonella enteritidis, providing a novel molecular mechanism for understanding and controlling Salmonella infection in laying duck ovaries. Lnc_012227 can compete with miR-let-7g-5p to indirectly regulate MAP3K8 expression, activate NF-κB and MAPK signaling pathways, and enhance the host's inflammatory response, thereby controlling S. enteritidis infection. This discovery not only provides new molecular-level insights into the infection mechanism of Salmonella in ducks but also provides a potential target for developing new therapeutic strategies, helping to reduce Salmonella-induced ovarian infection and egg contamination in laying ducks.
[0019] (2) This invention provides a novel molecular marker by identifying the expression pattern of Lnc_012227 in duck ovarian tissue infected with Salmonella enteritidis. Using a designed specific quantitative real-time PCR primer pair and kit, the invention identifies a significant increase in Lnc_012227 expression in duck ovarian tissue infected with Salmonella enteritidis. This provides a novel molecular marker that can be used to diagnose and monitor Salmonella infection in duck ovaries. This characteristic can serve as a reference for assessing the resistance potential of offspring, providing a new strategy and tool for the prevention and control of Salmonella infection in the duck laying industry, and contributing to improving the reproductive performance of ducks and the safety of duck eggs. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0021] Figure 1 The relative quantitative expression results of the duck long RNA Lnc_012227 gene in the primer pair and detection kit provided in Example 2 of this invention are shown. The expression levels of Lnc_012227 are shown for uninfected, infected (MOI = 1:10), and infected (MOI = 1:50).
[0022] Figure 2Anatomical diagrams of an ovarian-susceptible individual (A) and an ovarian-unsusceptible individual (B) in Example 3.
[0023] Figure 3 Example 3 describes the use of real-time quantitative PCR primer pairs and a detection kit to detect the expression level of Lnc_012227 in duck long RNA Lnc_012227 in the infected population, comparing ovarianly susceptible and ovarianly susceptible individuals.
[0024] Figure 4 This is a schematic diagram of the pcDNA3.1 vector in the duck long RNA Lnc_012227 gene overexpression vector provided in Example 4.
[0025] Figure 5 The image shows the colony PCR electrophoresis results of the duck long RNA Lnc_012227 gene overexpression vector provided in Example 4; the figure is labeled as follows: lane M is the DL2000 DNA marker, and lanes 1 and 2 are the bacterial amplification fragments of the long RNA Lnc_012227 overexpression vector.
[0026] Figure 6 This shows the changes in the expression of the long RNA Lnc_012227 gene in the overexpression plasmid group and the empty vector group after transfecting duck long RNA Lnc_012227-pcDNA3.1 (overexpression plasmid group) and pcDNA3.1 (empty vector group) in Example 4.
[0027] Figure 7 This is a comparison of the amount of intracellular bacterial invasion in the overexpression plasmid group and the empty vector group after overexpression of long RNA Lnc_012227 in Example 5.
[0028] Figure 8 This section describes the changes in mRNA expression of key genes in the NF-κB and MAPK signaling pathways (MAP3K8), pro-inflammatory genes (TNF-α, IL-1β, IL-6), and anti-inflammatory genes (IL-10) in the overexpression vector group and the empty vector group after overexpression of duck long RNA Lnc_012227 in Example 5. Compared with the empty vector transfection group, the expression levels of NF-κB and MAPK signaling pathway key genes (MAP3K8), pro-inflammatory genes (TNF-α, IL-1β, IL-6), and anti-inflammatory gene (IL-10) mRNA in cells overexpressing duck long RNA Lnc_012227 were significantly increased, while the expression level of anti-inflammatory gene (IL-10) mRNA was significantly decreased.
[0029] Figure 9To validate the binding target of RNA miR-let-7g-5p to MAP3K8-UTR or long RNA Lnc_012227. (A) Validation of potential binding sites of miR-let-7g-5p on MAP3K8-UTR. Blue letters indicate wild-type sites, and red letters indicate mutation sites in the pMir-report luciferase reporter vector. Luciferase assays were performed in cells co-transfected with pMir-report-MAP3K8-UTR-WT (wild-type) and miR-let-7g-5p mimics or pMir-MAP3K8-UTR-MUT (mutant) and miR-let-7g-5p mimics. Results showed that miR-let-7g-5p could bind to MAP3K8-3'UTR, reducing luciferase activity, while mutation at this site had no effect. (B) Potential binding sites of miR-let-7g-5p on long RNA Lnc_012227. Blue letters indicate wild-type sites, and red letters indicate mutation sites in the pMir-report luciferase reporter vector. Luciferase assays were performed in cells co-transfected with pMir-LNC_012227-WT (wild-type) and miR-let-7g-5p mimics or pMir-LNC_012227-MUT (mutant) and miR-let-7g-5p mimics. Results showed that miR-let-7g-5p could bind to the long RNA Lnc_012227, reducing luciferase activity, while mutation at this site had no effect. Detailed Implementation
[0030] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0031] Example 1: Cloning and sequence verification of the Lnc_012227 gene
[0032] The cDNA sequence corresponding to the duck long-chain Lnc_012227 described in this embodiment is shown in SEQ ID NO: 1. The duck long-chain Lnc_012227 of this invention is a novel LncRNA molecule obtained by the applicant based on the whole transcriptome sequencing results of duck follicular granulosa cells infected with Salmonella enteritidis, through extensive bioinformatics analysis and screening of sequencing results from follicular granulosa cell samples at different time points (0 hpi, 3 hpi, 6 hpi, 9 hpi). The applicant named it duck long-chain Lnc_012227, and the cDNA sequence corresponding to the duck long-chain Lnc_012227 is 402 bp in length.
[0033] The specific method was as follows: Ovarian tissue samples were collected from laying ducks infected with Salmonella enteritidis. Total RNA was extracted from the follicle tissue using the traditional TRIzol and chloroform methods. RNA concentration and OD values were detected using a NanoDrop 1000 micro-spectrophotometer, and RNA integrity was assessed using 1% agarose gel electrophoresis. cDNA templates were obtained through reverse transcription using the Vazyme HiScript IIIRT SuperMix for qPCR (+gDNA wiper). Primers were designed based on the full-length fragment of the Lnc_012227 gene sequence obtained from the whole transcriptome sequencing results.
[0034] Lnc_012227-F:aagctggctagttaagcttATGAGTAATATCTCTGGGCTCGCT;
[0035] SEQ ID NO: 2;
[0036] Lnc_012227-R:tagtcgaagggccctctagaTTATCCTCTGCCAGTGCTGAAA;
[0037] SEQ ID NO: 3;
[0038] The restriction enzyme sites were Hind III and Xba I, and PCR amplification was performed. The obtained PCR product was purified and sequenced to verify the sequence correctness. The results showed that the cDNA sequence corresponding to the long chain Lnc_012227 was 402 bp in length, and the sequencing results were completely consistent with the expectations.
[0039] SEQ ID NO: 1
[0040] >LNC_012227
[0041] ATGAGTAATATCTCTGGGCTCGCTGTGCTAACATTAGGTCTAGGGAGAACTAATCTCTTGAAGGAGAACGTGATCCGAGCAGAGCTGCCCTTCCCCAAACAAAAGCCCCGCTCGAACGTGGCACAGAGCACTGACGTGAGCTTGCTTCTGTTTGCTGACAGTGCACTAAATTCACTAAATATCCGGGCCTCTTCCCGGCAC AGGGCTGCACAGGCCTGGAGGAGACCAGCATTGACATGCACTTCATTTATGCCCTGTAATAAGGTGAGAAGAGTGGGGTGGCTCCGGGTCATCTGCAACAAAGCCTGCATGGCAAAACTGACCCCCAGGAAGGTTTGGCTGGTGTGCATGCAGGGCAGGCCAGGCGGGGAGCTGTATTTCAGCACTGGCAGAGGATAA
[0042] Example 2: Quantitative real-time PCR detection of Lnc_012227 gene in duck follicular granulosa cells at different infection times
[0043] 1. Isolation and culture of granulosa cells from duck ovarian follicles:
[0044] (1) Treatment of female ducks: Select laying ducks at the peak of egg production, bleed them out of their jugular veins and kill them; remove the entire ovarian tissue and place it in a sterile culture dish containing pre-cooled PBS; remove the pre-ovulatory follicles with a diameter of 12-15 mm.
[0045] (2) Follicle preparation: Place the extracted follicles into a container containing 1% double antibody PBS buffer and transfer them to the intercellular space within 4 hours.
[0046] (3) Remove the vascular membrane: Cut out the complete pre-ovulatory follicle, place it in a culture dish containing 1% double antibiotic DPBS solution, tear off the outermost vascular membrane to obtain a single complete pre-ovulatory follicle, and transfer it to a clean culture dish.
[0047] (4) Release yolk and granulosa cells: Use ophthalmic scissors to cut the yolk membrane to let the yolk flow out, then use tweezers to pick up the remaining membrane layer and put it into a culture dish containing 1% double antibiotic PBS. Shake and rinse to get out the white granulosa cell layer, and continue to rinse the white granulosa cell layer twice with 1% double antibiotic PBS solution.
[0048] (5) Digestion and resuspension: Transfer the rinsed granular cell layer to a 1.5 mL centrifuge tube, cut the granular cell layer into small pieces with ophthalmic scissors, digest with 0.25% trypsin at 4°C for 2.5 minutes, and resuspend the granular cell layer after stopping digestion.
[0049] (6) Filtration and cell density adjustment: The cell suspension was filtered using a cell sieve, and the density of granulocytes was measured after filtration. The density was then adjusted to 1×10⁻⁶. 7 ~3×10 7 per mL.
[0050] (7) Cell labeling and sorting: Add FSHR direct labeling antibody at 37℃ with a volume ratio of 1:200 to the cell suspension, incubate, and then perform flow cytometry to sort out positive cells.
[0051] (8) Cell culture: Treat the bottom of the cell culture dish with 0.15 mg / mL polylysine solution, take 1 mL of cell suspension from each dish, add 1 mL of culture medium with 5% fetal bovine serum, and transfer to a 37°C, 5% CO2 incubator for culture.
[0052] (9) Observation and identification: After 24 hours of culture, cell culture dishes were taken and cell morphology was observed under an inverted microscope. HE staining and indirect immunofluorescence were performed to identify the specificity of granulocytes. After passing the test, the culture medium was digested and added with 10% fetal bovine serum for passage culture.
[0053] 2. Quantitative real-time PCR detection of Lnc_012227 gene in granulosa cells of laying duck follicles at different SE infection times.
[0054] Granulosa cells from duck follicles were seeded onto 24-well plates at a density of 5 × 10⁶ cells / well. 5 After the cells adhered to the well overnight, Salmonella enterica resuspended in PBS at a MOI of 1:10 or 1:50 was added to each well. Three hours after infection, the cells were digested with Trizol, and total RNA was extracted from the cells according to the total RNA extraction method in Example 1. The total RNA was then reverse transcribed using the HiScript III RTSuperMix for qPCR (+gDNA wiper) kit to obtain cDNA template.
[0055] Primer pairs for real-time PCR detection were designed based on the Lnc_012227 gene sequence:
[0056] qLnc_012227-F:CTGCCCTTTCCCCAAACAA
[0057] qLnc_012227-R:AGCCACCCACTCTTCTCAC
[0058] As shown in SEQ ID NO: 4 and 5.
[0059] The reagent mixture included 10 μL of 2×ChamQ SYBR Color qPCR Mix, 0.4 μL of 10 μM upstream primer, 0.4 μL of 10 μM downstream primer, 2.0 μL of template, and 7.2 μL of ddH2O, for a total volume of 20 μL. The reaction conditions were set as follows: 95℃, 30 s, 1 cycle; 95℃, 10 s, 60℃, 30 s, 40 cycles; 95℃, 60 s; 55℃, 30 s, 95℃, 30 s, 1 cycle. Data were exported after the reaction and analyzed using 2-... ΔΔCT The method was analyzed, and the analysis results were plotted using GraphPad Prism software.
[0060] Results: The expression results of the long-chain Lnc_012227 gene in duck follicular granulosa cells treated with different amounts (MOI=1:10 or MOI=1:50) of Salmonella enteritidis for 3 h are shown in the figure. Figure 1 It can be seen that the expression level of the long-chain Lnc_012227 gene in the granulosa cells of laying duck follicles infected with high concentrations of Salmonella enteritidis is significantly increased compared with that in the case of low concentrations of Salmonella enteritidis infection. This indicates that, within a certain range, the long-chain Lnc_012227 gene is significantly correlated with the amount of Salmonella enteritidis infection.
[0061] Example 3: Study on the expression pattern of Lnc_012227 gene in duck ovarian tissue infected with Salmonella enteritidis
[0062] Ovarian tissue samples were collected from both symptomatic and non-symptomatic ducks infected with Salmonella enteritidis. Samples were immediately stored in liquid nitrogen or at -80°C to preserve RNA integrity. Total RNA was extracted from the ovarian tissue samples using TRIzol reagent according to the manufacturer's instructions. RNase contamination was avoided throughout the extraction process. RNA concentration and purity (A260 / A280 ratio) were determined using a NanoDrop 1000 microspectrophotometer, and RNA integrity was assessed using agarose gel electrophoresis. Total RNA was reverse transcribed into cDNA using high-fidelity reverse transcriptase. Pretreatment with gDNA Eraser was performed to eliminate interference from genomic DNA. Primer pairs were used for quantitative real-time PCR detection as shown in SEQ ID NO: 4 and 5. Quantitative real-time PCR was performed using the SYBR Green method to assess the differential expression of the Lnc_012227 gene in symptomatic and non-symptomatic Salmonella enteritidis samples. A 2- ΔΔCTMethods: The relative expression level of the Lnc_012227 gene was calculated, and statistical analysis was performed using GraphPadPrism software. The correlation between Lnc_012227 gene expression level and the degree of ovarian tissue lesions was analyzed to assess the potential of the Lnc_012227 gene as a biomarker for Salmonella enteritidis infection. The expression results of the long-chain Lnc_012227 gene in the ovarian tissues of uninfected and Salmonella enteritidis-infected laying ducks are shown in [Figure 1]. Figure 3 It can be seen that the expression level of the long-chain Lnc_012227 gene is significantly increased in the ovarian tissue of laying ducks infected with Salmonella enteritidis, and the long-chain Lnc_012227 gene is significantly associated with Salmonella enteritidis infection in the ovarian tissue of laying ducks.
[0063] Example 4: Construction of Lnc_012227 gene overexpression vector and cell transfection
[0064] The pcDNA3.1(+) vector was selected and double-digested with restriction endonucleases Hind III and XbaI. The PCR product was purified and double-digested with the same restriction endonucleases. The digested Lnc_012227 gene fragment was ligated into the vector and transformed into *E. coli* competent cells. Colony PCR and sequencing were performed on the transformed cells to confirm the construction of the recombinant vector. Figure 4 and Figure 5 The sequencing results are shown in SEQ ID NO: 6; individuals with correct colony PCR and sequencing results are considered successfully constructed recombinant vectors, named 012227-pcDNA3.1.
[0065] SEQ ID NO: 6:
[0066]
[0067] SEQ ID NO: 7; F:CGCCATATGATCACTGGGCGATGTATTAAAT (restriction site NheI)
[0068] SEQ ID NO: 8; R: TGCTCTAGACTCAGCTGTTTGGACAAGAGGT (restriction site XbaI)
[0069] Referring to the isolation and culture method of duck follicular granulosa cells in Example 2, duck follicular granulosa cells were seeded onto a 24-well plate, with 5 × 10⁶ cells per well. 5 After the cells adhered overnight, the constructed overexpression vector was transfected into duck follicular granulosa cells. 24 hours after transfection, the cells were digested with Trizol and transfected with pcDNA3.1 and 012227-pcDNA3.1 cells, respectively, as described in Example 2. Total RNA was extracted from the cells using the method described in Example 1. Reverse transcription and SYBR Green quantitative PCR were then performed. The results were analyzed using a 2-... ΔΔCT The relative expression level of the Lnc_012227 gene was calculated, and statistical analysis was performed using GraphPadPrism software to evaluate the expression effect of the Lnc_012227 gene after transfection. The expression of the long-chain Lnc_012227 gene was measured in two cell lines transfected with pcDNA3.1 and 012227-pcDNA3.1. The results are shown in [Figure 1]. Figure 6 It can be seen that the long-chain Lnc_012227 is highly expressed in cells transfected with 012227-pcDNA3.1, which is significantly higher than that in cells transfected with the empty vector pcDNA3.1.
[0070] Example 5: Effect of Lnc_012227 gene overexpression on ovarian transmission of Salmonella enteritidis
[0071] Duck follicular granulosa cells were cultured, and the 012227-pcDNA3.1 and pcDNA3.1 plasmids were transfected into the cells. After 24 h of culture, 100 μL of Salmonella enterica PBS resuspension (MOI = 1:10) was added, and the cells were co-cultured for 3 h. The intracellular Salmonella enterica load was then measured to assess the effect of Lnc_012227 gene overexpression on intracellular bacterial load. Results are shown below. Figure 7It can be seen that the intracellular bacterial load in cells transfected with 012227-pcDNA3.1 was significantly lower than that in the group transfected with the empty vector pcDNA3.1, indicating that Lnc_012227 gene overexpression inhibits bacterial proliferation. Simultaneously, following the total RNA extraction method in Example 1, total RNA was extracted from the blank group (untransfected cells), cells transfected with 012227-pcDNA3.1, and cells transfected with pcDNA3.1. Reverse transcription and SYBR Green method were used for quantitative real-time PCR to detect the mRNA expression of key genes in the MAPK signaling pathway: MAP3K8, TNF-α, IL-1β, IL-6, and IL-10. The primers for these key pathway genes are as follows:
[0072] MAP3K8 gene fluorescence quantitative primers:
[0073] qMAP3K8-F:GGAGCCCCTCAGACTGCTA
[0074] qMAP3K8-R:GATGGATCGTCTCGTCCCAC
[0075] TNF-α gene fluorescence quantitative primers:
[0076] qTNF-α-F:ACAGGACAGCCTATGCCAAC
[0077] qTNF-α-R:ACAGGAAGGGCAACACATCT
[0078] IL-1β gene fluorescence quantitative primers:
[0079] qIL-1β-F:TGGGCATCAAGGGCTACAAG
[0080] qIL-1β-R:GCTGTCGATGTCCCTCATGAC
[0081] IL-6 gene fluorescence quantitative primers:
[0082] qIL-6-F:AAAGCATCTGGCAACGAC
[0083] qIL-6-R: GAGGAGGGATTTCTGGGT
[0084] IL-10 gene fluorescent quantitative primers:
[0085] IL-10-F: AGCAGGAGCACCACCA
[0086] IL-10-R: TGCCGTTCTCGTTCATCTTT
[0087] Primers for quantitative real-time fluorescence of the internal reference gene β-actin:
[0088] β-actin-F:ATGTCGCCCTGGATTTCG
[0089] β-actin-R: CACAGGACTCCATACCCAAGAA
[0090] As shown in SEQ ID NO: 9-20.
[0091] Set up a reaction system of 10 μL 2×ChamQ SYBR Color qPCRMix, 0.4 μL 10 μM upstream primer, 0.4 μL 10 μM downstream primer, 2.0 μL template, and 7.2 μL ddH2O, for a total volume of 20 μL. Set the reaction conditions as follows: 95℃, 30 s, 1 cycle; 95℃, 10 s, 60℃, 30 s, 40 cycles; 95℃, 60 s; 55℃, 30 s, 95℃, 30 s, 1 cycle. After the reaction, export the data and use 2- ΔΔCT The methods were analyzed, and the results were plotted using GraphPad Prism software. The results are shown below. Figure 8 .
[0092] To verify that the long RNA Lnc_012227 can compete with the non-coding small RNA miR-let-7g-5p to indirectly regulate MAP3K8 mRNA expression, a dual-luciferase reporter system was used to verify that RNA Lnc_012227 can competitively regulate MAP3K8 mRNA expression with the non-coding small RNA miR-let-7g-5p.
[0093] 1. Reporter gene plasmid construction: Using primers with the restriction sites shown in SEQ ID NO: 7 and 8, namely NheI and XbaI, PCR amplification was performed to amplify the sequence containing the potential miR-let-7g-5p binding site on Lnc_012227, and cloned into the 3'UTR region of the firefly luciferase reporter gene vector. Simultaneously, a plasmid containing the same sequence but with a mutation at the miR-let-7g-5p binding site was constructed as a control.
[0094] 2. Co-transfection of cells: The constructed wild-type and mutant reporter gene plasmids were co-transfected with miR-let-7g-5pmimics (in vitro synthesized miR-let-7g-5p mimics used to mimic the function of endogenous miR-let-7g-5p. By transfecting mimics into cells, the level of miR-let-7g-5p can be increased, thereby studying its role in cells) into duck follicular granulosa cells with a confluence of more than 80%. Simultaneously, a plasmid containing Renilla luciferase was transfected as an internal control to standardize experimental results.
[0095] MAP3K83'UTR-MUT 5'-ATGACATGTTAAAACTATTGCCA-3'
[0096] MAP3K83'UTR-WT 5'-ATCTGTACATAAAACTATTGCCA-3'
[0097] let-7g-5p 3'-UGACAUGUUUGAUGAUGGAGU-5'
[0098] LNC_012227-MUT 5'-GCCGACATGTTGAACCCGTGTGGGA-3'
[0099] LNC_012227-WT 5'-GCCCTGTACAAGAACCCGTGTGGGA-3'
[0100] let-7g5p 3'-UGACAUGUUUGAUGAUGGAGU-5'
[0101] LNC_012227-MUT 5'-TGGACATGTCAAAGAGGAATCG-3'
[0102] LNC_012227-WT 5'-TGCTGTACACAAAGAGGAATCG-3'
[0103] let-7g-5p 3'-UGACAUGUUUGAUGAUGGAGU-5'
[0104] As shown in SEQ ID NO: 21-27.
[0105] 3. Luciferase activity assay: Approximately 48 hours post-transfection, the activities of firefly luciferase and Renilla luciferase were detected using a dual-luciferase reporter gene assay system. The regulatory role of miR-let-7g-5p on Lnc_012227 was assessed by comparing changes in firefly luciferase activity among the groups.
[0106] 4. Data Analysis: The Firefly Luciferase / Renilla Luciferase ratio (F / R) for each well was calculated to correct for experimental bias. The luciferase activity of the miR-let-7g-5p mimics treatment group and the control group were compared to determine whether miR-let-7g-5p can specifically bind to Lnc_012227 and affect its luciferase reporter gene expression.
[0107] 5. Verification of MAP3K8 mRNA expression regulation: The expression levels of MAP3K8 mRNA and protein were detected by qPCR to verify the indirect regulatory effect of Lnc_012227 on MAP3K8 through competition with miR-let-7g-5p. This was to assess the impact of Lnc_012227 gene overexpression on the NF-κB and MAPK signaling pathways and evaluate its regulatory role in the host inflammatory signaling response.
[0108] See results Figure 9 As can be seen, the luciferase activity of the miRNA-let-7g-5p mimic transfection groups of Lnc_012227 and MAP3K8 was significantly lower than that of the NC mimic transfection groups of Lnc_012227 and MAP3K8 (P < 0.01). When the miRNA-let-7g-5p binding sites on Lnc_012227 and MAP3K8 were mutated, there was no difference in luciferase activity between the mutated Lnc_012227 and mutated MAP3K8 miRNA-let-7g-5p mimic transfection groups and the mutated Lnc_012227 and mutated MAP3K8 NC mimic transfection groups. This indicates that miR-let-7g-5p interacts with the target genes Lnc_012227 and MAP3K8, meaning that Lnc_012227 indirectly regulates MAP3K8 by competing with miR-let-7g-5p.
[0109] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A long RNA Lnc_012227 that inhibits the ovarian transmission of Salmonella enteritidis, characterized in that, The nucleotide sequence of the cDNA encoded by the long RNA Lnc_012227 is shown in SEQ ID NO:
1.
2. The use of the long RNA Lnc_012227 according to claim 1 in the preparation of products for the prevention and control of Salmonella enteritidis infection.
3. The application according to claim 2, characterized in that, The prevention and control of Salmonella enteritis infection refers to the prevention and control of Salmonella infection in the ovaries of laying ducks.
4. An expression carrier, characterized in that, It includes the initial vector and the long RNA Lnc_012227 as described in claim 1.
5. The expression vector according to claim 4, characterized in that, The expression vector is an overexpression vector.
6. The expression vector according to claim 4, characterized in that, The initial vector was pcDNA3.
1.
7. The expression vector according to claim 4, characterized in that, The nucleotide sequence of the expression vector is shown in SEQ ID NO:
6.
8. A host, characterized in that, The transformation or transfection is performed using the expression vector as described in any one of claims 3 to 7; the host is a microorganism.
9. The use of the expression vector as described in any one of claims 4 to 7 or the host as described in claim 8 in the preparation of products for the prevention and control of Salmonella enteritidis infection.
10. The application according to claim 9, characterized in that, The prevention and control of Salmonella enteritis infection refers to the prevention and control of Salmonella infection in the ovaries of laying ducks.
Citation Information
Patent Citations
Non-coding RNA (ribonucleic acid) of salmonella as well as identification and application of non-coding RNA
CN104694533A
Long-chain RNA Lnc-13814 for regulating and controlling follicle development of laying ducks and application thereof
CN110295170A