Ramie high-temperature inducible promoter and application thereof

Abstract

The invention relates to the technical field of plant genetic engineering, and provides a ramie high-temperature inducible promoter and application thereof, and the nucleotide sequence of the promoter is as shown in SEQ ID NO: 1. The ramie high-temperature inducible promoter provided by the invention is rich in cis-acting elements (CCAAT-Box) related to temperature, also has elements related to drought (LTRE), dehydration (CATNTG motif) and wound induction (AG motif), and can be used as an effective tool for creating high-temperature-resistant plant varieties through genetic engineering.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a ramie high temperature inducible promoter and application thereof. Background Art

[0002] Ramie [Boehmeria nivea (L.) Gaudich.], a perennial herb of the Urticaceae family native to China, is one of the important bast fiber economic crops in my country, mainly used in the pharmaceutical, food and light industries. Long-term studies have found that the fiber quality of ramie harvested in summer is significantly lower than that in spring, and temperature is the key factor leading to the difference; secondly, as an economic crop, ramie cannot compete with food crops for land under the current situation of scarce arable land, and the trend is for the planting area to migrate to barren land such as hillsides. As a result, adverse environmental factors such as high temperature and drought have increasingly serious effects on ramie yield and quality. Therefore, the use of molecular biological methods to explore high temperature-inducible promoters is of great significance for improving ramie heat resistance using genetic engineering technology to adapt to the climate trend of global warming and the increasingly unfavorable planting environment.

[0003] The MYB (v-myb avian myeloblastosis viral oncogene homolog) gene family is one of the most important transcription factor families in higher plants, playing an important role in regulating plant growth and development, and responses to biotic and abiotic stresses. Under external stress conditions, MYB transcription factors regulate plant responses to adverse stresses through multiple mechanisms, such as regulating gene expression, participating in hormone signaling pathways, regulating secondary metabolism, and improving antioxidant capacity. For example, under high temperature stress, lily LlMYB305 activates LlHSC70 promoter activity under heat stress and participates in plant heat tolerance, and Arabidopsis AtMYB30 regulates oxidative and heat stress responses through annexin-mediated cytoplasmic calcium signals.

[0004] In the transcriptional regulation mechanism of plant stress resistance, the cis-acting elements of promoters play a vital role. In recent years, many plant stress-inducible promoters have been successfully cloned and identified, but there are no reports on the research of ramie high temperature-inducible promoters. Therefore, the isolation and identification of ramie endogenous high temperature-inducible promoters is of great significance for the use of genetic engineering to create new ramie varieties with high temperature resistance, and also provides new ideas and tools for plant stress resistance genetic engineering. Summary of the invention

[0005] In view of this, the present invention proposes a ramie high temperature inducible promoter and application thereof, wherein the promoter can initiate the expression of a target gene when induced by high temperature and can be used for plant stress resistance genetic engineering.

[0006] The technical solution of the present invention is implemented as follows: In a first aspect, the present invention provides a ramie high temperature inducible promoter, the nucleotide sequence of the promoter is shown in SEQ ID NO:1.

[0007] In a second aspect, the present invention provides a ramie high temperature inducible promoter for use in initiating the expression of a target gene in plant tissues under high temperature induction conditions.

[0008] On the basis of the above technical solution, preferably, the ramie high temperature inducible promoter drives the reporter gene GUS to up-regulate expression in transgenic Arabidopsis under high temperature induction conditions.

[0009] In a third aspect, the present invention provides a target gene expression vector comprising a ramie high temperature inducible promoter.

[0010] On the basis of the above technical solution, preferably, the target gene is β-glucuronidase gene, and the expression vector is pBI121::BnMYB6 pro ::GUS.

[0011] In a fourth aspect, the present invention provides a method for constructing a transgenic plant that expresses a transferred gene under high temperature induction, comprising the following steps:

[0012] S1, construction of the expression vector of the target gene;

[0013] S2, connecting the promoter described in claim 1 to the expression vector of step S1, and then transforming it into Agrobacterium;

[0014] S3, using the transformed Agrobacterium strain to mediate plant transformation to obtain transgenic plants that express the transferred gene inducibly by high temperature.

[0015] The ramie high temperature inducible promoter and its application of the present invention have the following beneficial effects compared with the prior art:

[0016] The ramie high temperature inducible promoter of the present invention is derived from the R2R3 transcription factor gene BnMYB6 cloned from Ramie Huazhu No. 5, which is rich in temperature-related cis-acting elements (CCAAT-Box), and also has elements related to drought (LTRE), dehydration (CATNTG motif) and wound induction (AG motif). The recombinant vector containing the promoter driving GUS expression is transformed into Arabidopsis by Agrobacterium-mediated method to obtain transgenic Arabidopsis. Comparative analysis proves that the transgenic Arabidopsis can express the reporter gene more efficiently under high temperature induction than under non-high temperature conditions, so that the transgenic Arabidopsis obtains the ability to express the GUS gene that non-transgenic Arabidopsis does not have, and can express it more highly under high temperature induction conditions. It means that the ramie BnMYB6 gene promoter of the present invention is a high temperature inducible promoter, which can be used as an effective tool for creating high temperature resistant plant varieties through genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 PCR electrophoresis diagram for the construction of the BnMYB6 gene promoter of Ramie Huazhu No. 5, M—Marker; Lane 1—Amplification results of the BnMYB6 gene promoter.

[0019] Figure 2 This is the electrophoresis diagram of double restriction enzyme digestion of pBI121, M—Marker; lanes 1-6—double restriction enzyme digestion results.

[0020] Figure 3 BnMYB6 pro :: PCR detection of GUS recombinant vector bacterial solution. M—Marker; Lanes 1-6—6 positive single colonies randomly selected.

[0021] Figure 4 BnMYB6 pro ::GUS transgenic Arabidopsis lines (BnMYB6 pro ::GUS-1;BnMYB6 pro ::GUS-8;BnMYB6 pro ::GUS-12) GUS staining results at 35°C for different treatment times. Scale bar = 1 mm.

[0022] Figure 5 BnMYB6 pro:: Analysis of relative expression levels of GUS gene in GUS transgenic Arabidopsis thaliana at different treatment times at 35℃. Figure A is the transgenic line BnMYB6 pro ::GUS-1, Figure B is the transgenic line BnMYB6 pro ::GUS-8, Figure C is the transgenic line BnMYB6 pro ::GUS-12. * indicates a significant difference, p<0.05; ** indicates a very significant difference, p<0.01. DETAILED DESCRIPTION

[0023] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] The laboratory of the applicant of the present invention cloned the R2R3 transcription factor gene BnMYB6 from ramie Huazhu No. 5, and found that high temperature treatment can significantly increase its expression level in ramie stem bark. Further research and analysis found that the promoter of the BnMYB6 gene is rich in cis-acting elements related to temperature, and also has elements related to drought (LTRE), dehydration (CATNTG motif) and wound induction (AG motif). After searching, no relevant reports on the promoter sequence of the gene and its biological function have been found so far.

[0025] Furthermore, the present invention uses a homologous recombination method and a ClonExpress system to connect the BnMYB6 gene promoter to a GUS expression vector pBI121 through a homologous recombination reaction, and verifies the BnMYB6 gene promoter function through an Arabidopsis transformation system. Experiments have confirmed that the BnMYB6 gene promoter of the Ramie Huazhu No. 5 of the present invention upregulates the expression of the target gene under high temperature induction conditions, and is expected to be used in the creation of transgenic high temperature resistant plants.

[0026] The ramie high temperature inducible promoter and its application of the present invention are further described in detail below in conjunction with the examples.

[0027] Example 1 Obtaining the promoter of the BnMYB6 gene of Ramie Huazhu No. 5

[0028] Relying on the ramie genome database, the 5' regulatory region of the BnMYB6 gene was identified, the 1452bp sequence upstream of the gene was determined, and the promoter primers were designed as follows:

[0029] Upstream primer: 5′-ATTTTTCTCTCTTGTATCCAG-3′;

[0030] Downstream primer: 5′-GCTTTTTTTGTGTGTATAGGTAAA-3′.

[0031] The genomic DNA of Ramie Huazhu No. 5 was taken, and the tender leaves of Ramie Huazhu No. 5 were used as materials, and the genomic DNA of Ramie Huazhu No. 5 was extracted using the Ezup column plant genome extraction kit (Shanghai Shenggong, B518261-0100). The genomic DNA was diluted to 100 ng / μL and used as a template for amplifying the promoter, and the high-fidelity enzyme PrimeSTARMax DNA Polymerase (Takara) was used to amplify the BnMYB6 gene promoter.

[0032] 1.1 Extraction of ramie genomic DNA

[0033] (1) Preheat BufferPCB and β-mercaptoethanol in a water bath to 65°C;

[0034] (2) Take 100 mg of fresh plant tissue, grind it into powder in liquid nitrogen, and transfer it to a 1.5 ml centrifuge tube;

[0035] (3) Quickly add 600 μL of 65°C preheated Buffer PCB and 12 μL of β-mercaptoethanol. Vortex to mix, place in a 65°C water bath for 25 min, mixing occasionally;

[0036] (4) Add 600 ml of chloroform, mix thoroughly, and centrifuge at 12,000 rpm for 5 min. Pipette the upper aqueous phase into a clean 1.5 ml centrifuge tube;

[0037] (5) Add an equal volume of Buffer BD to the upper water layer, mix by inversion 3-5 times, then add an equal volume of anhydrous ethanol to the upper water layer, mix thoroughly and add all of it to the adsorption column using a pipette, let stand at room temperature for 2 min, centrifuge at 10000 rpm for 1 min, and discard the waste liquid in the collection tube;

[0038] (6) Place the adsorption column back into the collection tube, add 500 μL of Wash Solution, centrifuge at 10,000 rpm for 1 min, and discard the waste liquid in the collection tube;

[0039] (7) Place the adsorption column back into the collection tube, add 500 μL of Wash Solution, centrifuge at 10,000 rpm for 1 min, and discard the waste liquid in the collection tube;

[0040] (8) Place the adsorption column back into the collection tube and centrifuge at 12000 rpm for 2 min;

[0041] (9) Take out the adsorption column and put it into a new 1.5 ml centrifuge tube. Add 50 μL TE Buffer to the center of the adsorption membrane, let it stand at room temperature for 3 min, and centrifuge at 12000 rpm for 2 min.

[0042] (10) The solution obtained by centrifugation was added back into the adsorption column, allowed to stand at room temperature for 3 min, and centrifuged at 12000 rpm for 2 min;

[0043] (11) Store the obtained DNA solution at -20°C.

[0044] 1.2 Cloning of the BnMYB6 gene promoter

[0045] High-fidelity enzyme PrimeSTAR Max DNA Polymerase amplification reaction system (25 μL system): DNA 2 μL, PrimeSTART Max Premix (2×) 12.50 μL, Primer F 0.5 μL, Primer R 0.5 μL, ddH 2 O 9.55 μL.

[0046] Amplification program: 98°C for 5 min, 35 cycles of (98°C for 10 s, 60°C for 5 s, 72°C for 90 s), 72°C for 10 min, and remove from the tube at 4°C.

[0047] After the reaction was completed, the reaction solution was immediately taken out and tested by 1.5% TAE agarose gel electrophoresis. Figure 1 shown.

[0048] 1.3 Purification and recovery of promoter fragments

[0049] Using nucleic acid purification kit PCR products were purified using SV Gel and PCR Clean-Up System (Promega, A9281).

[0050] (1) Take an equal volume of membrane binding buffer and mix it with the PCR product, transfer the mixture into the SV column assembly, incubate at room temperature for 1 min, centrifuge at 16000g for 1 min, empty the collection tube and put it back;

[0051] (2) Add 700 μL of membrane cleaning solution to the SV column, centrifuge at 16,000 g for 1 min, empty the collection tube and put it back;

[0052] (3) Repeat the washing step with 500 μL of membrane washing solution and centrifuge the SV column assembly at 16,000 g for 5 min;

[0053] (4) Centrifuge the column assembly again for 1 min to allow the residual ethanol to evaporate completely;

[0054] (5) Transfer the SV column into a clean 1.5 ml microcentrifuge tube and add 30 μL ddHO 2 O was added to the center of the column, incubated at room temperature for 1 min, and then centrifuged at 16000g for 1 min to collect the DNA solution.

[0055] 1.4 Connect the BnMYB6 promoter to the pEASY Blunt Zero cloning vector at 37°C for 15 min.

[0056] Reaction system (5 μL): 0.5 μL of promoter recovery fragment, 1 μL of pEASY-Blunt Zero Cloning Vector, ddH 2 O 3.5 μL.

[0057] 1.5 Plasmid transformation of E. coli

[0058] (1) Add the ligation product to 100 μL of E. coli DH5α competent cells (add the ligation product when the competent cells have just been thawed), flick to mix, and place on ice for 20-30 min.

[0059] (2) Heat shock at 42°C in a water bath for 30 seconds and immediately place on ice for 2 minutes.

[0060] (3) Add 250 μL of LB medium equilibrated to room temperature and culture at 200 rpm and 37°C for 1 h.

[0061] (4) Centrifuge at 1500 g for 1 min, discard part of the supernatant, retain 100-150 μL, flick to suspend the bacteria, spread all the bacterial suspension on LB / Kana solid medium (Kana 100 mg / L), and culture at 37°C overnight.

[0062] 1.6 Positive clone detection

[0063] Select clones and inoculate them in LB / Kana liquid medium (Kana 100 mg / L), and culture them at 200 rpm and 37°C for about 6 hours. Take 1 μL of bacterial solution and add it to 25 μL PCR system, and use M13 Forward Primer and M13 Reverse Primer to identify positive clones.

[0064] Reaction system (25 μL): bacterial solution 1 μL, EasyTaq 0.2 μL, 10×Easy Taq Buffer 2.5 μL, dNTPmix 0.5 μL, M13 Forward Prime 1 μL, M13 Reverse Primer 1 μL, ddH 2 O18.8μL.

[0065] Amplification program: 95°C for 5 min, 35 cycles of (95°C for 10 s, 60°C for 30 s, 72°C for 90 s), 72°C for 10 min, and take out at 4°C.

[0066] After the reaction was completed, the reaction solution was immediately taken out and detected by 1.5% TAE agarose gel electrophoresis.

[0067] 1.7 DNA sequencing

[0068] The bacterial solution that was positive in PCR detection was sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing, and the sequencing results were obtained. The promoter DNA sequence is shown in the sequence listing SEQ ID NO: 1.

[0069]

[0070] 1.8 Analysis of the promoter sequence of BnMYB6 gene in ramie Huazhu 5

[0071] The promoter sequence of the BnMYB6 gene was submitted to the PLACE online analysis tool for promoter sequence analysis (https: / / www.dna.affrc.go.jp / PLACE / ?action=newplace). The promoter sequence of the BnMYB6 gene of Ramie Huazhu No. 5 is rich in cis-acting elements related to temperature. In addition, it also has elements related to induction such as drought and dehydration, and there is an "AG motif" element related to wound induction in the area near the TATAbox (as shown in Table 1). In summary, it is preliminarily judged that the promoter of the BnMYB6 gene may be a temperature-sensitive inducible promoter.

[0072] Table 1 Elements enriched in the promoter of BnMYB6 gene of Ramie Huazhu 5

[0073]

[0074] Example 2BnMYB6 pro ::Construction of GUS expression vector and Agrobacterium transformation

[0075] According to the BnMYB6 promoter sequence amplified in Example 1, the adapter primers were designed, the upstream primer was added with a HindⅢ restriction site, and the downstream primer was added with a BamHI restriction site:

[0076] BnB6 pro -F:5'- GACCATGATTACGCCAAGCTT ATTTTTCTCTCTTGTATC CAG-3'.

[0077] BnB6 pro -R:5'- GGACTGACCACCCGGGGATCC GCTTTTTTTGTGTGTAT AGGTAAA-3'.

[0078] 2.1 PCR cloning to obtain the BnMYB6 promoter fragment with a linker

[0079] High-fidelity enzyme PrimeSTAR Max DNA Polymerase amplification reaction system (25 μL system): DNA 2 μL, PrimeSTART Max Premix (2×) 12.50 μL, BnMYB6 pro -F 0.5 μL, BnMYB6 pro -R 0.5 μL, ddHO 2 2. O 9.5 μL.

[0080] The amplification program was as follows: amplification program: 98°C for 5 min, (98°C for 10 s, 60°C for 5 s, 72°C for 90 s) for 35 cycles, 72°C for 10 min, and take out at 4°C.

[0081] After the reaction was completed, the reaction solution was immediately taken out, and the reaction solution was detected by 1.5% TAE agarose gel electrophoresis and the product was purified and recovered (the operation was the same as 1.3).

[0082] 2.2 Double restriction digestion of GUS expression vector pBI121

[0083] The promoter of the reporter gene GUS in the GUS expression vector pBI121 used in the experiment is 35s promoter, with restriction enzyme sites HindⅢ and BamHI at both ends, respectively. Double enzyme digestion was performed using nuclease HindⅢ and BamHI.

[0084] Double enzyme digestion system (20 μL): GUS expression vector pBI12115 μL, HindⅢ2 μL, BamHI1 μL, 10xFastDigest Buffer2 μL.

[0085] Enzyme digestion program: 37℃30min, 80℃5min, take out at 16℃.

[0086] After the reaction was completed, the reaction solution was immediately taken out and tested by 1.5% TAE agarose gel electrophoresis. The results of enzyme digestion electrophoresis were as follows: Figure 2 As shown, the short fragment of about 900 bp is the 35s promoter.

[0087] 2.3 Purification and recovery of linearized GUS expression vector pBI121

[0088] Agarose gel electrophoresis was used to separate the two fragments after double digestion reaction, and gel recovery kit was used SV Gel and PCR Clean-Up System was used for PCR (Promega, A9281) and long fragments were recovered by gel excision.

[0089] (1) Cut out a single target DNA band from the agarose gel (try to remove as much excess as possible) and place it in a clean centrifuge tube and weigh it.

[0090] (2) Based on the weight of the gel cut in the previous step, add 100 μL of membrane binding solution to 100 mg, mix the two, transfer the mixture into the SV column assembly, incubate at room temperature for 1 min, centrifuge at 16,000 g for 1 min, empty the collection tube and put it back;

[0091] (3) Add 700 μL of membrane cleaning solution to the SV column, centrifuge at 16,000 g for 1 min, empty the collection tube and put it back;

[0092] (4) Repeat the washing step with 500 μL of membrane washing solution and centrifuge the SV column assembly at 16,000 g for 5 min;

[0093] (5) Centrifuge the column assembly again for 1 min to allow the residual ethanol to evaporate completely;

[0094] (6) Transfer the SV column to a clean 1.5 ml microcentrifuge tube, add 30 μL of ddH2O to the center of the column, incubate at room temperature for 1 min, and centrifuge at 16,000 g for 1 min to collect the DNA solution.

[0095] 2.4 Recombination reaction between promoter fragment and linearized vector

[0096] The promoter fragment purified in step 2.1 was connected to the linearized GUS expression vector pBI121 obtained in step 2.3 by homologous recombination using the homologous recombination kit ClonExpress II One Step Cloning Kit (Vazyme, C112). The reaction system (10 μL) included: 1 μL of insert fragment, 6 μL of linearized GUS expression vector, 1 μL of Exnase II, and 2 μL of 5×CE II Buffer.

[0097] The reaction system was placed in a PCR instrument and reacted at 37°C for 30 min. After the reaction was completed, the product was cooled on ice for later use.

[0098] 2.5 Plasmid transformation of E. coli

[0099] (1) Add the ligation product to 100 μL of E. coli DH5α competent cells (add the ligation product when the competent cells have just been thawed), flick to mix, and place on ice for 20-30 min.

[0100] (2) Heat shock at 42°C in a water bath for 30 seconds and immediately place on ice for 2 minutes.

[0101] (3) Add 250 μL of LB medium equilibrated to room temperature and culture at 200 rpm and 37°C for 1 h.

[0102] (4) Centrifuge at 1500 g for 1 min, discard part of the supernatant, retain 100-150 μL, flick to suspend the bacteria, spread all the bacterial suspension on LB / Kana solid medium (Kana 100 mg / L), and culture at 37°C overnight.

[0103] 2.6 Positive clone detection

[0104] In order to facilitate the detection and sequencing verification of recombinant plasmids, we designed primers, namely VT-F and VT-R, respectively, upstream and downstream of the original CaMV35S promoter based on the pBI121 vector sequence. VT-F / VT-R can be used to easily detect whether the exogenous DNA sequence has been recombined into the pBI121 vector. At the same time, this pair of primers can be used to sequence and verify the recombinant plasmid to determine whether the recombinant sequence is consistent with the target sequence.

[0105] VT-F:5'-CCCCAGGCTTTACACTTTATGCTT-3',

[0106] VT-R:5'-CGCTGATCAATTCCACAGTTTTCG-3'.

[0107] Select a single clone and inoculate it in LB / Kana liquid medium (Kana 100 mg / L), and culture it at 200 rpm and 37°C for about 6 hours. Take 1 μL of the bacterial solution and add it to 25 μL of PCR system, and use VT-F / VT-R to perform PCR detection of positive clones.

[0108] Reaction system (25 μL): bacterial solution 1 μL, EasyTaq 0.2 μL, 10×Easy Taq Buffer 2.5 μL, dNTPmix 0.5 μL, Primer F 1 μL, Primer R 1 μL, ddH 2 O 18.8 μL.

[0109] Amplification program: 95°C for 5 min, (95°C for 10 s, 30°C for 5 s, 72°C for 90 s) for 35 cycles, 72°C for 10 min, take out at 4°C.

[0110] After the reaction was completed, the reaction solution was immediately taken out and tested by 1.5% TAE agarose gel electrophoresis. Figure 3 shown.

[0111] 2.7 DNA sequencing

[0112] The positive clones were expanded and cultured and sent for sequencing. After the sequencing results were fed back and the recombinant sequence was confirmed to be correct, the promoter DNA sequence was shown in the sequence table SEQ ID No. 1. The recombinant plasmid of the BnMYB6 promoter was constructed and prepared for the next experiment.

[0113] 2.8 Extraction of recombinant plasmid DNA

[0114] The recombinant plasmid DNA was extracted using a high-purity plasmid mini-preparation kit (Tiangen Biochemical Technology Co., Ltd., DP107).

[0115] (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CP4 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0116] (2) Take 5-15 ml of overnight culture solution and add it to a centrifuge tube. Centrifuge at 12,000 rpm for 1 min and remove the supernatant as much as possible.

[0117] (3) Add 500 μL of solution P1 to the centrifuge tube containing the bacterial cell pellet and use a pipette or vortex oscillator to thoroughly suspend the bacterial cell pellet.

[0118] (4) Add 500 μL of solution P2 to the centrifuge tube and gently invert it upside down 6-8 times to fully lyse the bacteria.

[0119] (5) Add 700 μL of solution P3 to the centrifuge tube and gently invert it 6-8 times to mix thoroughly. A white flocculent precipitate will appear. Centrifuge at 12,000 rpm for 10 min. A precipitate will form at the bottom of the centrifuge tube.

[0120] (6) Add the supernatant collected in the previous step to the adsorption column CP4 in portions, and be careful not to suck out the precipitate. Centrifuge at 12000 rpm for 1 min, pour out the waste liquid in the collection tube, and place the adsorption column CP4 in the collection tube.

[0121] (7) Add 600 μL of rinse solution PW to the adsorption column CP4, centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and place the adsorption column CP4 in the collection tube.

[0122] (8) Repeat step (7).

[0123] (9) The adsorption column CP4 was placed in a collection tube and centrifuged at 12,000 rpm for 2 min to remove the residual rinse solution in the adsorption column.

[0124] (10) Place the adsorption column CP4 in a clean centrifuge tube, add 100-300 μL of elution buffer EB to the middle part of the adsorption membrane, leave it at room temperature for 2-5 min, centrifuge it at 12000 rpm for 2 min, and collect the plasmid solution into the centrifuge tube.

[0125] 2.9 Plasmid transformation of Agrobacterium GV3101

[0126] (1) Take out the GV3101 Agrobacterium competent cells from the -80°C refrigerator and quickly place them in an ice box to thaw.

[0127] (2) Add 1 μL of recombinant plasmid DNA sample and mix gently. Place the mixture on an ice box for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min.

[0128] (3) Add 900 μL of LB liquid medium without antibiotics, mix well, and culture at 28°C with shaking for 2-3 h.

[0129] (4) Collect the bacteria by centrifugation at 6000 rpm for 1 min. Take about 100 μL of the supernatant and gently blow to resuspend the bacteria. Apply the suspension to LB / Kana / Rif solid medium (Kana 100 mg / L, Rif 50 mg / L), invert and place in a 28°C incubator for 2-3 days.

[0130] 2.10 PCR verification of transformed Agrobacterium

[0131] BnMYB6 pro ::GUS recombinant vector Agrobacterium was screened. A single clone was selected and inoculated into 500 μL LB / Kana / Rif (Kana 100 mg / L, Rif 50 mg / L) liquid medium, and cultured at 200 rpm and 37°C for about 24 hours. 1 μL of bacterial solution was added to 25 μL PCR system, and positive clones were identified using VT-F / VT-R.

[0132] Reaction system (25 μL): bacterial solution 1 μL, EasyTaq 0.2 μL, 10×Easy Taq Buffer 2.5 μL, dNTPmix 0.5 μL, Primer F 1 μL, Primer R 1 μL, ddH 2 O 18.8 μL.

[0133] Amplification program: 95°C for 5 min, (95°C for 10 s, 30°C for 5 s, 72°C for 90 s) for 35 cycles, 72°C for 10 min, take out at 4°C.

[0134] After the reaction was completed, the reaction solution was immediately taken out and detected by 1.5% TAE agarose gel electrophoresis.

[0135] The bacterial solution that has been verified to be correct was taken for expansion culture, and the expanded cultured bacterial solution was mixed with 50% glycerol in a ratio of 1:1 and frozen at -80°C for subsequent experiments.

[0136] Example 3. Verification of the function of the ramie BnMYB6 gene promoter in Arabidopsis

[0137] 3.1 Infection of Arabidopsis thaliana by floral dipping

[0138] (1) Cut off the first 1 cm to 5 cm long primary inflorescence. Perform infiltration transformation within one week after pruning.

[0139] (2) One week in advance, activate the bacterial solution stored in the ultra-low temperature refrigerator in 2.10. One day before the infiltration transformation, add the activated Agrobacterium GV3101 containing the expression vector plasmid to 300 ml LB / Kana / rif (Kana 100 mg / L, rif 20 mg / L) liquid culture medium and culture at 28°C and 200 rpm in a shaking incubator until the OD reaches 600 It is about 0.8-1.0, and the plants need to be well watered one day before the infiltration transformation so that the stomata of the plants can be fully opened during the transformation.

[0140] (3) Centrifuge at 4000 rpm for 20 min at 25°C and prepare a resuspension solution (5% sucrose + 300 μL / L silwet-77) to resuspend the cells to an OD of 600 It is about 0.8-1.0, stir evenly.

[0141] (4) Before infection, cut off the fruit pods and fully opened flowers on the plant, immerse the above-ground part of the plant in the bacterial solution for 20-30 seconds, and shake it gently.

[0142] (5) After soaking, cover with plastic wrap to keep moisture. After dark culture for 1 day, remove the plastic wrap and transfer the material to an incubator for growth.

[0143] (6) Cultivate the infected Arabidopsis thaliana under normal culture conditions until the seeds mature, and then harvest the seeds.

[0144] 3.2 Sterilization of transgenic Arabidopsis seeds

[0145] (1) Take an appropriate amount of Arabidopsis seeds and place them in a 1.5 ml centrifuge tube. Add 1 ml of distilled water and wash for 20 seconds. Let it stand until the seeds settle at the bottom of the tube. Discard the distilled water and repeat this three times.

[0146] (2) Add 1 ml of 75% ethanol to wash for 3 min, let it stand until the seeds settle at the bottom of the tube, and discard the 75% ethanol;

[0147] (3) Add 1 ml of anhydrous ethanol to wash for 3 min, let it stand until the seeds settle at the bottom of the tube, and discard the anhydrous ethanol;

[0148] (4) Add 1 ml of distilled water and rinse for 20 seconds. Let it stand until the seeds settle at the bottom of the tube, discard the distilled water, and repeat 5 times.

[0149] (5) Add 1 ml of distilled water and mix well. Finally, use a pipette to suck the seeds into MS / Kana (Kana 100 mg / L) solid medium and spread them evenly. Discard the excess distilled water in the medium. Grow at 25°C, 16 h light / 22°C, 8 h dark.

[0150] 3.3 Transgenic Arabidopsis screening

[0151] (1) After transformation, mature Arabidopsis seeds were harvested and screened on MS / Kana (Kana 100 mg / L) solid medium. The strains with normal growth and green seedlings were identified as positive strains in the initial screening.

[0152] (2) Transplant some of the initially screened positive strains into nutrient soil for further growth.

[0153] (3) Wait for the positive plants to mature and harvest T 1 After the T1 generation seeds were sterilized, they were screened on MS / Kana (Kana 100 mg / L) solid medium. The proportion of transgenic seedlings with Kana resistance increased slightly. The positive plants were cultured to maturity to obtain T2 generation seeds and repeat the kanamycin screening step.

[0154] (4) After two generations of screening, the positive plant rate reached a high proportion, and T was gradually obtained. 3 Generation of pure strains.

[0155] 3.4 Analysis of the inducible expression of the BnMYB6 promoter in transgenic Arabidopsis under high temperature treatment

[0156] Select the full T3 generation BnMYB6 pro ::GUS transgenic Arabidopsis homozygous strain (BnMYB6 pro ::GUS-1,BnMYB6 pro ::GUS-8,BnMYB6 pro ::GUS-12) seeds were cultured for 15 days and then transferred to a 35℃ artificial climate chamber for high temperature treatment. At 0h, 2h, 4h, and 6h of treatment, plants were selected for GUS histochemical staining using the GUS staining kit gusblue kit (Beijing Huayueyang Biotechnology Co., Ltd., CAT: GT0391). The results showed that ( Figure 4 ), compared with the untreated condition, after high temperature treatment, T 3 Generation BnMYB6 pro ::The enhanced GUS staining in GUS transgenic Arabidopsis indicates that the expression of the GUS gene is enhanced, which further indicates that the promoter of the BnMYB6 gene has high temperature induction function and can be used as a promoter tool in genetic engineering research to create high temperature resistant plant varieties.

[0157] 3.5 Analysis of GUS gene expression in transgenic Arabidopsis thaliana under high temperature treatment by promoter of BnMYB6 gene

[0158] Select the full T3 generation BnMYB6 pro ::GUS transgenic Arabidopsis homozygous lines (BnMYB6pro ::GUS-1,BnMYB6 pro ::GUS-8,BnMYB6 pro ::GUS-12) seeds were cultured for 15 days after germination and transferred to a 35°C artificial climate chamber for high temperature treatment. The whole Arabidopsis thaliana plant was taken after 0 h (control), 2 h, 4 h, and 6 h of treatment, and total RNA was extracted using the Trizol method. The steps are as follows:

[0159] (1) Place the liquid tube in an insulated bucket, take a sample from the ultra-low temperature refrigerator and quickly place it in liquid nitrogen;

[0160] (2) Wear a mask and gloves, pour a small amount of liquid nitrogen into the mortar to keep it at a low temperature, and repeat once;

[0161] (3) Use pre-cooled tweezers to take about 100 mg of the sample into a mortar and grind it quickly into a particle-free powder. During this time, liquid nitrogen should be added continuously to maintain the low temperature to prevent RNA degradation.

[0162] (4) Place the sample in a pre-cooled 1.5 ml enzyme-free centrifuge tube and add 1 ml of Trizol reagent. Mix or shake quickly.

[0163] (5) Place on ice, mark, and let stand for 5 minutes;

[0164] (6) Place the centrifuge tube in a pre-cooled high-speed centrifuge at 12,000 rpm, 4°C, for 10 min.

[0165] (7) Prepare a new 1.5 ml enzyme-free centrifuge tube, add 400 μL of refrigerated chloroform, and place on ice;

[0166] (8) Place the supernatant in a 1.5 ml enzyme-free centrifuge tube containing chloroform, mix gently for 2 min, place on ice for 5 min, and centrifuge at 12,000 rpm, 4°C, for 10 min.

[0167] (9) Repeat steps (7) to (8)

[0168] (10) Prepare a new 1.5 ml enzyme-free centrifuge tube, take the supernatant and place it in a 1.5 ml enzyme-free centrifuge tube. Add an equal volume of isopropanol stored at -20°C to the centrifuge tube, gently mix up and down, let stand at -20°C for 30 min to precipitate RNA, and centrifuge at 12,000 rpm, 4°C, for 10 min.

[0169] (11) Discard the supernatant, add 400 μL 75% ethanol for washing, mix gently with a pipette, and incubate at 12,000 rpm, 4°C, for 3 min.

[0170] (12) Discard the supernatant, add 400 μL of anhydrous ethanol, mix gently, and incubate at 12,000 rpm, 4°C, for 2 min.

[0171] (13) Discard the supernatant, place on a clean bench to dry for 5 min, and add 20 μL of enzyme-free water.

[0172] (14) Measure the concentration and store in a -80℃ refrigerator.

[0173] cDNA was obtained by reverse transcription using the reverse transcription kit TransScript One-Step gDNARemoval and cDNA SynthesisSuperMix (Beijing Quanshijin Biotechnology Co., Ltd., AT311-03). The reaction system (10 μL) included: Total RNA 2.5 μL, Anchored Oligo Primer 0.5 μL, 2×TS Reaction Mix 5 μL, TransScript RT / RI Enzyme Mix 0.5 μL, gDNARemover 0.5 μL, ddH 2 2. 4% dHO 1 μL.

[0174] The amplification program was as follows: 42°C for 30 min, 85°C for 10 s, and 16°C for 30 min.

[0175] The obtained cDNA was used as a template and ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02) was used for fluorescence quantitative PCR. The GUS gene was used as the target gene and the Arabidopsis Actin2 gene was used as the internal reference gene. The primer sequences were designed as follows:

[0176] qGUS-F:5'-CTCCTACCGTACCTCGCATTAC-3',

[0177] qGUS-R:5'-GCCTCTTCGCTGTACAGTTCTT-3',

[0178] qAtActin2-F:5'-GCCATCCAAGCTGTTCTCTC-3',

[0179] qAtActin2-R:5'-CAGTAAGGTCACGTCCAGCA-3'.

[0180] The reaction system (10 μL) was as follows: cDNA 1 μL, ChamQ Universal SYBR qPCR Master Mix 5 μL, Prmier F 0.5 μL, Prmier R 0.5 μL, ddH 2 2 μL of HO.

[0181] Amplification program: 95°C for 30 min, 40 cycles of (95°C for 10 s, 60°C for 30 s), 95°C for 15 s, 60°C for 1 min, 95°C for 15 s.

[0182] The results show that Figure 5 ): T after high temperature treatment 3 Generation BnMYB6 pro ::GUS transgenic Arabidopsis lines (BnMYB6 pro ::GUS-1;BnMYB6 pro ::GUS-8;BnMYB6 pro ::GUS-12) rapidly triggered the expression of GUS within 2 hours; at 4 hours, the expression level of GUS gene decreased; at 6 hours, the expression level of GUS gene increased significantly again, indicating that BnMYB6 pro It drives the up-regulated expression of reporter genes in transgenic Arabidopsis and is an available high-temperature inducible promoter that can be used as a promoter tool in genetic engineering research to create high-temperature resistant plant varieties.

[0183] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A ramie high temperature inducible promoter, characterized in that: The nucleotide sequence of the promoter is shown in SEQ ID NO:

1.

2. Use of the ramie high temperature inducible promoter as claimed in claim 1 to promote the expression of a target gene in plant tissue under high temperature induction conditions.

3. The use according to claim 2, characterized in that: The ramie high temperature inducible promoter drives the reporter gene GUS to up-regulate expression in transgenic Arabidopsis under high temperature induction conditions.

4. A target gene expression vector comprising the ramie high temperature inducible promoter as claimed in claim 1.

5. The expression vector according to claim 4, characterized in that: The target gene is β-glucuronidase gene, and the expression vector is pBI121::BnMYB6 pro ::GUS.

6. A method for constructing a transgenic plant expressing a transferred gene induced by high temperature, characterized in that: The following steps are involved: S1, construction of the expression vector of the target gene; S2, connecting the promoter described in claim 1 to the expression vector of step S1, and then transforming it into Agrobacterium; S3, using the transformed Agrobacterium strain to mediate plant transformation to obtain transgenic plants that express the transferred gene inducibly by high temperature.

Images