Recombinant humanized IV-type collagen M2 or M4 as well as preparation method and application thereof

Abstract

The invention discloses a recombinant humanized IV-type collagen M2 or M4, a nucleic acid molecule sequence for coding the recombinant humanized IV-type collagen M2 is shown as SEQ ID NO.1, and a nucleic acid molecule sequence for coding the recombinant humanized IV-type collagen M4 is shown as SEQ ID NO.3. The invention also discloses a recombinant humanized IV-type collagen M4. The recombinant humanized IV-type collagen M2 or M4 provided by the invention adopts a genetic engineering technology and a biological fermentation method to express and purify the recombinant humanized IV-type collagen, has the advantages of single component of a final product, few impurities, no animal virus, no immune risk, convenience in industrialization and the like, can effectively improve the proliferation and migration activity of cells, and can be used for preparing the recombinant humanized IV-type collagen. The method can be widely applied to the fields of food, cosmetics, health care products and medical and mechanical products.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a recombinant humanized type IV collagen M2 or M4 and a preparation method and application thereof. Background Art

[0002] Collagen is mainly distributed in the extracellular matrix (ECM) and is the main material basis of connective tissue. So far, 28 different types of collagen have been discovered. Collagen family members have a unique heterotrimeric helical structure. According to whether they can form collagen fibrils with periodic striations, they are divided into fibrillar collagen and nonfibrillar collagen. Common fibrillar collagens include type I, II, III, V and XI collagens, and common nonfibrillar collagens include type IV and X collagens. Collagen IV is a member of the collagen family and belongs to nonfibrillar collagen. It also has a unique heterotrimeric helical chain structure and is mainly found in the basement membranes (BMs). Collagen IV not only plays an important role in the formation of the basement membrane skeleton, but also has the function of participating in important physiological processes such as cell adhesion, migration, growth, proliferation and differentiation.

[0003] However, the structure of natural collagen is very complex, and its insoluble nature in water has caused certain restrictions on its research and development, application and production. The main methods for producing collagen at present include acid-base treatment of animal tissues (such as pig skin, cow skin, donkey skin and fish, etc.), and enzymatic extraction. Although these methods perform well in terms of recovery rate, the extracted collagen is still a mixed peptide of different lengths, and the water solubility of each peptide varies greatly, which makes it difficult to separate pure peptides alone. In addition, since most of the extracted collagen is heterologous, it is easy to cause rejection reactions during clinical applications, which limits its application in the fields of biomedical materials or drug carriers. At the same time, the collagen obtained by these methods is far inferior to the natural collagen of the human body in terms of biological activity, and cannot meet the needs of industries such as medicine, food and cosmetics.

[0004] Compared with animal collagen, human collagen has better biological efficacy, but it cannot be extracted from human tissue using the extraction method, and the extraction method has hidden dangers of viruses and allergies, as well as cumbersome post-processing processes. Therefore, the preparation of human collagen with a single component and high purity has become a trend. Therefore, the field urgently needs to develop highly expressed, water-soluble, and more active type IV collagen. Recombinant humanized type IV collagen expressed and purified by biofermentation using genetic engineering technology has the advantages of a single final product component, few impurities, no animal viruses, no immune risks, and convenient industrialization. Therefore, the use of genetically engineered yeast strains combined with fermentation engineering to recombinant humanized type IV collagen is urgently needed in the current market. Summary of the invention

[0005] In view of the deficiencies in the prior art, the purpose of the present invention is to provide a recombinant humanized type IV collagen M2 or M4 and a preparation method and application thereof, so as to achieve high expression of type IV collagen, good water solubility, better activity, no immune risk and industrialization, and provide an important basis for its application in biology and medicine.

[0006] In order to achieve the above object, the present invention adopts the following technical scheme:

[0007] The first aspect of the present invention provides a recombinant humanized type IV collagen M2 or M4, the nucleic acid molecule sequence encoding the recombinant humanized type IV collagen M2 is shown as SEQ ID NO.1, and the nucleic acid molecule sequence encoding the recombinant humanized type IV collagen M4 is shown as SEQ ID NO.3.

[0008] Preferably, the nucleic acid molecule sequence encoding the recombinant humanized type IV collagen M4 is shown as SEQ ID NO.3.

[0009] Another aspect of the present invention provides a vector, wherein the vector comprises the nucleic acid molecule of collagen M2 or M4 as described above.

[0010] Another aspect of the present invention provides a host cell, wherein the host cell comprises the nucleic acid molecule of collagen M2 or M4 as described above.

[0011] Preferably, the host cell is a prokaryotic cell or a eukaryotic cell.

[0012] Preferably, the eukaryotic cell is Pichia pastoris.

[0013] Another aspect of the present invention provides a method for preparing the recombinant humanized type IV collagen M2 or M4 as described above, the method comprising the following steps:

[0014] The recombinant humanized type IV collagen M2 or M4 is expressed by the host cells as described above, and then separated and purified.

[0015] Another aspect of the present invention provides the use of the recombinant humanized type IV collagen M2 or M4 as described above in the preparation of food, cosmetics or pharmaceutical products.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The recombinant humanized type IV collagen M2 or M4 provided by the present invention adopts genetic engineering technology and biological fermentation method to express and purify recombinant humanized type IV collagen, which has the advantages of single final product composition, few impurities, no animal virus, no immune risk and convenient industrialization, can effectively enhance the cell proliferation and migration activity, and can be widely used in the fields of food, cosmetics, health care products and pharmaceutical and medical products. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is the map of plasmids pPIC9K-M2 and pPIC9K-M4 in Example 3 of the present invention;

[0019] Figure 2 The maps of plasmids pPIC9K-6XCDS-M2 and pPIC9K-6XCDS-M4 in Example 3 of the present invention;

[0020] Figure 3 is the map of the plasmid pPICZA-CPB+KEX2 in Example 4 of the present invention;

[0021] Figure 4 This is a diagram showing the expression of the M2 protein in Example 5 of the present invention;

[0022] Figure 5 This is a diagram showing the expression of the M4 protein in Example 5 of the present invention;

[0023] Figure 6 Non-reducing SDS-PAGE protein electrophoresis and reducing SDS-PAGE protein electrophoresis for the small molecule collagens M2 and M4 in Example 6 of the present invention;

[0024] Figure 7 The liquid chromatography and mass spectrometry molecular weight spectra of the purified M2 and M4 proteins in Example 7 of the present invention;

[0025] Figure 8 This is a graph of relative cell proliferation activity of recombinant human type IV small molecule collagen (M2 and M4) in Example 8 of the present invention;

[0026] Fig. 9This is a graph showing the cell migration activity of the recombinant human type IV small molecule collagen (M2 and M4) in Example 9 of the present invention;

[0027] Fig.10 This is a cell migration diagram of the recombinant human type IV small molecule collagen (M2 and M4) in Example 9 of the present invention. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below through specific preferred embodiments, but the present invention is not limited to the following embodiments.

[0029] It should be noted that, unless otherwise specified, the chemical reagents involved in the present invention were purchased through commercial channels.

[0030] Example 1 Sequence analysis and acquisition of candidate small molecule collagen sequences

[0031] The amino acid sequence of human type IV collagen α2 chain is from the National Center for Biotechnology Information, USA, with the accession number KAI4063798.1

[0032] (https: / / www.ncbi.nlm.nih.gov / protein / KAI4063798.1 / ), with a total length of 1712aa. Integrins on the cell membrane bind to integrin recognition sites in the extracellular matrix components and complete information exchange between cells and between cells and the external environment. Collagen is an important component of the extracellular matrix. Therefore, the number of integrin recognition sites in the collagen sequence will affect the life activities of cells, such as proliferation activity, adhesion activity and migration activity. Based on this, we analyzed the existence of multiple integrin sites in the 258-346 segment of the type IV collagen α1 chain amino acid sequence, such as GEK, GER, etc., and named it M icro COLVIIα1- 2 (abbreviated as M2). At the same time, we analyzed the amino acid sequence of type IV collagen α1 chain and found multiple integrin sites in the 583-681 segment, such as GEK, GER, etc., which were named M icro COLVIIα1- 4 (abbreviated as M4).

[0033] Example 2 Codon Optimization and Synthesis of M2 and M4 Collagen Base Sequences

[0034] In order to analyze the expression of M2 and M4 collagen sequence fragments, we used the Pichia pastoris expression system for an attempt. Since the base sequences encoding the M2 and M4 collagen sequence fragments come from humans, and considering that the expression host is Pichia pastoris, there is a preference for codon usage between the two, so we used GenSmartTM codon optimization (Version Beta1.0) online software to codon optimize the base sequence of the M2 collagen sequence fragment to make it more suitable for the yeast expression system. The optimized sequence is shown in SEQ ID NO.1:

[0035] GGTGAGAAAGGCCAGAAGGGAGAACCAGGTTTTCAAGGTATGCCTGGTGTAGGGGAAAAAGGTGAGCCAGGGAAGCCTGGGCCGAGAGGGAAGCCCGGGAAAGATGGGGACAAAGGAGAAAAAGGATCCCCCGGA TTCCCTGGCGAGCCGGGGTACCCAGGGCTCATTGGACGGCAAGGCCCCCAGGGAGAAAAGGGAGAGGCCGGCCCTCCGGGTCCTCCGGGCATCGTCATAGGTACAGGCCCATTAGGCGAAAAGGGTGAGCGATAA.

[0036] The natural sequence is shown in SEQ ID NO.2:

[0037] GGAGAAAAGGGCCAAAAAGGTGAACCTGGATTTCAGGGGATGCCAGGGGTCGGAGAGAAAGGTGAACCCGGAAAACCAGGACCCAGAGGCAAACCCGGAAAAGATGGTGACAAAGGGGAAAAAGGGAGTCCCGGTTTTCCTGGTGAACCCGGGTACCCAGGACTCATAGGCCGCCAGGGCCCGCAGGGAGAAAAGGGTGAAGCAGGTCCTCCTGGCCCACCTGGAATTGTTATAGGCACAGGACCTTTGGGAGAAAAAGGAGAGAGG. The homology between the optimized nucleotide sequence of M2 and the non-optimized nucleotide sequence of M2 is 77.65%.

[0038] The optimized sequence was then sent to GenScript Technologies for synthesis, and the synthesized sequence was integrated into the pEASYT3 vector and named pEASYT3-M2.

[0039] We used GenSmartTM codon optimization (Version Beta 1.0) online software to optimize the base sequence of the M4 collagen sequence fragment to make it more suitable for the yeast expression system. The optimized sequence is shown in SEQ ID NO.3:

[0040] GGCGAGCGAGGGCCACCTGGCGGCGTCGGCTTCCCCGGATCACGGGGGGACACAGGTCCACCGGGTCCACCTGGGTACGGTCCGGCGGGACCCATAGGAGACAAAGGTCAAGCTGGCTTTCCTGGAGGACCCGGTTCGCCGGGCCTACCA GGCCCAAAGGGGGAACCTGGTAAGATCGTGCCGTTACCTGGCCCCCCCGGAGCCGAAGGCTTGCCTGGTAGCCCGGGGTTTCCCGGACCGCAGGGTGATAGAGGTTTCCCCGGGACTCCAGGACGTCCGGGGCTCCCAGGGGAGAAATAA.

[0041] The natural sequence is shown in SEQ ID NO.4:

[0042] GGAGAGCGTGGCCCCCCTGGAGGAGTTGGATTCCCAGGCAGTCGTGGTGACACCGGCCCCCCTGGGCCTCCAGGATATGGTCCTGCTGGTCCCATTGGTGACAAAGGACAAGCAGGCTTTCCTGGAGGCCCTGGATCCCCAGGCCTGCC AGGTCCAAAGGGTGAACCAGGAAAAATTGTTCCTTTACCAGGCCCCCCTGGAGCAGAAGGACTGCCGGGGTCCCCAGGCTTCCCAGGTCCCCAAGGAGACCGAGGCTTTCCCGGAACCCCAGGAAGGCCAGGCCTGCCAGGAGAGAAG. The homology between the nucleotide sequence of the optimized M4 and the nucleotide sequence of the unoptimized M4 is 75.00%.

[0043] The optimized sequence was then sent to GenScript Technologies for synthesis, and the synthesized sequence was integrated into the pEASYT3 vector and named pEASYT3-M4.

[0044] Example 3 Construction of pPIC9K-M2 and pPIC9K-M4 vectors

[0045] (1) Enzyme digestion of pPIC9K expression vector: pPIC9K expression vector (Invitrogen, Catalog No.: V17520) plasmid was extracted and digested with EcoRI (NEB, Catalog No.: R3104S) restriction enzyme. The digestion system is as follows:

[0046] Enzyme digestion system (100 μL):

[0047]

[0048] The enzyme digestion was carried out at 37°C for 3 h. After the digestion, the plasmid was purified using a common DNA product purification kit (DP204) and set aside.

[0049] (2) Amplification of exogenous fragments of M2: To ensure that the M2 protein secreted and expressed by Pichia pastoris contains no exogenous amino acid residues, that is, humanized collagen; we used the KEX2 protease in Pichia pastoris. KEX2 specifically recognizes double basic amino acid sequences, such as RR, KR, and PR. Therefore, the first amino acid of M2 was connected to the back of the KEX2 protease recognition site KR. In this way, when Pichia pastoris secretes and expresses the recombinant protein, it will cut at the C-terminus of KR, so that the secreted M2 has no exogenous amino acid residues. To achieve this goal, we designed M2-L:

[0050] GTATCTCTCGAGAAAAGAGGTGAGAAAGGCCAGAAGGG and M2-R: GCGGCCGCCCTAGGGAATTCTTATCGCTCACCCTTTTCGCC primers. Amplification of exogenous fragments of M4: To ensure that the M4 protein secreted and expressed by Pichia pastoris has no exogenous amino acid residues, that is, humanized collagen; we used the KEX2 protease in Pichia pastoris. KEX2 specifically recognizes double basic amino acid sequences, such as RR, KR, PR, so the first amino acid of M4 was connected to the back of the KEX2 protease recognition site KR. In this way, when Pichia pastoris secretes and expresses the recombinant protein, it will be cut at the C-terminus of KR, so that the secreted M4 has no exogenous amino acid residues. To achieve this goal, we designed primers M4-L: GTATCTCTCGAGAAAAGAGGCGAGCGAGGGCCACCT and M4-R: GCGGCCGCCCTAGGGAATTCTTATTTCTCCCCTGGGAGCCC. TaKaRa R45Q DNA polymerase was used to amplify the DNA sequences of M2 and M4. The PCR system was as follows:

[0051]

[0052] The PCR program is as follows:

[0053] 98℃ 10sec

[0054] 55℃ 5sec

[0055] 72℃ 30sec

[0056] The PCR program was amplified for 28 cycles.

[0057] The target band was detected by agarose gel electrophoresis, and then purified using a DNA gel recovery kit (DP204) for later use.

[0058] (3) Ligation and positive clone verification: The pPIC9K linearized vector and M2 / M4PCR exogenous vector from (1) and (2) were respectively connected using TSINGKE TSV-S3 Seamless Cloning Kit is connected, and the connection system is as follows:

[0059] Ligation system (10 μL):

[0060] pPIC9K(EcoRI) 2.5μL

[0061] M2 / M4 PCR exogenous 2.5 μL

[0062] 2x Seamless Cloning Mix 5μL

[0063] React at 50℃ for 45min, transform the ligation product into DH5a E. coli (purchased from Jinsha Biotechnology), culture at 37℃ overnight, pick a single clone the next day, expand and extract the plasmid, verify by enzyme digestion and sequence the plasmid to confirm the correct insertion position and sequence. The correctly sequenced plasmids were named pPIC9K-M2 and pPIC9K-M4. The plasmid map is as follows Figure 1 shown.

[0064] Amplification of M2 multi-copy exogenous fragments: In order to increase the expression of M2 protein in Pichia pastoris, 5 copies of CDS were inserted after the original CDS sequence based on pPIC9K-M2. Each CDS was connected with the amino acid sequence KREAEA. In order to avoid wrong connection, 5 different KREAEA base sequences were selected and inserted according to the degeneracy of codons, namely: Aaacgagaggctgaagcc, Aaacgagaagcggaggcc, Aagagggaagcagaggcc, Aagcgtgaagcagaggct, Aaaagagaggcggaagcc. Primers were designed accordingly:

[0065] 2xM2-L:

[0066] GGCGAAAAGGGTGAGCGAAAACGAGAGGCTGAAGCCGGTGAGAAAGGCCAGAAGGG;

[0067] 2xM2-R:GGCCTCCGCTTCTCGTTTTCGCTCACCCTTTCGCC;

[0068] 3xM2-L: AAACGAGAAGCGGAGGCCGGTGAGAAAGGCCAGAAGGG;

[0069] 3xM2-R:GGCCTCTGCTTCCCTCTTTCGCTCACCCTTTCGCC;

[0070] 4xM2-L: AAGAGGGAAGCAGAGGCCGGTGAGAAAGGCCAGAAGGG;

[0071] 4xM2-R: AGCCTCTGCTTCACGCTTTCGCTCACCCTTTCGCC;

[0072] 5xM2-L: AAGCGTGAAGCAGAGGCTGGTGAGAAAGGCCAGAAGGG;

[0073] 5xM2-R:GGCTTCCGCCTCTCTTTTTCGCTCACCCTTTCGCC;

[0074] 6xM2-L: AAAAGAGAGGCGGAAGCCGGTGAGAAAGGCCAGAAGGG;

[0075] 6xM2-R: TAATTCGCGGCCGCCCTAGGGAATTCTTATCGCTCACCCTTTTCGCC.

[0076] Amplification of M4 multi-copy exogenous fragments: In order to increase the expression of M4 protein in Pichia pastoris, 5 copies of CDS were inserted after the original CDS sequence based on pPIC9K-M4. Each CDS was connected with the amino acid sequence KREAEA. In order to avoid wrong connection, 5 different KREAEA base sequences were selected and inserted according to the degeneracy of codons, namely: Aaacgagaggctgaagcc, Aaacgagaagcggaggcc, Aagagggaagcagaggcc, Aagcgtgaagcagaggct, Aaaagagaggcggaagcc. Primers were designed accordingly:

[0077] 2xM4-L: GGGCTCCCAGGGGAGAAAAAAACGAGAGGCTGAAGCCGGCGAGCGAGGGCC;

[0078] 2xM4-R: GGCCTCCGCTTCTCGTTTTTTCCCCTGGGAGCCC;

[0079] 3xM4-L: AAACGAGAAGCGGAGGCCGGCGAGCGAGGGCC;

[0080] 3xM4-R:GGCCTCTGCTTCCCTCTTTTTCCCCTGGGAGCCC;

[0081] 4xM4-L: AAGAGGGAAGCAGAGGCCGGCGAGCGAGGGCC;

[0082] 4xM4-R: AGCCTCTGCTTCACGCTTTTTCTCCCCTGGGAGCCC;

[0083] 5xM4-L:AAGCGTGAAGCAGAGGCTGGCGAGCGAGGGCC;

[0084] 5xM4-R: GGCTTCCGCCTCTCTTTTTTTCCCCTGGGAGCCC;

[0085] 6xM4-L: AAAAGAGAGGCGGAAGCCGGCGAGCGAGGGCC;

[0086] 6xM4-R: TAATTCGCGGCCGCCCTAGGGAATTCTTATTTCTCCCCTGGGAGCCC.

[0087] TaKaRa R45Q DNA polymerase was used to amplify five M2 DNA sequences using PCR. The PCR system was as follows:

[0088]

[0089] The PCR program is as follows:

[0090] 98℃ 10sec

[0091] 55℃ 5sec

[0092] 72℃ 30sec

[0093] The PCR program was amplified for 28 cycles.

[0094] The target band was detected by agarose gel electrophoresis, and then the five amplified fragments were mixed and purified using a common DNA product purification kit (DP204) for later use.

[0095] The pPIC9K-M2 linearized vector and five copies of M2 were PCR-transfected using TSINGKE TSV-S3 Seamless Cloning Kit is connected, and the connection system is as follows:

[0096] Ligation system (10 μL):

[0097] pPIC9K-M2(EcoRI) / pPIC9K-M4(EcoRI)2.5μL

[0098] M2 PCR exogenous / M4 PCR exogenous 2.5 μL

[0099] 2x Seamless Cloning Mix 5μL

[0100] React at 50℃ for 45min, transform the ligation product into DH5α E. coli (purchased from Jinsha Biotechnology), culture at 37℃ overnight, pick a single clone the next day, expand and extract the plasmid, verify by enzyme digestion and sequence the plasmid to confirm the correct insertion position and sequence. The correctly sequenced plasmids were named pPIC9K-6XCDS-M2 and pPIC9K-6XCDS-M4. The plasmid map is shown in Figure 2 shown.

[0101] Example 4 Preparation of competent yeast strain GS115 and electroporation

[0102] (1) Preparation of competent yeast strain GS115: A single colony of GS115 yeast was picked and inoculated into a 50 mL Erlenmeyer flask containing 5 mL YPD medium (10 g / L yeast extract; 20 g / L peptone; 20 g / L glucose) (purchased from Thermo Fisher), and cultured overnight at 30°C, 250 rpm; on the second day, the overnight culture was inoculated into a 200 mL Erlenmeyer flask containing 50 mL YPD medium at an inoculation ratio of 1:100, and cultured overnight at 30°C, 250 rpm. On the third day, the overnight culture was centrifuged at 4°C, 5000rpm for 5 min, and the bacterial pellet was resuspended with 50mL of ice-cold sterile water, centrifuged at 4°C, 5000rpm for 5 min, and the supernatant was discarded; then the bacterial pellet was resuspended with 50mL of ice-cold sterile water, centrifuged at 4°C, 5000rpm for 5 min, and the supernatant was discarded; the bacterial pellet was resuspended with 25mL of ice-cold 1M sorbitol solution, centrifuged at 4°C, 5000rpm for 5 min, and the supernatant was discarded; the bacterial pellet was resuspended with 1mL of ice-cold 1M sorbitol solution, and the pellet was divided into 80μL / tubes and stored on ice for later use. The remaining competent cells were stored in a -80°C ultra-low temperature refrigerator.

[0103] (2) Electroporation: Take 10 μg of pPIC9K-M2 and pPIC9K-M4 plasmids linearized with restriction endonuclease (enzyme digestion system: buffer 20 μL enzyme 5 μL plasmid 20 μg) and add them to 80 μL GS115 competent medium, mix well, transfer to a 0.2 cm ice-precooled electroporation cuvette, and place the electroporation cuvette on ice for 5 min. Use Gene PulserXcell TM The electroporation system (BIO-RAD) was used with the following parameters: voltage 1.5 kV; capacitance 25 μF; resistance 200 Ω; and electric shock time 4 to 10 msec. After the electric shock, 1 mL of 1 M pre-cooled sorbitol solution was immediately added to mix the bacteria, and the mixture was transferred to a 1.5 mL EP tube and cultured at 30°C and 250 rpm on a shaker for 1 to 2 h.

[0104] (3) Screening of positive transformants: The cultured bacterial liquid was spread on a yeast histidine-deficient medium plate (SD-HIS 8 g / L; glucose 20 g / L; agar 20 g / L, pH 6.0) (purchased from Sinopharm), and the plate was inverted and cultured in a 30°C incubator. Generally, a single colony grows after 4-5 days, and a gradient concentration screening of G418 (BBI, JC26BA0002) is carried out. A single colony is picked from the SD-HIS plate with a sterile pipette tip and streaked on a YPD plate (yeast extract 10g / L; peptone 20g / L; glucose 20g / L; agar 20g / L; 1mg / mL G418) (purchased from Sinopharm) containing 1mg / mL G418. The plate is inverted in a 30°C incubator and cultured until a single colony grows. Then, a single colony is picked from the 1mg / mL G418 plate with a sterile pipette tip and streaked on a YPD plate containing 5mg / mL G418. By analogy, continue to set up a 10mg / mL G418 concentration gradient screening.

[0105] Example 4 Yeast chassis modified strain construction

[0106] (1) Enzyme digestion of pPICZA expression vector: pPICZA plasmid was extracted and digested with restriction endonucleases EcoRI+XhoI (NEB, catalog number: R0146S). The enzyme digestion system was as follows:

[0107] Enzyme digestion system (100 μL):

[0108]

[0109] The enzyme digestion was carried out at 37°C for 3 h. After the digestion, the plasmid was purified using a common DNA product purification kit (DP204) and set aside.

[0110] (2) Amplification of exogenous fragments in chassis strains: To avoid incomplete enzyme cleavage to form protein polymers when the target protein is expressed, CPB and KEX2 exogenous sequences are inserted into the chassis strain, and the two sequences are connected in series with a P2A connecting peptide to construct pPICZA-SP+CPB+P2A+KEX2. The protein polymers are cleaved twice by expressing CPB and KEX2 proteases. Primers are designed accordingly:

[0111] GZ-1F: ACTAATTATTCGAAACGAGGAATTCATGTACCTTCCTGCACTAAGGC;

[0112] GZ-1R: AGAGAAGTTTGTTGCCAAGGCAGCACGTTTAGGGTGC;

[0113] GZ-2F:AAACGTGCTGCCTTGGCAACAAACTTCTCTCTGCTGA;

[0114] GZ-2R: GGCCGGAAGATACATCGGTCCAGGATTCTCTTCGACA;

[0115] GZ-3F: GAGAATCCTGGACCGATGTATCTTCCGGCCCTACGTT;

[0116] GZ-3R: CAAGCTGGCGGCCGCCGCGGCTCGAGTCAAAGCGCAGCCCGTTTCGGA, three DNA sequence fragments of SP+CPB, P2A and KEX2 were amplified by PCR using TaKaRa's R45Q DNA polymerase. The PCR system is as follows:

[0117]

[0118] The PCR program is as follows:

[0119] 98℃ 10sec

[0120] 55℃ 5sec

[0121] 72℃ 3min / 30sec

[0122] The PCR program was amplified for 28 cycles.

[0123] Purification kit (DP204) for later use.

[0124] (3) Ligation and positive cloning: The pPICZA linearized vector and PCR exogenous vector from 5.1 and 5.2 were respectively connected using TSINGKE TSV-S3 Seamless Cloning Kit is connected, and the connection system is as follows:

[0125] Ligation system (10 μL):

[0126]

[0127] React at 50℃ for 45min, transform the ligation product into DH5α E. coli (purchased from Jinsha Biotechnology), culture at 37℃ overnight, pick a single clone the next day, expand and extract the plasmid, verify by enzyme digestion and sequence the plasmid to confirm the correct insertion position and sequence. The correctly sequenced plasmid is named pPICZA-CPB+KEX2. The plasmid map is as follows Figure 3 shown.

[0128] Example 5 Preparation of competent chassis strains and electroporation

[0129] (1) Electroporation: Take 10 μg of pPICZA-CPB+KEX2 plasmid linearized with SacI (NEB, Catalog No.: R3156S) restriction endonuclease and add it to 80 μL of Pichia pastoris GS115 competent medium. After mixing, perform electroporation according to (5.2).

[0130] (2) Screening of positive transformants: Spread the cultured bacterial solution after electroporation on a YPD plate (yeast extract 10 g / L; peptone 20 g / L; glucose 20 g / L; agar 20 g / L; 300 μg / mL Zeo) (purchased from Sinopharm) containing 300 μg / mL Zeo (Invitiogen, catalog number: R25001), and invert the plate in a 30°C incubator for incubation. Generally, a single colony will grow after 4-5 days, and Zeo gradient concentration screening will be carried out. Use a sterile pipette tip to pick a single colony from the YPD plate containing 300 μg / mL Zeo and streak it on a YPD plate containing 1 mg / mL Zeo. Invert the plate in a 30°C incubator until a single colony grows. Then use a sterile pipette tip to pick a single colony from the 1 mg / mL Zeo plate and streak it on a YPD plate containing 2 mg / mL Zeo for incubation.

[0131] (3) Preparation of competent plates: Select the fastest growing pPICZA-CPB+KEX2 colonies from the YPD plate with 2 mg / mL Zeo concentration, prepare competent plates, name them GZ, and dispense them into 80 μL / tubes, and keep them on ice for later use. The remaining competent plates were stored in a -80°C ultra-low temperature freezer.

[0132] (4) Electrotransformation: 10 μg of pPIC9K-6XCDS-M2 plasmid and pPIC9K-6XCDS-M4 plasmid linearized with SalI restriction enzyme were added to 80 μL of chassis strain GZ competent medium for electrotransformation.

[0133] (5) Screening of positive transformants: Spread the cultured bacterial solution after electroporation on a yeast histidine-deficient medium plate, and incubate the plate upside down in a 30°C incubator. After colonies grow, perform G418 gradient concentration screening.

[0134] Example 6 Inducing expression and screening high expression strains

[0135] (1) Induced expression: Pick the fast-growing M2 colonies: pPIC9K-M2(GS115), pPIC9K-6XCDS-M2(GS115), pPIC9K-6XCDS-M2(GZ) colonies and M4 colonies: pPIC9K-M4(GS115), pPIC9K-6XCDS-M4(GS115), pPIC9K-6XCDS-M4(GZ) colonies from the YPD plate with 10 mg / mL G418 concentration. Inoculate into a 10 mL sterile centrifuge tube containing 2 mL YPD medium and culture at 30°C, 250 rpm overnight. Inoculate the overnight culture into a 100 mL shake flask containing 20 mL BMGY medium at an inoculation ratio of 1:100 and culture at 30°C, 250 rpm overnight. The remaining part of the YPD overnight culture was preserved in glycerol and stored in a -80°C refrigerator. Transfer the overnight culture to a 50 mL sterile centrifuge tube, centrifuge at 8000 rpm for 5 min at room temperature, collect the cells, resuspend the cells in BMMY medium to a 150 mL shake flask, make the final OD value about 2.0, and the final volume is 20 mL. Induce expression at 30°C and 250 rpm, take samples every 24 hours, and add 1% volume of methanol every day to continue induction.

[0136] (2) SDS-PAGE detection: The yeast was co-induced for expression for 10 days. Samples were taken every day and centrifuged at 12000 rpm for 5 min. 40 μL of the supernatant was taken and 10 μL of 5× reduced protein loading buffer (Biosharp, Catalog No.: BL502A) was added to mix well. The mixture was placed in a metal bath at 95°C for 5 min for heat denaturation. 20 μL of the denatured sample was added to the wells of 15% SDS-PAGE protein gel (GenScript Biotech, Catalog No.: M00930). After electrophoresis at 160 V for 1 h, the sample was stained and destained using a decolorizer (GenScript Biotech, Catalog No.: M00930) and photographed on a white light plate.

[0137] According to the results of induced expression Figure 4 , it was found that the pPIC9K-1XCDS-M2 strain can express small molecule collagen, but the protein expression level is low. After increasing the number of M2 copies, the expression level of pPIC9K-6XCDS-M2 was significantly improved. In the GS115 competent state, the protein polymer expressed by pPIC9K-6XCDS-M2 was not completely cleaved into short peptides, while in the 6 clones picked by the GZ competent state, proteins ③④⑤⑥ were almost completely cleaved into short peptides, showing a clear single band, and the expression level of protein ⑤ seemed to be the highest. Therefore, pPIC9K-6XCDS-M2⑤ (GZ) was determined as the engineering strain for subsequent fermentation condition optimization.

[0138] According to the results of induced expression Figure 5, it was found that the pPIC9K-1XCDS-M4 strain can express small molecule collagen, but the protein expression level is low. After increasing the number of M4 copies, the expression level of pPIC9K-6XCDS-M4 increased significantly. In the GS115 competent state, the protein polymer expressed by pPIC9K-6XCDS-M4 was not completely cleaved into short peptides, while in the 6 clones picked by the GZ competent state, proteins ③④⑤⑥ were almost completely cleaved into short peptides, showing a clear single band, and the expression level of protein ④ seemed to be the highest. Therefore, pPIC9K-6XCDS-M4④ (GZ) was determined as the engineering strain for subsequent fermentation condition optimization.

[0139] Example 6 Yeast strain fermentation, purification and thermal stability study

[0140] In the fermentation process, yeast strain M2 and yeast strain M4 were fermented in a tank at a 1% inoculation rate, and YP solution (yeast extract powder 10 g / L, trypsin 20 g / L) was added at a ratio of 10 mL / L / day, starting from 48 hours of induction and ending at 110 hours.

[0141] The harvested yeast fermentation harvest liquid was first filtered and clarified through a 0.1 μm hollow fiber (purchased from Hangzhou Kebet Filter Equipment Co., Ltd.) to collect the clarified filtered collected liquid. The clarified filtered collected liquid was diluted with purified water to a conductivity of 4.0-6.0 mS / cm, and the pH was adjusted to 4.0 as a cation exchange chromatography loading sample. The cation chromatography column (BXK26 / 20) was first balanced with cation buffer A for ≥5CV (column volume) until the UV210 absorbance and conductivity values ​​remained unchanged, and then the sample was loaded. After the loading was completed, the sample was washed with cation balance solution A (20mM sodium acetate, pH4.0) for ≥5CV until the UV210 absorbance and conductivity values ​​remained unchanged, and then eluted with 20% cation buffer B (20mM sodium acetate, 1M NaCl, pH4.0). When the UV210 absorbance value increased, the sample was collected, and when the UV210 absorbance value decreased to the lowest ultraviolet absorbance value and conductivity and remained unchanged, the collection was stopped. The cation chromatography elution collection solution was dialyzed with anion buffer and used as anion exchange chromatography loading sample. First, the anion chromatography column (Borgron QBestarose FF) was balanced with anion buffer for ≥5CV (column volume) until the UV210 absorbance and conductivity values ​​remained constant, and then the sample was loaded. When the UV210 absorbance value increased, the sample was collected. After the loading was completed, the column was rinsed with anion buffer C (20mM PB, 40mM NaCl, pH7.4) until the UV210 absorbance value dropped to the minimum and remained constant, and then the sample collection was stopped. The purified small molecule collagen M2 and M4 were subjected to non-reducing SDS-PAGE protein electrophoresis and reducing SDS-PAGE protein electrophoresis. The results are shown in Figure 6 As shown, the purity was ≥95%.

[0142] Example 7 Study on the quality of small molecule collagen

[0143] The purity and molecular weight of the purified M2 and M4 proteins were studied by high performance liquid chromatography-mass spectrometry. The method is as follows: chromatographic column: ACQUITY UPLC Peptide BEH C18 300A, 1.7um, 2.1×150mm. Mobile phase: MPA: 0.1% FA (formic acid), 2% ACN (acetonitrile), 98% H20; MPB: 0.1% FA (formic acid), 98% ACN (acetonitrile), 2% H2O. The injection volume is 4ug, the detection wavelength is UV 240nm, and the column temperature is 40℃. The chromatographic gradient conditions are shown in Table 1 below.

[0144] Table 1 Chromatographic gradient conditions

[0145]

[0146] After mass spectrometry ( Figure 7 ) The molecular weight of M2 was determined to be consistent with the theoretical molecular weight of 5.6 KD. The molecular weight of M4 was consistent with the theoretical molecular weight of 9.1 KDa.

[0147] Example 8 Cell proliferation activity detection

[0148] NIH-3T3 cells with good growth status and confluence of 80%-90% were digested and counted, and the digested NIH-3T3 cells were diluted with complete medium containing 10% FBS to 3×10 4 cells / cm 2 96-well plates were plated and placed in a CO2 incubator at 37°C and 5% CO2 concentration. After the NIH-3T3 cells adhered to the wells, the liquid in the wells was removed and washed once with 200 μL DMEM basal medium, and the washing solution was discarded before adding the corresponding samples.

[0149] Under sterile conditions, recombinant human type IV small molecule collagen M2 and M4 samples were taken, weighed in proportion, and diluted to 1 mg / mL with DMEM basal medium containing 1% FBS. 200 μL of recombinant human type IV small molecule collagen solution diluted to 1 mg / mL was added to the experimental group, 200 μL of DMEM basal medium containing 1% FBS was added to the negative control group, and 200 μL of 10% FBS DMEM complete medium was added to each well of the positive control group. Each group was repeated 5 times and placed in a carbon dioxide incubator for culture at a temperature of 37°C and a carbon dioxide concentration of 5%.

[0150] After 48 hours of culture, remove the supernatant from the 96-well plate and add 110 μL of CCK8 reagent (CCK8 reagent and DMEM basal medium are prepared at a ratio of 1:10), and add a blank control group for CCK8 detection (containing only CCK8 reagent and DMEM basal medium, without cells). Incubate in a 37°C, 5% CO2 incubator for 1.5 hours, use a multifunctional microplate reader to detect the absorbance of each well at a wavelength of 450nm, and statistically analyze the cell proliferation level of each group. The more the cells proliferate, the greater the absorbance OD value, and the relative cell proliferation activity results are shown in Table 2 below.

[0151] Relative cell proliferation activity calculation formula:

[0152] Relative cell proliferation activity = [(OD 样品组 -OD 空白组 ) / (OD 阴性对照组 -OD 空白组 )]×100%Table 2 Results of relative cell proliferation activity

[0153]

[0154] The activity and proliferation rate of fibroblasts determine the firmness of the skin and thus affect the condition of the skin. The decrease in the activity and number of fibroblasts will lead to skin aging. Therefore, the firming effect of the sample can be evaluated by testing the effect of the sample on the proliferation of fibroblasts. The faster the proliferation rate, the better the biological activity of collagen. Figure 8 The recombinant human type IV small molecule collagen M2 and M4 shown have significant differences compared with the negative control, indicating that the recombinant human type IV small molecule collagen M2 and M4 have the effect of promoting cell proliferation.

[0155] Example 9 Cell migration activity detection

[0156] Experimental preparation: First, use a marker pen to draw four horizontal lines on the back of a 6-well plate with a ruler, approximately one line every 0.5 cm. Digest and count NIH-3T3 cells with good growth and a confluence of 80%-90%. Dilute the digested NIH-3T3 cells with DMEM complete medium containing 10% FBS to 9×10 4 cells / cm 2 A 6-well plate was plated and placed in a carbon dioxide incubator at 37°C and a carbon dioxide concentration of 5%.

[0157] Under sterile conditions, take the recombinant human type IV small molecule collagen M2 and M4 samples, weigh them in proportion, and dilute them with DMEM basal medium to 1 mg / mL. After culturing the 6-well plate for 24±2 hours, use the tip of the gun to compare the ruler and try to scratch it perpendicular to the horizontal line on the back. The tip of the gun should not be tilted vertically. Then rinse the cells twice with DMEM basal medium to remove the scratched cells. The experimental group added 2mL of recombinant human type IV small molecule collagen solution diluted to 1mg / mL, the negative control group added 2mL of DMEM basal medium, and the positive control group added 2mL of 10% FBS DMEM complete medium to each well. Each group repeated 2 duplicate wells and placed in a carbon dioxide incubator for culture at a temperature of 37°C and a carbon dioxide concentration of 5%. Samples were taken at 0h and 24h of culture and photographed. The scratch area of ​​each picture was calculated using ImageJ image processing software, and the cell migration rate results are shown in Table 3 below.

[0158] The cell migration rate calculation formula is:

[0159] Cell migration rate = [(0h migration area - 24h migration area) / 0h migration area] × 100%

[0160] Table 3 Cell migration rate results

[0161]

[0162] The in vitro cell migration experiment of fibroblasts simulates the process of cell migration in vivo to a certain extent, and directly reflects the interaction between cells and extracellular matrix and cells under the influence of matrix. Cell migration activity is a more effective indicator to characterize the biological activity of collagen. The higher the migration rate and the faster the speed, the better the biological activity of collagen. Fig. 9 Compared with the negative control, the recombinant human type IV small molecule collagen (M2 and M4) shown in the figure showed significant differences. Fig.10 The actual comparison of cell migration captured at 0h and 24h as shown shows that recombinant human type IV small molecule collagen (M2 and M4) has the effect of promoting cell migration.

[0163] Finally, it should be noted that the above embodiments do not limit the present invention in any form. For those skilled in the art, some modifications and improvements can be made to the present invention. Therefore, any modification or improvement made without departing from the spirit of the present invention belongs to the scope of protection claimed in the present invention.

Claims

1. A recombinant humanized type IV collagen M2 or M4, characterized in that: The nucleic acid molecule sequence encoding the recombinant humanized type IV collagen M2 is shown in SEQ ID NO.1, and the nucleic acid molecule sequence encoding the recombinant humanized type IV collagen M4 is shown in SEQ ID NO.

3.

2. A carrier, characterized in that The vector comprises the nucleic acid molecule of collagen M2 or M4 as claimed in claim 1.

3. A host cell, characterized in that The host cell comprises the collagen M2 nucleic acid molecule or M4 nucleic acid molecule as claimed in claim 1.

4. The host cell according to claim 3, characterized in that The host cell is a prokaryotic cell or a eukaryotic cell.

5. The host cell according to claim 4, characterized in that The eukaryotic cell is Pichia pastoris.

6. A method for preparing the recombinant humanized type IV collagen M2 or M4 according to claim 1, characterized in that: The method comprises the following steps: The recombinant humanized type IV collagen M2 or M4 is expressed by the host cell described in any one of claims 3 to 5, and then separated and purified to obtain the recombinant humanized type IV collagen M2 or M4.

7. Use of the recombinant humanized type IV collagen M2 or M4 according to claim 1 in the preparation of food, cosmetics or pharmaceutical products.

Images