A method for improving photosynthetic capacity of a plant

By overexpressing the PMI1 protein in rice and using recombinant expression vectors and Agrobacterium-mediated genetic transformation, transgenic rice lines overexpressing the PMI1 protein were constructed. This solved the problem of insufficient photosynthetic capacity in rice, improved net photosynthetic rate and stomatal conductance, and enhanced photosynthetic capacity.

CN119979556BActive Publication Date: 2025-12-16SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411991811.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2025-12-16
Estimated Expiration
2044-12-31

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively enhance the photosynthetic capacity of rice and other gramineous crops, thus limiting their food production potential and impacting food security.

Method used

By overexpressing the PMI1 protein in plants, and using recombinant expression vectors and Agrobacterium-mediated genetic transformation, transgenic rice lines overexpressing the PMI1 protein were constructed to enhance photosynthetic capacity.

Benefits of technology

The breeding of plant varieties that significantly improve the net photosynthetic rate, stomatal conductance, and chlorophyll content of rice, thereby enhancing photosynthetic capacity without affecting rice yield, and promoting the improvement of photosynthetic capacity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119979556B_ABST
    Figure CN119979556B_ABST
Patent Text Reader

Abstract

The application discloses a method for improving photosynthetic capacity of plants. The application finds that the expression of PMI1 protein in rice can improve the photosynthetic capacity of rice, the net photosynthetic rate, the stomatal conductance and the chlorophyll content of rice, and meanwhile, the yield of rice is not affected, by constructing PMI1 protein super-expression transgenic rice lines and PMI1 protein function loss mutant rice lines respectively and determining the net photosynthetic rate, the stomatal conductance and the like of the obtained lines under normal light conditions. Therefore, the application provides a method for improving the photosynthetic capacity of plants, that is, improving the photosynthetic capacity of plants by super-expressing PMI1 protein in plants. The application is favorable for the cultivation of plant varieties with improved photosynthetic capacity.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering. More particularly, it relates to a method for improving the photosynthetic capacity of plants. BACKGROUND

[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, supplying the main food demand of 50% of the world's population. In recent years, with the continuous decline of rice planting area and the continuous growth of population, food security problems have gradually become prominent, and increasing rice yield has become an important way to solve food security problems.

[0003] Currently, the harvest index of rice, wheat and other gramineous crops has approached the theoretical limit. Photosynthesis is the basis of plant growth and yield formation. Improving leaf light energy conversion efficiency can not only increase the utilization efficiency of light energy and carbon dioxide by crops, but also improve the biomass and yield of crops. Leaf light energy conversion efficiency refers to the proportion of light energy absorbed by leaves that is converted into chemical energy through photosynthesis. The level of leaf light energy conversion efficiency depends largely on the photosynthetic capacity of leaves, including leaf photosynthetic rate, stomatal conductance, etc. The improvement of leaf photosynthetic rate is an important goal of high-yield and high-efficiency breeding. In addition, stomata are the main channel for carbon dioxide to enter and exit plants, and improving stomatal characteristics, such as stomatal conductance, is a major measure to reduce the limitation of stomata on photosynthetic efficiency.

[0004] In summary, it is necessary to continuously explore proteins involved in the regulation of plant photosynthetic capacity in order to cultivate crop varieties with improved photosynthetic capacity through molecular breeding, improve crop yield, and ensure food security. SUMMARY

[0005] The present application enriches the protein library involved in the regulation of plant photosynthetic capacity and improves the photosynthetic capacity of plants by providing a method for improving the photosynthetic capacity of plants using PMI1 protein.

[0006] The first object of the present application is to provide a method for improving the photosynthetic capacity of plants.

[0007] The second object of the present application is to provide the application of PMI1 protein in regulating the photosynthetic capacity of plants.

[0008] The third object of the present application is to provide the application of an expression promoter of PMI1 protein in improving the photosynthetic capacity of plants.

[0009] The fourth object of the present application is to provide the application of an expression promoter of PMI1 protein in the preparation of a product for improving the photosynthetic capacity of plants.

[0010] A fifth object of the present application is to provide an application of the expression promoter of PMI1 protein in constructing a plant strain with improved photosynthetic capacity.

[0011] The above objects of the present application are achieved by the following technical solutions.

[0012] The present application finds that promoting the expression of PMI1 protein in rice can improve the photosynthetic capacity of rice, increase the net photosynthetic rate, stomatal conductance and chlorophyll content of rice, and does not affect the yield of rice, by constructing PMI1 protein overexpression transgenic rice strains and PMI1 protein functional deletion mutant rice strains and measuring the net photosynthetic rate, stomatal conductance and other parameters of the obtained strains under normal light conditions.

[0013] Specifically, the method for improving the photosynthetic capacity of plants is to overexpress PMI1 protein in plants.

[0014] Specifically, the amino acid sequence of the PMI1 protein is shown in SEQ ID NO. 1.

[0015] Specifically, the overexpression of PMI1 protein in plants is achieved by constructing a recombinant expression vector containing a gene encoding PMI1 protein and transforming plants. Specifically, the cDNA sequence of the gene encoding PMI1 protein is shown in SEQ ID NO. 2.

[0016] Specifically, the promoter region and gDNA sequence of the gene encoding PMI1 protein are shown in SEQ ID NO. 3.

[0017] Specifically, the recombinant expression vector contains a constitutive strong promoter, which can overexpress the target gene.

[0018] Alternatively, the constitutive strong promoter is a maize ubiquitin gene (Ubiquitin) promoter (P ubi ).

[0019] In a specific embodiment of the present application, the vector used for constructing the recombinant expression vector is pCambia1300-pOX vector, which is obtained by inserting the maize ubiquitin gene promoter (P ubi ) after the promoter P35s based on the pCambia1300 vector.

[0020] Specifically, the transformation is achieved by using the Agrobacterium-mediated genetic transformation method.

[0021] Alternatively, the Agrobacterium is Agrobacterium EHA105.

[0022] Specifically, the photosynthetic capacity includes net photosynthetic rate, stomatal conductance and / or chlorophyll content.

[0023] Specifically, the plant is a Gramineae plant.

[0024] Specifically, the Gramineae plant is rice.

[0025] Meanwhile, the application claims the application of PMI1 protein in regulating the photosynthetic capacity of plants.

[0026] Specifically, the amino acid sequence of the PMI1 protein is shown in SEQ ID NO. 1.

[0027] Specifically, the photosynthetic capacity includes net photosynthetic rate, stomatal conductance and / or chlorophyll content.

[0028] Specifically, the plant is a Gramineae plant.

[0029] Specifically, the Gramineae plant is rice.

[0030] In view of the fact that overexpression of PMI1 protein with the amino acid sequence shown in SEQ ID NO. 1 in plants can improve the photosynthetic capacity of plants, the application also claims the application of an expression promoter of PMI1 protein in improving the photosynthetic capacity of plants.

[0031] The application also claims the application of an expression promoter of PMI1 protein in preparing a product for improving the photosynthetic capacity of plants.

[0032] The application also claims the application of an expression promoter of PMI1 protein in constructing a plant strain with improved photosynthetic capacity.

[0033] Specifically, the photosynthetic capacity includes net photosynthetic rate, stomatal conductance and / or chlorophyll content.

[0034] Specifically, the plant is a Gramineae plant.

[0035] Specifically, the Gramineae plant is rice.

[0036] Optionally, the expression promoter is a recombinant expression vector containing a gene encoding PMI1 protein or a genetically engineered bacterium containing a recombinant expression vector containing a gene encoding PMI1 protein.

[0037] Specifically, the recombinant expression vector contains a constitutive strong promoter, which can overexpress the target gene.

[0038] Optionally, the constitutive strong promoter is a maize ubiquitin gene promoter.

[0039] In a specific embodiment of the present application, the vector used for constructing the recombinant expression vector is pCambia1300-pOX vector, which is obtained by inserting the maize ubiquitin gene promoter into the pCambia1300 vector after the P35s promoter.

[0040] The present application has the following beneficial effects:

[0041] The present application finds that promoting the expression of PMI1 protein in rice can improve the photosynthetic capacity of rice, increase the net photosynthetic rate, stomatal conductance and chlorophyll content of rice, and does not affect the yield of rice by constructing PMI1 protein overexpression transgenic rice lines and PMI1 protein functional deletion mutant rice lines and determining the net photosynthetic rate, stomatal conductance and other parameters of the obtained lines under normal light conditions. Therefore, the present application provides a method for improving the photosynthetic capacity of plants, i.e. improving the photosynthetic capacity of plants by overexpressing PMI1 protein in plants. The present application is conducive to the cultivation of plant varieties with improved photosynthetic capacity. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 Figure 4 is the electrophoresis detection result of the PCR amplification product of the cDNA sequence of OsPMI1 gene.

[0043] Figure 2 Figure 5 is a schematic diagram of the structure of pCambia1300-pOX vector.

[0044] Figure 3 Figure 6 is the PCR detection result of the T0 generation transformed plants described in Example 1.

[0045] Figure 4 Figure 7 is the expression amount detection result of OsPMI1 gene in the homozygous lines OEPMI1-32 and OEPMI1-33 of T2 generation described in Example 1.

[0046] Figure 5 Figure 8 is the photosynthetic capacity analysis result of PMI1 protein overexpression transgenic rice lines, PMI1 protein functional deletion mutant rice lines and wild type rice lines under sunny and cloudless conditions, Figure 5 wherein A-E are the analysis results of net photosynthetic rate (Net Photosynthetic net), stomatal conductance (Cond), light saturation (lightsaturation), light compensation point (light compensation point) and light saturation point (Amax) of the lines, respectively; *p<0.05; **p<0.01; ***p<0.001 in the figure.

[0047] Figure 6Figure 3 is a result of stomata scanning of PMI1 protein overexpression transgenic rice strain, PMI1 protein functional deficiency mutant rice strain and wild type rice strain under sunny and cloudless conditions; in the figure, ***p<0.001.

[0048] Figure 7 Figure 4 is total chlorophyll content of PMI1 protein overexpression transgenic rice strain, PMI1 protein functional deficiency mutant rice strain and wild type rice strain; in the figure, A is total chlorophyll content of the strains at flowering stage; B is total chlorophyll content of the strains at mature stage; in the figure, **p<0.01; ***p<0.001.

[0049] Figure 8 Figure 5 is leaf starch staining result of PMI1 protein overexpression transgenic rice strain, PMI1 protein functional deficiency mutant rice strain and wild type rice strain at flowering stage.

[0050] Figure 9 Figure 6 is yield trait analysis result of PMI1 protein overexpression transgenic rice strain, PMI1 protein functional deficiency mutant rice strain and wild type rice strain; in the figure, A-D are grain width, plant height, tiller number and plot yield of the strains, respectively; in the figure, ***p<0.001. DETAILED DESCRIPTION

[0051] The present application will be further described below in conjunction with the drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the technical field.

[0052] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0053] The PMI1 protein described in the examples of the present application is rice PMI1 protein (OsPMI1), the amino acid sequence of which is shown in SEQ ID NO. 1; the cDNA sequence of OsPMI1 gene encoding the protein is shown in SEQ ID NO. 2; the promoter region and gDNA sequence of OsPMI1 gene are shown in SEQ ID NO. 3.

[0054] Example 1 Construction of PMI1 protein overexpression transgenic rice strain

[0055] 1. Cloning of OsPMI1 gene cDNA sequence

[0056] In order to amplify the cDNA sequence of rice PMI1 gene (OsPMI1) (shown in SEQ ID NO. 2), the present application designs corresponding PCR amplification primers, the nucleotide sequences (5'-3') of the designed primers are as follows:

[0057] OsPMI1F: AAGCTTACTAGTACGATGGCGGACGACGGCAAGAG

[0058] OsPMI1R: TGATAGGATCCATAACGCTTGAGAGGGATCTTCACGT

[0059] The cloning process of the OsPMI1 gene cDNA sequence is as follows:

[0060] Total RNA of seedling leaves of a rice variety Nanguizhan is extracted by using TriZol Reagent (Invitrogen, item number: 15596026), and the purity and concentration of the extracted total RNA are detected by using a UV spectrophotometer. 1 μg of the total RNA meeting the experimental requirements in purity and concentration is subjected to a reverse transcription reaction. The enzyme used in the reverse transcription reaction is AMV reverse transcriptase of TAKARA Company, and the operation steps of the reverse transcription reaction refer to the instruction manual of the used reverse transcriptase. The product obtained by the reverse transcription reaction is used as a template, and primers OsPMI1F and OsPMI1R are used for PCR amplification. The polymerase used in the PCR reaction is KOD FX of Toyobo Company, and the PCR reaction system is prepared according to the instruction manual of KOD FX. The PCR reaction conditions are as follows: 94℃ for 3 min; 94℃ for 30 sec, 60℃ for 30 sec, 68℃ for 150 sec, 35 cycles; 68℃ for 5 min; the PCR amplification product is subjected to electrophoresis detection and is transformed and sequenced.

[0061] The electrophoresis detection result of the PCR amplification product of the OsPMI1 gene cDNA sequence is shown in Figure 1 . It can be known from Figure 1 that the present application amplifies a single band with a correct size. At the same time, it can be known from the sequencing result that the present application successfully amplifies the OsPMI1 gene cDNA sequence shown in SEQ ID NO. 2.

[0062] 2. Construction of recombinant expression vector

[0063] The PCR amplification product of the OsPMI1 gene cDNA sequence recovered by cutting the gel is used to respectively cut the PCR amplification product and the pCambia1300-pOX vector (modified by inserting the maize ubiquitin gene promoter (P ubi ) after the promoter P35s in the pCambia1300 vector) by using a restriction endonuclease Mlu I, and the two are ligated to obtain a recombinant expression vector pCambia1300-pOX-OsPMI1. Figure 2The cDNA fragment and the linearized vector are connected by using a homologous recombination enzyme, and the connection system is as follows: 5 μL of the homologous recombination enzyme, 3 μL (200 ng) of the cDNA fragment after enzyme digestion, and 2 μL (50 ng) of the linearized pCambia1300-poX vector, and the connection condition is as follows: 50 ℃ connection for 5 min; 10 μL of the connection product is taken, transformed into E. coli DH5α competent cells by using a heat shock transformation method, and the transformation product is coated on LB solid culture medium containing kanamycin; after being cultured at 37 ℃ overnight, 10 single colonies are picked, and plasmids are extracted, enzyme-digested, and sequenced for identification.

[0064] The nucleotide sequence (5'-3') of the primer used for sequencing identification is as follows:

[0065] OsPMI1 TF: ACTTCGAGGAGACGCTCTTC

[0066] R2: CGATCTAGTAACATAGATGACAC

[0067] According to the enzyme digestion and sequencing identification results, the recombinant expression vector containing the OsPMI1 gene cDNA sequence shown in SEQ ID NO. 2 is successfully constructed, and can be used for construction of a PMI1 protein super-expression transgenic rice strain.

[0068] 3. Construction of a PMI1 protein super-expression transgenic rice strain

[0069] In this embodiment, the constructed recombinant expression vector is transformed into callus of a wild type indica rice variety Nanguizhan (NGZ) by using an Agrobacterium EHA105-mediated genetic transformation method, and the specific method is carried out according to the literature (Zhou L Y, Jiang D G, Wu H, et al. Establishment of a rice transformation system based on TAC vector [J]. Acta Genetica Sinica, 2005, 32(005): 514-518.). After screening, pre-differentiation and differentiation, 6 T0 generation transformed plants are obtained in this embodiment, and PCR detection is carried out on the T0 generation transformed plants to identify whether the plants are positive transformed plants at the DNA level.

[0070] The nucleotide sequence (5'-3') of the primer used for PCR detection is as follows:

[0071] Primer 1: GACAGCGTCTCCGACCTGAT

[0072] Primer 2: CATCGCCTCGCTCCAGTCAAT

[0073] The reaction system used for PCR detection is shown in Table 1.

[0074] Table 1

[0075]

[0076] PCR detection used reaction conditions were: 94℃ 2 min; 94℃ 20 sec, 58℃ 20 sec, 72℃ 30 sec, 30 cycles; 72℃ 5 min.

[0077] After the PCR reaction, the PCR amplification product was detected by 1% agarose gel electrophoresis. If the sample to be tested is a positive transformed plant, a single band of about 600 bp in size can be amplified. The PCR detection results of the T0 generation transformed plants are shown in Figure 3 Figure 3 It can be seen from

[0078] The obtained T0 generation positive transformed plants were selfed to obtain transgenic 1 (T1) generation lines. Each line selected 10 plants positive for PCR detection were selfed to breed T2 generation lines. The T2 generation lines were further subjected to PCR detection to obtain two T2 generation homozygous lines derived from different T0 generation plants, which were named OEPMI1-32 and OEPMI1-33, respectively.

[0079] The total RNA of the flag leaves of T2 generation homozygous lines OEPMI1-32 and OEPMI1-33 at the flowering stage was extracted and reverse transcribed to obtain cDNA. The obtained cDNA was used as a template for qPCR detection to detect the expression level of the target gene OsPMI1, with the detection results of the wild type NGZ plant as a control, and the reference gene being Actin.

[0080] The nucleotide sequences (5'-3') of the primers used for qPCR detection are as follows:

[0081] Primer F: TTGCGAGGCATTGACGACTT

[0082] Primer R: GGAACTCCGAGTCATCGACC

[0083] Reference primer F: CACATTCCAGCAGATGTGGA

[0084] Reference primer R: GCGATAACAGCTCCTCTTGG

[0085] The reaction system and conditions used for qPCR are shown in Tables 2 and 3, respectively.

[0086] Table 2 Reaction system used for qPCR

[0087]

[0088] Table 3 Reaction conditions used for qPCR

[0089]

[0090] The expression amount detection results of the OsPMI1 gene in T2 generation homozygous strains OEPMI1-32 and OEPMI1-33 are shown in Table 2. Figure 4 Figure 4 It can be known that the OsPMI1 gene is highly expressed in strains OEPMI1-32 and OEPMI1-33, and is lowly expressed in the wild type strain, which indicates that the PMI1 protein overexpression transgenic rice strain is successfully constructed.

[0091] Example 2 Construction of PMI1 protein functional deletion mutant rice strain

[0092] In this embodiment, the method in the reference (Ma X, Zhang Q, Zhu Q, et al. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot Plants. Mol Plant [J], 2015, 8(8): 1274-1284) is referred to, and a PMI1 protein functional deletion mutant rice strain is constructed by using a CRISPR / Cas9 gene editing system.

[0093] The linker primers designed for the OsPMI1 gene are shown as follows, the linker primers are synthesized, and the gRNA expression cassette is connected to the pYLCRISPR / Cas9 vector, the obtained vector is transformed into callus of a wild type indica rice variety Nanguizhan (NGZ), after screening, differentiation and rooting seedling, the PMI1 protein functional deletion mutant rice strain is screened and identified by sequencing.

[0094] The designed linker primers are as follows:

[0095] CasPMI1U3T1F: ggcaGCCCCGGCCGTTCCTCCTGT

[0096] CasPMI1U3T1R: aaacACAGGAGGAACGGCCGGGGC

[0097] CasPMI1U6bT2F: gttgCTGTTCCAGCAGCTGTGCGC

[0098] CasPMI1U6bT2R: aaacGCGCACAGCTGCTGGAACAG

[0099] ​Through sequencing identification, two PMI1 protein functional deletion mutant rice strains are successfully constructed, and are named as Caspmi-1 and Caspmi-6.

[0100] Example 3 Photosynthetic capacity analysis and yield trait identification

[0101] 1. Photosynthetic capacity analysis

[0102] In order to analyze the influence of OsPMI1 gene on the photosynthetic capacity of rice, the flowering stage rice plants of PMI1 protein overexpression transgenic rice strains OEPMI1-32 and OEPMI1-33, PMI1 protein functional deletion mutant rice strains Caspmi-1 and Caspmi-6, and wild type NGZ were analyzed for photosynthetic efficiency under sunny and cloudless conditions by using Li-cor6400 XT portable photosynthesis instrument. Among them, the light intensity gradient is set from high to low as follows: 1500, 1200, 1000, 800, 600, 400, 200, 150, 100, 50, 20 and 0; Minimum wait time (seconds) is set to 120; Maximum wait time (seconds) is set to 200; Match if | ΔCO2 | less than (ppm) is set to 20 or 15, and automatic measurement is entered, and the measurement is waited to end.

[0103] According to the above steps, the Pn-PAR response curve was measured by using Li-cor6400 XT portable photosynthesis instrument from 8:00 to 12:00, and Li-6400-02B red and blue light source was used. The sunny day was continuously measured for one day, three parallel determinations were made for each strain, and the net photosynthetic rate (Pn, μmol·m -2 ·s -1 ), stomatal conductance (Gs, mmol·m -2 ·s -1 ), and intercellular CO2 concentration (Ci, μmol / mol) of rice leaves under each light intensity were measured. In addition, under sunny and cloudless conditions, the stomata of PMI1 protein overexpression transgenic rice strains OEPMI1-32 and OEPMI1-33, PMI1 protein functional deletion mutant rice strains Caspmi-1 and Caspmi-6, and wild type NGZ after photosynthesis were observed by scanning.

[0104] The results of photosynthetic capacity analysis of PMI1 protein overexpression transgenic rice strains, PMI1 protein functional deletion mutant rice strains and wild type rice strains under sunny and cloudless conditions are shown in Table 1. Figure 5 Figure 5 ​In the table, A through E represent the analysis results of net photosynthetic net, stomatal conductance (Cond), light saturation, light compensation point, and light saturation point (Amax), respectively. Figure 5 It can be seen that the photosynthetic efficiency, stomatal conductance, intercellular carbon dioxide concentration, and photosynthetic saturation point of the transgenic rice lines OEPMI1-32 and OEPMI1-33, which overexpress the PMI1 protein, are all higher than those of the wild type.

[0105] Under clear, cloudless conditions, stomatal scanning results of PMI1 protein overexpressing transgenic rice lines, PMI1 protein loss-of-function mutant rice lines, and wild-type rice lines are as follows: Figure 6 As shown. By Figure 6 It can be seen that the PMI1 protein overexpression transgenic rice lines OEPMI1-32 and OEPMI1-33 have more stomata in their leaves, and the reason for their higher stomatal conductance may be the increase in the number of stomata.

[0106] The total chlorophyll content at flowering and maturity stages of PMI1 protein overexpression transgenic rice lines, PMI1 protein loss-of-function mutant rice lines, and wild-type rice lines are as follows: Figure 7 As shown in A and B in the diagram. Figure 7 It can be seen that the total chlorophyll content of the PMI1 protein overexpressing transgenic rice lines OEPMI1-32 and OEPMI1-33 was higher than that of the wild type during the flowering and maturity stages. However, the total chlorophyll content of the PMI1 protein loss-of-function mutant rice lines Caspmi-1 and Caspmi-6 was not significantly different from that of the wild type, indicating that the photosynthetic potential of the leaves of the overexpressing transgenic rice lines OEPMI1-32 and OEPMI1-33 is better.

[0107] This invention also involved starch staining of leaves from transgenic rice lines overexpressing PMI1 protein during flowering, PMI1 protein loss-of-function mutant rice lines, and wild-type rice lines to observe the accumulation of photosynthetic products in the leaves.

[0108] Leaf starch staining: Leaves collected at 6:00 AM after a night of respiration and at 6:00 PM after a day of photosynthesis were stained with starch to detect the products accumulated during photosynthesis. 8.8 g of potassium iodide was added to 30 mL of preheated double-distilled water and stirred slowly until dissolved. Then, 2.2 g of crystalline iodine was added and shaken thoroughly until completely dissolved. The solution was then diluted to 1 L with double-distilled water to obtain iodine-potassium iodide (I₂-KI). Materials collected from the field were treated in 95% ethanol for 24–48 hours until completely decolorized. Afterward, they were stained with I₂-KI, and observed and photographed after approximately 20 minutes.

[0109] The results of starch staining of leaves of the PMI1 protein overexpression transgenic rice lines, PMI1 protein functional deletion mutant rice lines and wild type rice lines are shown in Figure 8 Figure 8 It can be seen that the leaves of the PMI1 protein overexpression transgenic rice lines OEPMI1-32 and OEPMI1-33 accumulate more products (with starch as reference) after one day of photosynthesis.

[0110] The above results show that overexpression of PMI1 protein can improve the photosynthetic capacity of rice leaves and improve the accumulation of photosynthetic products.

[0111] 2. Yield trait identification

[0112] Take several mature seeds of the PMI1 protein overexpression transgenic rice lines OEPMI1-32 and OEPMI1-33, the PMI1 protein functional deletion mutant rice lines Caspmi-1 and Caspmi-6 and the wild type NGZ, water them, and after the seeds germinate, clamp them on a 96-well plate for water culture, and after the seedlings are grown, plant them in a field net chamber and cultivate until maturity, and during the period, observe the phenotype and analyze the yield traits (statistic the tiller number, plot yield, plant height and seed kernel width of the rice plants).

[0113] The results of yield trait analysis of the PMI1 protein overexpression transgenic rice lines, PMI1 protein functional deletion mutant rice lines and wild type rice lines are shown in Figure 9 Figure 9 A-D in the table are the kernel width, plant height, tiller number and plot yield of the lines, respectively. Figure 9 It can be seen that overexpression of PMI1 protein can improve photosynthesis while maintaining the plot yield and tiller number of rice, thereby maintaining the stability of rice yield, and functional knockout of OsPMI1 gene can significantly reduce the kernel width of rice.

[0114] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations and simplifications made without departing from the spirit and principles of the present application are equivalent replacement methods and are included in the protection scope of the present application.​​

Claims

1. A method for improving photosynthetic capacity in rice, characterized by, The method is to overexpress PMI1 protein with amino acid sequence as shown in SEQ ID NO. 1 in rice.

2. The method of claim 1, wherein, The overexpression of PMI1 protein in rice is achieved by constructing a recombinant expression vector containing a gene encoding the PMI1 protein and transforming the rice.

3. The method of claim 2, wherein, The cDNA sequence of the gene encoding the PMI1 protein is shown as SEQ ID NO.

2.

4. Application of PMI1 protein with amino acid sequence as shown in SEQ ID NO. 1 in improving photosynthetic capacity of rice.

5. Application of expression promoter of PMI1 protein with amino acid sequence as shown in SEQ ID NO. 1 in improving photosynthetic capacity of rice.

6. Application of expression promoter of PMI1 protein with amino acid sequence as shown in SEQ ID NO. 1 in preparing products for improving photosynthetic capacity of rice.

7. Application of expression promoter of PMI1 protein with amino acid sequence as shown in SEQ ID NO. 1 in constructing rice strain with improved photosynthetic capacity.

8. The method according to any one of claims 1 to 3 or the use according to any one of claims 4 to 7, characterized in that, The photosynthetic capacity includes net photosynthetic rate, stomatal conductance and / or chlorophyll content.

9. Use according to any one of claims 5 to 7, characterized in that, The expression promoter is a recombinant expression vector containing a gene encoding the PMI1 protein or a genetically engineered bacterium containing the recombinant expression vector containing a gene encoding the PMI1 protein.

Citation Information

Patent Citations

  • Application of ZmPMI1L gene or encoded protein thereof in regulation and control of corn plant height

    CN118345100A

  • Compositions and methods for controlling gene expression

    WO2018144831A1