Application of MsLAC5 in aspects of changing plant cellulose monomer proportion and improving biomass oil energy yield

Abstract

The invention relates to application of MsLAC5 in changing the proportion of plant cellulose monomers and improving the biomass oil energy yield, and belongs to the technical field of plant genetic engineering, the amino acid sequence of the MsLAC5 is shown as SEQ ID NO.2, and the nucleotide sequence of the MsLAC5 is shown as SEQ ID NO.1. By overexpressing the MsLAC5 gene in the plant and increasing the proportion of the H lignin monomer in the plant in the total cellulose, the yield of the biomass oil prepared by plant hydrothermal cracking is increased.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering and discloses an application of MsLAC5 in changing the proportion of plant cellulose monomers and improving the yield of biomass oil. Background Art

[0002] Miscanthus is a fast-growing C4 plant with high water use efficiency and low fertilizer demand. It is mainly used as energy grass and forage. It grows rapidly, has high biomass, wide adaptability, strong stress resistance and is environmentally friendly. It can grow on saline, arid and barren marginal lands. It is an important type of fiber biomass resource. The lignocellulosic biomass contained in its cell wall is the most abundant and environmentally friendly bioethanol raw material in the world. Due to the rapid increase in the global population, the excessive consumption of fossil energy has made the development of renewable energy necessary. Biomass energy has the characteristics of abundant resources, environmental protection, cleanness and renewable, and is currently the most promising alternative energy. The development and research of biomass energy is mostly concentrated on two major categories: biodiesel and bioethanol. Among them, the development and utilization of bioethanol has gradually been commercialized. Aquathermolysis of biomass oil is an efficient technology for converting biomass into liquid fuel, which has important energy and environmental significance. Studies have shown that there is a certain linear relationship between the lignin content in biomass and the bio-oil yield. As the lignin content increases, the bio-oil yield may change. However, there is no report on which type of structural unit in the composition of lignin plays a decisive role in the biomass oil yield. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide an application of MsLAC5 in changing the proportion of plant cellulose monomers and improving the biomass oil yield, so as to solve the problem of insufficient gene resource library for improving the quality of energy plants.

[0004] The present invention is achieved through the following technical solutions:

[0005] The first object of the present invention is to provide an application of MsLAC5 in changing the proportion of plant cellulose monomers, wherein the application is to overexpress the MsLAC5 gene, thereby increasing the proportion of H-type lignin monomers in the total cellulose in the plant, or inhibit the expression of the MsLAC5 gene, thereby reducing the proportion of H-type lignin monomers in the total cellulose in the plant. The nucleotide sequence of the MsLAC5 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0006] The second object of the present invention is to provide an application of an MsLAC5 gene in improving the yield of plant biomass oil. The nucleotide sequence of the MsLAC5 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. The application is to overexpress the MsLAC5 gene in plants and increase the proportion of H lignin monomer in total cellulose in the plants, thereby increasing the yield of biomass oil prepared by plant hydrothermal cracking.

[0007] The third object of the present invention is to provide an application of a recombinant vector pro35S:MsLAC5 in improving the yield of plant biomass oil, wherein the application is to overexpress the MsLAC5 gene in Miscanthus sinensis using the recombinant vector pro35S:MsLAC5, thereby increasing the proportion of H lignin monomer in the total cellulose in the plant, thereby increasing the yield of biomass oil prepared by plant hydrothermal cracking.

[0008] The application method of the present invention is to obtain the CDS region sequence of the plant Laccase protein MsLAC5 gene. According to the Miscanthus genome information published on the Phytozome website, primers MsLAC5-F and MsLAC5-R are designed on both sides of the MsLAC5 full-length sequence, and the 1740bp Miscanthus Laccase protein MsLAC5 gene full-length sequence is obtained by PCR amplification. Afterwards, the obtained full-length sequence fragment is recombinantly integrated into the overexpression vector based on the Greengate technology; the target gene is stably transferred into the Arabidopsis reproductive cells by the flower immersion method, and the transgenic homozygous plants are obtained by glyphosate resistance screening. The positive transgenic plants are finally determined by PCR analysis; the results of the total lignin content, monomer content and aquathermolysis biomass oil yield determination show that constitutive overexpression of MsLAC5 can indeed increase the H-type lignin monomer content in the plant, but the total cellulose content remains unchanged, and the biomass oil yield is increased at the same time.

[0009] The core features and inventive concepts of the present invention include:

[0010] 1. Lignin is an important factor affecting the quality of plant cell walls. The present invention uses genetic engineering to target the Lac gene of the energy plant Miscanthus, and increases the expression level of the MsLAC5 gene in Arabidopsis through overexpression technology, thereby ultimately increasing the proportion of H-type lignin monomers in total cellulose in Arabidopsis, and obtaining transgenic Arabidopsis plants with increased hydrothermal cracking biomass oil yield, which has important guiding significance for the genetic breeding and directional molecular design of Gramineae forage plants.

[0011] 2. The present invention starts with the genes that regulate plant quality and regulates the plant lignin content through advanced genetic engineering technology, providing a new target for the genetic improvement and molecular breeding of the quality of perennial forage and other monocotyledonous crops.

[0012] The beneficial effects of the present invention compared with the prior art are as follows:

[0013] 1. The MsLAC5 gene obtained in the present invention is an important gene for regulating plant lignin monomer synthesis and improving oil production capacity, which makes an important contribution to obtaining high-yield energy plants through molecular directed design;

[0014] 2. In the present invention, the overexpression of Miscanthus MsLAC5 can significantly increase the content of H-type lignin in Arabidopsis and change the proportion of lignin monomers, which has important reference significance for the improvement of cell wall structure of energy plants and grass forage;

[0015] 3. The genetically modified plants produced in the present invention can be integrated into conventional breeding programs, thereby providing new germplasm resources for the breeding of energy plants and grass crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of MsLAC5 overexpression vector in Arabidopsis; a. Schematic diagram of MsLAC5 overexpression vector in wild-type Arabidopsis; b. Schematic diagram of MsLAC5 overexpression vector in Arabidopsis thaliana with Lac4-2 / lac17 double mutant;

[0017] Figure 2 qRT-PCR results of MsLAC5 gene in MsLAC5-overexpressing Arabidopsis plants; a. qRT-PCR results of MsLAC5 gene in wild-type Arabidopsis, WT represents wild-type Arabidopsis plants; p35S:MsLAC5 represents MsLAC5-positive transgenic plants; Dummy represents a short dummy sequence that replaces the CDS of the MsLAC gene and can be used as a control, and p35S:Dummy represents Dummy control plants. b. qRT-PCR results of MsLAC5 gene in Lac4-2 / lac17 double mutant Arabidopsis. WT represents wild-type Arabidopsis plants; pAtLAC17:MsLAC5 represents Lac4-2 / lac17 double mutant Arabidopsis plants with MsLAC5 complementation; pAtLAC17:Dummy represents Lac4-2 / lac17 double mutant Arabidopsis plants with Dummy complementation;

[0018] Figure 3 Phenotype of MsLAC5 transgenic plants; Col-0 represents wild-type Arabidopsis plants, pro35S:MsLAC5 represents MsLAC5-positive transgenic plants, and pro35S:Dummy represents Dummy control plants;

[0019] Figure 4 MsLAC5 complements the phenotype of the Lac4-2 / lac17 double mutant Arabidopsis plants; Col-0 represents wild-type Arabidopsis plants, Lac4-2 / lac17 represents Lac4-2 / lac17 double mutant Arabidopsis plants, pAtLAC17:MsLAC5 represents MsLAC5 complemented Lac4-2 / lac17 double mutant Arabidopsis plants, and pAtLAC17:Dummy represents Dummy complemented Lac4-2 / lac17 double mutant Arabidopsis plants;

[0020] Figure 5 Determination of lignin content in MsLAC5 transgenic plants; The yields of H, G and S lignin monomers in the extract samples were expressed in μmol / g, Col-0 represents wild-type Arabidopsis plants, pro35S:MsLAC5 represents MsLAC5-positive transgenic plants, and pro35S:Dummy represents Dummy control plants;

[0021] Figure 6 Determination of lignin content in Arabidopsis plants complemented with MsLAC5 Lac4-2 / lac17 double mutant. a. Cross section of Arabidopsis stem stained with phloroglucinol; Scale bar: 100 μm, b. Determination of lignin content in mature stems of different Arabidopsis plants; c. Determination of lignin monomer content in different Arabidopsis plants, the yield of H, G and S lignin monomers in the extract samples is expressed in μmol / g, Col-0 represents wild-type Arabidopsis plants, Lac4-2 / lac17 represents Lac4-2 / lac17 double mutant Arabidopsis plants, pAtLAC17:MsLAC5 represents Lac4-2 / lac17 double mutant Arabidopsis plants complemented with MsLAC5, and pAtLAC17:Dummy represents Lac4-2 / lac17 double mutant Arabidopsis plants complemented with Dummy;

[0022] Figure 7 Determination of biomass oil yield by aquathermolysis of MsLAC5 transgenic Arabidopsis plants; Col-0 represents wild-type Arabidopsis plants, and p35S:MsLAC5 represents MsLAC5-positive transgenic plants. DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with specific examples and drawings. Unless otherwise specified, the materials, reagents and molecular marker probes used in the following examples can all be purchased from the company through commercial channels.

[0024] Example 1: Cloning of MsLAC5 gene

[0025] According to the Miscanthus sinensis genome information (Miscanthus sinensis v7.1) published on the Phytozome (https: / / phytozome.jgi.doe.gov) website (accession number Misin14G017400.1), primers MsLAC5-F and MsLAC5-R were designed on both sides of the full-length sequence of MsLAC5, and PCR amplification was performed using the above primers using the Miscanthus sinensis cDNA as a template.

[0026] The primer sequences are as follows:

[0027] MsLAC5-F: AACAGGTCTCAggctCAATGGCGAGGTCAGGTCTC (SEQ ID NO.3),

[0028] MsLAC5-R: AACAGGTCTCTctgaCAGCACCGCAGATGGGCAA (SEQ ID NO.4);

[0029] The PCR reaction system is: 2μL cDNA, 25μL 2×Buffer, 4μL 10pM dNTP, 2μL each of 10μM forward / reverse primers, 0.5μL 5U / μL PrimerSTAR HSDNA polymerase and 14.5μL ddH2O. Add the sample on ice and mix well. The PCR reaction conditions are: 98℃ 3min; 98℃ 5sec, 56℃ 15sec; 72℃ 30sec, 35 cycles; 72℃ 5min.

[0030] The PCR amplification product was gel-recovered (using a Promega gel recovery kit) and conventionally sequenced (Beijing Liuhe BGI Gene Technology Co., Ltd.). The sequencing results showed that the amplified sequence contained a complete open reading frame with a total length of 1740 bases, as shown in SEQ ID NO.1, and the encoded protein contained 579 amino acid residues, and the sequence was shown in SEQ ID NO.2.

[0031] Example 2: Recombinant vector construction

[0032] 1) Use Eco31I FD (Thermo Scientific) endonuclease to digest the sequence fragments obtained above, and separate the 35S promoter empty vector and the AtLAC17 promoter empty vector; 2) Purify the digestion products; 3) Use T4-DNA ligase (NEB) to connect the target gene with the 35S promoter empty vector and the AtLAC17 promoter empty vector respectively; 4) Take 3 μl of the mixture for transformation.

[0033] Reaction program system: 1) Add 1 μl of the target vector and 1.5 μl of the gene fragment into a PCR tube; 2) Add 2 μl FastDigest buffer, 1.5 μl 10 mM ATP, 1 μl T4 DNA ligase (NEB) and 1 μl Eco31I FD (ThermoScientific); 3) Place the reaction system in a PCR instrument, and the reaction program is as follows: 37°C 2 min, 16°C 2 min, 50 cycles; 50°C 5 min, 80°C 5 min;

[0034] 4) Take 5 μl of the mixture for transformation. After sequencing is correct, the recombinant vector construction is completed ( Figure 1 ).

[0035] Example 3: Obtaining transgenic Arabidopsis plants overexpressing MsLAC2

[0036] The pro35S:MsLAC5 was transformed into Arabidopsis thaliana by the floral dip method (Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998 Dec; 16(6):735-43). 、 The pAtLAC17:MsLAC5 recombinant plasmid was introduced into wild-type and Lac4-2 / lac17 double mutant Arabidopsis plants to obtain resistant seedlings. The upstream and downstream primers (bar-F+bar-R) of the vector bar gene were used to detect the hygromycin gene, and finally the positive transgenic strains were determined.

[0037] Example 4: Molecular identification of transgenic plants

[0038] Take the tender leaf tissue of the transgenic positive plant identified above, extract total RNA with TriZol Reagent kit (Invitrogen, catalog number 15596026), detect the content and purity of total RNA by agarose gel electrophoresis and nucleic acid analyzer (NanoDrop), take 1.0 μg of total RNA for reverse transcription reaction, and use reverse transcriptase (Promega, catalog number M1701) to reverse into cDNA. The reverse transcription reaction steps refer to the instructions for use. Use the above cDNA as a template, use primers MsLAC5-qRT-F and MsLAC5-qRT-R for fluorescence quantitative PCR detection, and the internal reference gene is PDF2 gene. The primer sequences are as follows:

[0039] PDF2-F:TAACGTGGCCAAAATGATGC (SEQ ID NO.5),

[0040] PPDF2-R: GTTCTCCACAACCGCTTGGT (SEQ ID NO.6),

[0041] MsLAC5-qRT-F: ACCACCACCACGGCCATCTT (SEQ ID NO.7),

[0042] MsLAC5-qRT-R: CCGACGGTGAAGAAGAGGCTCT (SEQ ID NO. 8).

[0043] The real-time fluorescence quantitative PCR reaction system was 20 μL, including 1 μL of each forward / reverse primer, 2 μL of cDNA template, 10 μL of SYBRGreen qRT MasterMix (purchased from Bao Biotechnology Co., Ltd.), and ddH2O to 20 μL. The real-time fluorescence quantitative PCR instrument used Roche480 and a two-step reaction was used. The test results showed that compared with the wild type, the expression level of MsLAC5 in the transgenic plant MsLAC5_OE was significantly increased ( Figure 2 ).

[0044] Example 5: Analysis of total lignin and monomer content in transgenic plants

[0045] The phenotypic observation and lignin content of the plants were performed after 2 months of growth. Compared with the wild-type and pro35S:Dummy Arabidopsis plants, the growth of pro35S:MsLAC5 plants under constant light conditions was normal, with no significant difference from the wild-type control ( Figure 3 In addition, pAtLAC17:MsLAC5 could not complement the semi-dwarf phenotype of the Lac4-2 / lac17 double mutant Arabidopsis under constant light conditions ( Figure 4 ). The results of lignin content determination showed that compared with wild-type and pro35S:Dummy Arabidopsis plants, the total amount of lignin in p35S:MsLAC5 plants did not change significantly, while the content of H-type lignin monomers increased ( Figure 5 ). For the pAtLAC17:MsLAC5 complementation experimental group, phloroglucinol staining of stem sections showed that when pAtLAC17::MsLAC5 was overexpressed, the irregular xylem phenotype of the lac4-2 / lac17 double mutant Arabidopsis inflorescence stems was complemented ( Figure 6 a). In addition, we performed quantitative lignin analysis in stems of the lac4-2 / lac17 double mutant, the pAtLAC17:MsLAC5 line, and wild-type Arabidopsis control plants ( Figure 6b). As mentioned above, the lac4-2 / lac17 double mutant has a lower lignin content compared to wild-type plants (Berthet et al., 2011). Under the conditions of this experiment, the total lignin (KL) content of wild-type Col-0 plants was 18.3%, of which the acid-soluble lignin (ASL) content was 3.4% and the insoluble lignin (IL) content was 14.9%. In the lac4-2lac17 double mutant, the IL content dropped to about 9%, while there was no significant difference in ASL content. In contrast, the level of pAtLAC17:Dummy negative control plants was similar to that of the lac4-2 lac17 double mutant, containing only ~12% lignin. Plants overexpressing pAtLAC17:MsLAC5 were able to complement the lac4-2 lac17 double mutant plants to a certain extent, restoring the insoluble lignin content to the level of wild-type plants.

[0046] Example 6: Determination of the oil yield of biomass from hydrothermal cracking of transgenic Arabidopsis

[0047] The biomass sample was dried and crushed to make biomass powder with a particle size of no more than 80 mesh. The same weight of biomass powder from the control group (wild-type Col-0 plant) and the overexpression group (p35S:MsLAC5 plant) was taken, and an acidifier (such as hydrochloric acid solution) was added to acidify to pH ≤ 2 to prevent the hydrolysis of oil in the sample. The biomass sample was placed in a hydrothermal reactor and cracked at a temperature range of 250°C to 550°C. The liquid product after cracking usually contains water and tar. The water and part of the light oil are transferred to a centrifuge tube, and n-hexane is added to separate the light oil from the water by ultrasound and centrifugation. The tar is dissolved in tetrahydrofuran and transferred to a rotary evaporator. The solvent is recovered by a rotary evaporator to obtain light oil and heavy oil. The yield of the separated biomass oil is calculated by weighing the mass of the separated biomass oil. Based on this, it is calculated that the hydrothermal cracking biomass oil yield of the transgenic plant is about 45% higher than that of the wild-type plant ( Figure 7 ), which proves that the content of H lignin monomers determines the yield of biomass oil energy.

[0048] Nucleotide sequence of MsLAC5 gene (SEQ ID NO.1):

[0049]

[0050] The amino acid sequence of the protein encoded by the MsLAC5 gene (SEQ ID NO.2):

[0051] .

[0052] The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention will not be limited to the embodiments shown herein, but will conform to the broadest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of MsLAC5 in changing the ratio of plant cellulose monomers is characterized in that: The application is to increase the proportion of H-type lignin monomers in the total cellulose in the plant by overexpressing the MsLAC5 gene, or to inhibit the expression of the MsLAC5 gene to reduce the proportion of H-type lignin monomers in the total cellulose in the plant. The nucleotide sequence of the MsLAC5 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.

2.

2. An application of MsLAC5 gene in improving plant biomass oil yield, characterized in that: The nucleotide sequence of the MsLAC5 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.

2. The application is to increase the yield of biomass oil prepared by plant hydrothermal cracking by overexpressing the MsLAC5 gene in plants and increasing the proportion of H lignin monomer in total cellulose in the plants.

3. Application of the recombinant vector pro35S:MsLAC5 in improving the oil yield of plant biomass, characterized in that: The application is to use the recombinant vector pro35S:MsLAC5 to overexpress the MsLAC5 gene in Miscanthus sinensis, thereby increasing the proportion of H lignin monomers in the total cellulose in the plant, thereby increasing the yield of biomass oil prepared by plant hydrothermal cracking.

Images