Primer combination for detecting multiple gene mutation types, library construction method and application thereof

Abstract

The invention discloses a primer combination for detecting various gene mutation types, a library construction method and application thereof. A specific primer combination system is designed and can be effectively applied to construction of detection libraries of various gene mutation types, and random primers, template replacement primers and random primers carrying universal sequences are utilized; fixed sequences are respectively added at the 3'end and the 5 'end of the cDNA subjected to reverse transcription, so that a target fragment is amplified by a 3' / 5 'gene specific primer and a universal primer, fusion forms of the 5'end and the 3' end of a target gene can be detected at the same time, two types of fusion are amplified separately, mutual interference is reduced, and the accuracy and sensitivity of detection are improved; a DNA target fragment is amplified through a DNA specific primer pair and a universal primer, so that rapid and comprehensive detection of various types of variation in a target fusion gene and DNA can be realized, the operation is simple, the cost is low, and the audience range is wide.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and relates to a primer combination for detecting multiple gene mutation types, a method for constructing a detection library and applications thereof. Background Art

[0002] Fusion gene is a type of gene mutation, which refers to the fusion of all or part of the sequences of two genes into a new gene at the DNA or RNA level. It may be the result of chromosomal translocation, interstitial deletion or chromosomal inversion. In most cases, fusion genes can lead to the production of proteins with abnormal sequences or functions, or the dysregulation of certain gene expressions, thereby causing or promoting the occurrence of tumors. Since the discovery of the Philadelphia chromosome in 1973, with the development of detection technology, especially sequencing technology, scientists have successively discovered the existence of a large number of fusion genes in blood tumors such as leukemia and solid tumors such as lung cancer, prostate cancer, breast cancer, ovarian cancer, Ewing sarcoma, and synovial sarcoma. The results of the study show that fusion genes, as tumor driver genes, are of great significance in the diagnosis, prognosis, stratification, treatment and drug development of tumors. Therefore, the accurate detection of fusion genes is an important basis for targeted tumor therapy, and is also of great significance for drug development and precision medicine.

[0003] Currently, the methods for detecting fusion gene mutations mainly include reverse transcription polymerase chain reaction (RT-PCR), immunohistochemistry (IHC), and fluorescence in situ hybridization (FISH). Although these methods are low-cost, they are complex to operate, time-consuming, and can only detect known fusions, which has great limitations.

[0004] High-throughput sequencing (NGS) is one of the main means of detecting unknown fusion genes. It can detect multiple fusion variations of multiple genes at one time, and can detect known and unknown fusions at the same time, as well as point mutations, insertions / deletions, microsatellite instability, copy number variations, etc. However, most of the current library construction methods for detecting unknown fusion genes are time-consuming, difficult to operate, and costly, and need to be further improved.

[0005] Template switch oligo (TSO) is an oligonucleotide that hybridizes with the non-template base added to the 3' end of cDNA after reverse transcription by reverse transcriptase during the reverse transcription process, and then extends its reverse complementary sequence at the 3' end of cDNA through the action of reverse transcriptase. This fixed sequence can be used as a primer anchoring site for downstream cDNA amplification. Existing literature has proposed using TSO technology to add a universal sequence to the 3' end of the reverse transcription product, so as to achieve amplification and sequencing of the corresponding fusion gene of the target gene (i.e., driver gene). The amplicon method detects unknown fusions, such as CN115074422A discloses a method for detecting unknown fusion genes, which is difficult to cover completely and can only detect the unknown fusion of the 3' end driver gene, but cannot detect the fusion of the 5' end driver gene. Since TSO technology can only add a universal sequence to the 3' end of cDNA, the current library construction method for detecting unknown fusion genes using TSO technology can only detect the unknown fusion form of the 3' end driver gene on the RNA sequence, but cannot simultaneously detect the fusion of the 5' end driver gene of the target gene. Summary of the invention

[0006] In view of the deficiencies of the prior art and actual needs, the present invention develops a novel method for constructing an unknown fusion gene detection library, which can realize the simultaneous amplification and sequencing of multiple target genes where gene fusion occurs at different ends, which is of great significance.

[0007] The present invention provides a primer combination for constructing a detection library for various gene mutation types, a method for constructing a detection library and its application, so as to achieve rapid and comprehensive detection of target fusion genes and various gene mutation types, avoid the generation of by-products, greatly improve the sensitivity and accuracy of detection, and have simple operation and low cost.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] In a first aspect, the present invention provides a primer combination for constructing a library for detecting multiple gene mutation types, characterized in that the primer combination comprises:

[0010] a first random primer, a template displacement primer, a second random primer, a gene-specific primer, a universal primer, and a sequencing adapter primer pair;

[0011] The first random primer includes a first random sequence; the second random primer includes a universal sequence and a second random sequence in sequence from the 5' to the 3' end; the template displacement primer includes the universal sequence; the gene-specific primer includes a linker sequence and a GSP primer in sequence from the 5' to the 3' end, and the GSP primer is reverse complementary to or identical to the driver gene RNA sequence of the gene to be detected;

[0012] The universal primer includes the universal sequence; one primer in the sequencing adapter primer pair contains a sequence at the 3' end that is identical to part or all of the adapter sequence in the gene-specific primer, and the other primer in the sequencing adapter primer pair contains a sequence at the 3' end that is identical to part or all of the universal primer.

[0013] Preferably, the gene-specific primers include a 5' gene-specific primer and a 3' gene-specific primer.

[0014] Preferably, the gene-specific primers comprise a DNA-specific amplification primer pair; the DNA-specific amplification primer pair comprises a DNA forward-specific amplification primer and a DNA reverse-specific amplification primer.

[0015] Preferably, the DNA forward specific amplification primer and the DNA reverse specific amplification primer in the DNA specific amplification primer pair both include a linker sequence and a GSP primer sequence from the 5' end to the 3' end.

[0016] Preferably, the linker sequence of the DNA forward specific amplification primer is different from the linker sequence of the DNA reverse specific amplification primer, and the linker sequence of the DNA forward specific amplification primer or the linker sequence of the DNA reverse specific amplification primer is the same as the sequence of the universal primer.

[0017] Preferably, the universal primers include two universal primers with different sequences, the linker sequence of the DNA forward specific amplification primer is the same as the sequence of one universal primer; the linker sequence of the DNA reverse specific amplification primer is the same as the sequence of another universal primer; the GSP primer sequence of the DNA forward specific amplification primer is reverse complementary to the DNA template chain sequence, and the GSP primer sequence of the DNA reverse specific amplification primer is the same as the DNA template chain.

[0018] Preferably, the universal sequence is located at the 5' end of the template displacement primer, so as to connect the reverse complementary sequence of the universal sequence to the 3' end of the template displacement reverse transcription product cDNA of the RNA sequence of the gene to be detected after reverse transcription and template displacement of the RNA sequence of the gene to be detected.

[0019] Preferably, the universal sequence is located at the 5' end of the second random primer, and is used for connecting the universal sequence to the 5' end of the cDNA of the reverse transcription product of the RNA sequence of the gene to be detected after reverse transcription of the RNA sequence of the gene to be detected.

[0020] Preferably, the sequence identical to at least a portion of the adapter sequence in the gene-specific primer contained at the 3' end of one primer in the sequencing adapter primer pair is located at the 5' end of the gene-specific primer. Preferably, the sequence identical to at least a portion of the universal primer contained at the 3' end of the other primer in the sequencing adapter primer pair is located at the 5' end of the universal primer.

[0021] Preferably, the gene-specific primers include a 3' gene-specific primer and / or a 5' gene-specific primer, wherein the 3' gene-specific primer includes a linker sequence and a 3'GSP primer in sequence from the 5' to the 3' end, and the 3'GSP primer is reverse complementary to the 3' driver gene RNA sequence of the gene to be detected; the 5' gene-specific primer includes a linker sequence and a 5'GSP primer of the gene to be detected in sequence from the 5' to the 3' end, and the 5'GSP primer sequence is the same as the 5' driver gene RNA sequence.

[0022] In the present invention, a specific primer combination system is designed, which can be effectively applied to construct a detection library for various gene mutation types, and fixed sequences are added to the 3' end and 5' end of the reverse transcribed cDNA by using random primers, template replacement primers and random primers with universal sequences, respectively, so that the target fragments can be amplified by 3' / 5' gene-specific primers and universal primers, and the fusion forms of the 3' and 5' ends of the target gene can be detected simultaneously, the generation of by-products can be avoided, and the target fusion gene can be quickly, comprehensively and accurately detected.

[0023] Preferably, the length of the sequence of the first random primer and the sequence of the second random primer are each independently 6 to 70 nt, including but not limited to 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 66 nt, 67 nt, 68 nt, 69 nt or 70 nt.

[0024] Preferably, the first random sequence is an N6 random sequence; and the second random sequence is an N6 random sequence.

[0025] Preferably, the length of the universal sequence is 20 to 35 nt, including but not limited to 20 nt, 21 nt, 22 nt, 25 nt, 26 nt, 28 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt or 35 nt.

[0026] In some embodiments, the common sequence is TTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO. 23).

[0027] In some embodiments, the common sequence is GGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO. 24).

[0028] Preferably, the length of the sequence at the 3' end of one primer in the sequencing adapter primer pair that is identical to a part or all of the adapter sequence in the gene-specific primer is about 20 nt (e.g., 20-21 nt), preferably about 20 nt (e.g., 20-21 nt) from the 5' end of the adapter sequence in the gene-specific primer.

[0029] Preferably, the length of the sequence at the 3' end of the other primer in the sequencing adapter primer pair that is identical to part or all of the universal primer is about 20 nt (e.g., 20-21 nt), preferably about 20 nt (e.g., 20-21 nt) from the 5' end of the universal primer.

[0030] Preferably, the other primer in the sequencing adapter primer pair contains a sequence identical to at least a portion of the universal primer at the 3' end, and the sequence at the 5' end of the identical sequence that is different from the universal sequence of the template displacement primer is the second adapter sequence.

[0031] Preferably, the length of the second linker sequence is 0-7 nt, including but not limited to 0 nt, 1 nt, 2 nt, 3nt, 4 nt, 5 nt, 6 nt, and 7 nt.

[0032] Preferably, the second linker sequence is ACACTCT (SEQ ID NO. 19).

[0033] Preferably, the second linker sequence is GTGACT (SEQ ID NO. 21).

[0034] Preferably, the two primers in the sequencing adapter primer pair are a P5 sequencing adapter primer and a P7 sequencing adapter primer, respectively, the P5 sequencing adapter primer comprises a sequence identical to part or all of the universal primer at its 3' end, and the P7 sequencing adapter primer comprises a sequence identical to part or all of the adapter sequence in the gene-specific primer at its 3' end.

[0035] Preferably, part or all of the adapter sequence of the DNA forward specific amplification primer is identical to the sequence at the 3' end of the P5 sequencing adapter primer; part or all of the adapter sequence of the DNA reverse specific amplification primer is identical to the sequence at the 3' end of the P7 sequencing adapter primer.

[0036] Preferably, the 3' end of the P5 sequencing adapter primer contains a sequence identical to part or all of the adapter sequence of the DNA forward specific amplification primer; the 3' end of the P7 sequencing adapter primer contains a sequence identical to part or all of the adapter sequence of the DNA reverse specific amplification primer.

[0037] Preferably, the nucleic acid sequence of the template replacement primer includes the sequence shown in SEQ ID NO.1, and rG is the ribonucleic acid G base.

[0038] Preferably, the nucleic acid sequence of the second random primer includes the sequence shown in SEQ ID NO.2.

[0039] Preferably, the nucleic acid sequence of the linker sequence includes the sequence shown in SEQ ID NO.3.

[0040] Preferably, the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.4.

[0041] Preferably, the nucleic acid sequence of the sequencing adapter primer includes the sequence shown in SEQ ID NO.5 or SEQ ID NO.6.

[0042] Preferably, the nucleic acid sequence of the other universal primer includes the sequence shown in SEQ ID NO.3.

[0043] SEQ ID NO. 1: TTCCTACACGACGCTCTCCGATCTrGrGrG.

[0044] SEQ ID NO. 2: TTCCTACACGACGCTCTCCGATCTNNNNNN.

[0045] SEQ ID NO. 3: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT.

[0046] SEQ ID NO. 4: ACACTCTTTCCCTACACGACCGCTTCCGATCT.

[0047] SEQ ID NO.5:

[0048] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGAC.

[0049] SEQ ID NO.6:

[0050] CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGT.

[0051] Preferably, the nucleic acid sequence of the template replacement primer includes the sequence shown in SEQ ID NO. 20, and rG is the ribonucleic acid G base.

[0052] Preferably, the nucleic acid sequence of the second random primer includes the sequence shown in SEQ ID NO.7.

[0053] Preferably, the nucleic acid sequence of the linker sequence includes the sequence shown in SEQ ID NO.4.

[0054] Preferably, the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.3.

[0055] Preferably, the nucleic acid sequence of the sequencing adapter primer includes the sequence shown in SEQ ID NO.5 or SEQ ID NO.6.

[0056] Preferably, the nucleic acid sequence of the other universal primer includes the sequence shown in SEQ ID NO.4.

[0057] Preferably, the gene to be detected is selected from: FGFR2, FGFR3, ALK, BRAF, NTRK1, NTRK3, RET, ROS1 or MET. Preferably, a 5'GSP primer comprising the following nucleic acid sequence can be used: ACCTGGACCGTGTCCTTArCCGTGA (SEQ ID NO.9); and a 3'GSP primer comprising the following nucleic acid sequence can be used: TCATGATGGTCGAGGTGCrGGAGCT (SEQ ID NO.10), ATGATCTTCATCTGCTGGTCGrGAAGGG (SEQ ID NO.11), TCCACATTTGTTGAGCACAArGGAGCA (SEQ ID NO.12), CACCGGGTCTCCAGATGrUGCTGT (SEQ ID NO.13), GTCTCTCCTCTTAATGTGCTrGCACAA (SEQ ID NO.14), CCAAGAACCAAGTTCTTCCGAGrGGAATA (SEQ ID NO.15), AAGGAGAAGAGGACAGCGrGCTGCG (SEQ ID NO.16), TGTAACAACCAGAAATATTCCAACTATrAATAGT (SEQ ID NO.17). NO.17) or TAGTTAGGATGGGGGACATGrUCTGTC (SEQ ID NO.18).

[0058] In a second aspect, the present invention provides the use of the primer combination for constructing a library for detecting multiple gene mutation types as described in the first aspect in constructing a library for detecting multiple gene mutation types.

[0059] Preferably, the present invention provides the use of the primer combination for constructing a detection library for multiple gene mutation types described in the first aspect in the preparation of a product for constructing a detection library for simultaneously detecting multiple gene mutation types.

[0060] In a third aspect, the present invention provides a method for constructing a library for detecting multiple gene mutation types, the method using the primer combination for constructing a library for detecting multiple gene mutation types described in the first aspect, comprising the following steps:

[0061] (1) Sample RNA is divided into two parts as templates, one part is subjected to a template displacement reverse transcription reaction using a first random primer and a template displacement primer to obtain a template displacement reverse transcription product; the other part is subjected to a reverse transcription reaction using a second random primer to obtain a reverse transcription product;

[0062] (2) using the template-displaced reverse transcription product and the reverse transcription product as a template, using gene-specific primers and universal primers, to perform a first amplification reaction to obtain a product of the first amplification reaction;

[0063] (3) Using sequencing adapter primers to perform a second amplification reaction on the product of the first amplification reaction, and using the obtained amplification reaction product to construct the multiple gene mutation type detection library.

[0064] Preferably, step (1) or step (2) does not include the step of mixing the template-converting reverse transcription product with the reverse transcription product; in step (2), the template-displacement reverse transcription product and the reverse transcription product are subjected to a first amplification reaction using gene-specific primers and universal primers, respectively, to obtain a product of a first amplification reaction of the template-displacement reaction and a product of a first amplification reaction of the reverse transcription reaction, respectively; in step (3), the product of the first amplification reaction of the template-displacement reaction and the product of the first amplification reaction of the reverse transcription reaction are mixed to obtain a mixed product of the first amplification reaction, and a second amplification reaction is performed on the mixed product of the first amplification reaction using a sequencing adapter primer.

[0065] Preferably, step (2) further comprises using the sample DNA as a template, using a DNA-specific amplification primer pair and a universal primer to perform a first amplification reaction to obtain a product of the first amplification reaction; wherein the primer combination further comprises a DNA-specific amplification primer pair; the two primers in the DNA-specific amplification primer pair are a DNA forward-specific amplification primer and a DNA reverse-specific amplification primer, respectively.

[0066] Preferably, the DNA forward specific amplification primer and the DNA reverse specific amplification primer in the DNA specific amplification primer pair both include a linker sequence and a GSP primer sequence, the linker sequence of the DNA forward specific amplification primer is identical to the sequence of the universal primer; the linker sequence of the DNA reverse specific amplification primer is identical to the sequence of another universal primer; the GSP primer sequence of the DNA forward specific amplification primer is reverse complementary to the DNA template chain sequence, and the GSP primer sequence of the DNA reverse specific amplification primer is identical to the DNA template chain.

[0067] Preferably, step (1) further comprises the step of purifying the template replacement reverse transcription product and the reverse transcription product.

[0068] Preferably, step (2) further comprises the step of purifying the product of the first amplification reaction.

[0069] Preferably, step (3) also includes the step of purifying the product of the second amplification reaction.

[0070] In a fourth aspect, the present invention provides a method for detecting multiple types of gene mutations. Preferably, a method for simultaneously detecting multiple types of gene mutations is provided, the method comprising constructing a library using the method for constructing a library for detecting multiple types of gene mutations described in the third aspect, and sequencing and analyzing the library.

[0071] In a fifth aspect, the present invention provides the use of a product comprising the primers or primer combinations defined in the first aspect in constructing a library for detecting multiple gene mutation types or for detecting multiple gene mutation types, wherein the product optionally comprises reverse transcriptase, dNTP, DNA polymerase and reaction buffer. Preferably, the application is for the method described in the third aspect.

[0072] Preferably, the present invention provides the use of the primers or primer combination products defined in the first aspect in constructing a detection library for simultaneously detecting multiple gene mutation types or simultaneously detecting multiple gene mutation types, wherein the product optionally includes reverse transcriptase, dNTP, DNA polymerase and reaction buffer. Preferably, the application is used in the method described in the third aspect.

[0073] In the present invention, a method for rapidly and comprehensively detecting target fusion genes and various types of gene mutations is designed, which has broad application prospects, such as the study of the basic behavior of fusion genes for non-disease diagnosis or treatment purposes, etc.

[0074] In the present invention, the P5 sequencing adapter primer and the P5 universal primer can be used interchangeably; the P7 sequencing adapter primer and the P7 universal primer can be used interchangeably.

[0075] the term

[0076] The full name of Variant Allele Frequency (Variant Allele Frequency) or Variant Allele Fraction (Variant Allele Fraction).

[0077] ddPCR (Droplet Digital PCR) is a droplet digital PCR that provides an ultra-high-similarity nucleic acid detection and absolute quantification method.

[0078] The various types of gene mutations include, but are not limited to, point mutations, short fragment insertion / deletion, fusion mutations, microsatellite instability or copy number variation.

[0079] Compared with the prior art, the present invention has the following beneficial effects:

[0080] The unknown fusion gene detection method based on TSO technology developed by the present invention uses random primers with universal sequences and random primers and template replacement primers to add universal sequences at both ends of the cDNA sequence, which can realize the detection of the fusion situation on both sides of the target gene; it can realize the amplification and sequencing of multiple target genes with gene fusion occurring on different ends at the same time, and the detection results are more comprehensive. The present invention can detect the unknown fusion of the 3' driver gene in the RNA template and the unknown fusion of the 5' driver gene by the amplicon method, and amplify the two types of fusion separately, reducing the mutual interference between the two, avoiding the generation of by-products, and greatly improving the accuracy and sensitivity of the detection; it can also detect multiple types of gene mutations such as point mutations, insertions / deletions and microsatellite instability in DNA templates. The method is simple to operate, low cost, and has a wide audience, which is more conducive to the popularization and application of tumor patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] Figure 1 Schematic diagram of RNA template amplification.

[0082] Figure 2 Schematic diagram of DNA template amplification.

[0083] Figure 3 Figure 1 is a flowchart of library construction, where A is the flowchart of RNA library construction and B is the flowchart of DNA & RNA co-construction library. DETAILED DESCRIPTION

[0084] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0085] If no specific technology or conditions are specified in the examples, the technology or conditions described in the literature in the field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels. In addition, "reverse transcription" in the claims, description and examples of the present invention is synonymous with "reverse transcription".

[0086] The present invention develops a method for constructing a detection library of unknown fusion genes and various other gene mutation types based on template switch oligo. The technical principle is: A cDNA library with a fixed sequence at the 3' end is generated by reverse transcription reaction using random primers and template displacement primers, and a cDNA library with a fixed sequence at the 5' end is generated by reverse transcription reaction using random primers with universal sequences; Gene-specific primers (GSP) are designed according to the position of the target gene on the RNA sequence; if the fusion of the 3' end of the target gene on the RNA sequence is detected, the GSP should carry the reverse complementary sequence of the 3' end region of the target gene on the RNA sequence. If the fusion of the 5' end of the target gene on the RNA sequence is detected, the GSP should carry the same sequence as the 5' end region of the target gene on the RNA sequence. After effective amplification with gene-specific primers, unknown fusion events of the target gene can be detected.

[0087] Example 1

[0088] This example designs primers used in constructing a library for detecting multiple gene mutation types.

[0089] The primer sequences are shown in Table 1.

[0090] Table 1 Primers required for the construction of detection libraries for various gene mutation types

[0091]

[0092] Where N is a random base, A, G, C or T; rG is the RNA G base. The primer sequences were synthesized by IntegratedDNA Technologies (USA) (IDT). The product was delivered in the form of dry powder, and IDTE buffer (IDT) was added according to the volume recommended by the manufacturer, and the quality control was performed using a NanoDrop spectrophotometer (Thermo Fisher).

[0093] The technical principle of the above primer system is as follows Figure 1 and Figure 2 As shown, Driver refers to the driver gene, Partner refers to the partner gene, and fusion genes include many types. The fusion of a proto-oncogene with another gene (called the "partner gene") leads to the occurrence and progression of cancer.

[0094] ① Reverse transcription step: RNA is divided into two tubes. One tube is reverse transcribed to the 5' end of RNA using random primers, and then non-template bases are added. Finally, a DNA-dependent DNA polymerase reaction is carried out under the guidance of template displacement primers to synthesize a cDNA library with a fixed sequence at the 3' end. The other tube is reverse transcribed using random primers with universal sequence 1 to generate a cDNA library with a fixed sequence at the 5' end. The two cDNA libraries are purified separately and not mixed.

[0095] ② First round of PCR (PCR1): Design gene-specific primers according to the position of the target gene on the RNA sequence. If the 3'-driven gene fusion is detected, the target fragment is amplified by the 3'-gene-specific primer and universal primer 1. If the 5'-driven gene fusion is detected, the target fragment is amplified by the 5'-gene-specific primer and universal primer 1. According to the position of the target gene on the DNA sequence, design a DNA-specific primer pair (including a DNA forward-specific amplification primer and a DNA reverse-specific amplification primer), amplify the target fragment by the DNA-specific amplification primer pair and universal primer 1, and purify the product. Perform PCR1 amplification on the two cDNA libraries respectively. In addition, the 3' gene-specific primer and the 5' gene-specific primer may have the same adapter primer sequence or different adapter primer sequences; the embodiment of the present invention selects the 3' gene-specific primer and the 5' gene-specific primer to have the same adapter primer sequence, and part or all of the adapter primer sequence is the same as the 3' end sequence of the P7 universal primer (sequencing adapter primer); the universal sequence in the template replacement primer has the same universal sequence as universal primer 1 and random primer 1, and the sequence of the P5 universal primer (sequencing adapter primer) is partially identical to the above universal sequence at the 3' end.

[0096] If the 3' gene-specific primer and the 5' gene-specific primer carry different adapter primer sequences (e.g., the 3' gene-specific primer and the 5' gene-specific primer-2), the template-displacing primer and the universal primer sequence in the random primer with a universal sequence must also be different, the 3' gene-specific primer and the universal primer sequence in the template-displacing primer should always remain different, the 5' gene-specific primer and the universal primer sequence in the random primer with a universal sequence should also always remain different, and universal primer 1 and universal primer 2 need to be added to the PCR1 reaction system at the same time.

[0097] The 3' gene-specific primer includes a linker sequence and a 3'GSP primer from the 5' to the 3' end, and the 3'GSP primer is reverse complementary to the 3' driver gene RNA sequence of the gene to be detected; the 5' gene-specific primer includes a linker sequence and a 5'GSP primer of the gene to be detected from the 5' to the 3' end, and the 5'GSP primer sequence is the same as the 5' driver gene RNA sequence.

[0098] The DNA specific amplification primers corresponding to point mutation, insertion / deletion and MSI detection include a linker sequence and a GSP primer sequence from the 5' to the 3' end, and the DNA specific amplification primer pair includes a DNA forward specific amplification primer and a DNA reverse specific amplification primer. The GSP primer sequence of the DNA forward specific amplification primer is reversely complementary to the DNA template chain sequence, and the GSP primer sequence of the DNA reverse specific amplification primer is the same as the DNA template chain. The linker sequences in the DNA forward specific amplification primer and the DNA reverse amplification primer are different sequences, respectively, and are different primer sequences in the sequencing linker primer pair. The linker sequence of the DNA forward specific amplification primer of the present invention is the same as the sequence of universal primer 1, and part or all of the linker sequence of the DNA forward specific amplification primer is the same as the sequence at the 3' end of the P5 universal primer (sequencing linker primer); part or all of the linker sequence of the DNA reverse specific amplification primer is the same as the sequence at the 3' end of the P7 universal primer (sequencing linker primer), and is the same as the sequence of universal primer 2. For example, the DNA forward specific amplification primer sequence for detecting EGFR_p.L858R_c.2573T>G mutation is: acactctttccctacacgacgctcttccgatctAAACACCGCAGCATGTCAArGATCAG / 3SPC3 / ; the DNA reverse specific amplification primer sequence is: gtgactggagttcagacgtgtgctcttccgatctTACAGCTAGTGGGAAGGCAGrCCTGGA / 3SPC3 / ; the lowercase sequence is the linker sequence.

[0099] ③ Second round of PCR (PCR2): Use P5 and P7 sequencing adapter primers to amplify the purified PCR1 product. After amplification, purify the library (in Figure 1 In the figure, the P5 sequencing adapter primer is shown as the P5 universal primer, and the P7 sequencing adapter primer is shown as the P5 universal primer. Figure 1 The P7 universal primer is shown in Figure ).

[0100] The random primer or the random sequence in the random primer can be a plurality of random bases, for example, 6 to 70 random bases, including but not limited to 7, 8, 9, 10, 11, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 66, 67, 68, 69 bases, etc., for reverse transcribing RNA into cDNA.

[0101] It should be noted that although Table 1 only shows that the P7 universal primer contains a sequence identical to a portion of the adapter sequence in the gene-specific primer (3' gene-specific primer or 5' gene-specific primer-1) at the 3' end, the sequence of the identical portion is located at the 5' end of the gene-specific primer, so as to achieve the purpose of amplifying the target and tailing the target using the P7 universal primer, based on this purpose, those skilled in the art can also set the sequence at the 3' end of the P7 universal primer (the sequence between the barcode and the 3' end) to be completely identical to the adapter sequence of the gene-specific primer. Although Table 1 only shows that the P5 universal primer contains a sequence identical to a portion of the universal primer at the 3' end, the identical sequence is located at the 5' end of the universal primer, so as to achieve the purpose of tailing, so as to achieve the purpose of amplifying the target and tailing the target using the P5 universal primer, based on this purpose, those skilled in the art can also set the sequence at the 3' end of the P5 sequencing adapter primer (the sequence between the barcode and the 3' end) to be completely identical to the universal sequence.

[0102] GSP primers can be designed according to the gene to be detected, and an exemplary display is shown in Table 2.

[0103] Table 2

[0104]

[0105] Example 2 Construction of RNA library for unknown fusion gene detection

[0106] This example constructs an RNA library for detecting unknown fusion genes.

[0107] 1. Preparation of experimental samples: Use nucleic acid extraction or purification reagents (Shanghai Silidi Biomedical Technology Co., Ltd.) to extract RNA from paraffin-embedded samples (FFPE) or other types of samples. For the extracted RNA, perform template switching (TSO) reaction and reverse transcription (RT) reaction according to the following procedures.

[0108] 2. Template switching (TSO) reaction: Prepare TSO reverse transcription system according to Table 3.

[0109] Table 3 TSO reverse transcription system

[0110]

[0111] Prepare the reaction system in Table 3, mix by pipetting, centrifuge briefly, incubate at 65°C for 5 min in a PCR instrument, and then incubate on ice for at least 1 min. Then add the template switching (TSO) reaction system to continue the reaction. The template switching reaction system is shown in Table 4. Perform the reaction program in a PCR instrument at 23°C for 10 min, 50-55°C for 10 min, 80°C for 10 min, and maintain at 4°C to generate template switching reverse transcription products.

[0112] Table 4 Template switching reaction system

[0113]

[0114] 3. Reverse transcription (RT) reaction: prepare the reverse transcription system according to Table 5.

[0115] Table 5 Reverse transcription system

[0116]

[0117] Prepare the reaction system in Table 5, mix by pipetting, centrifuge briefly, set the heat cover of the PCR instrument to ≥ 85°C, and perform the reaction procedure of 25°C, 10 min, 42°C, 30 min, 80°C, 20 min, and maintain at 4°C to generate reverse transcription products.

[0118] 4. Product purification:

[0119] The reverse transcription product and template-switched reverse transcription product were purified separately, and 50 μL (2.5×) AMPure Xp Beads were added to each product and mixed well; after standing at room temperature for 5 min, the supernatant was discarded on a magnetic rack; then washed twice with 200 μL 80% ethanol, dried at room temperature for 5 min, and finally eluted with 15 μL H2O. The supernatant was recovered for downstream reactions.

[0120] 5. PCR1 specific amplification: Prepare the first round of PCR (PCR1) reaction system (30uL) according to Table 6. The template switching (TSO) reaction product and the reverse transcription (RT) product were subjected to PCR1 reaction respectively. The primer sets in Tables 6-1 and 6-2 were designed by the authors of the present invention and synthesized at IDT; cDNA was the purified product of the reverse transcription product in step 4 or the purified product of the template switching reverse transcription product.

[0121] Table 6-1 PCR1 amplification reaction system

[0122]

[0123] Table 6-2 PCR1 amplification reaction system

[0124]

[0125] The first round of amplification of the target region was performed using a ProFlex PCR System PCR instrument (Applied biosystems by life technologies, model: ProFlex) according to the reaction program in Table 7.

[0126] Table 7 PCR1 amplification program

[0127]

[0128] 6. Purification of PCR1 amplification products:

[0129] Combine the products of template switching (TSO) cDNA amplified by PCR1 and reverse transcription (RT) cDNA amplified by PCR1, add Agencourt AMPure XP beads and mix well, wash with 80% ethanol (freshly prepared and used) to purify the target product.

[0130] 7. PCR2 specific amplification: Prepare the second round of PCR (PCR2) reaction system according to Table 8.

[0131] Table 8 PCR2 amplification reaction system

[0132]

[0133] Prepare the reaction system in Table 8 and perform amplification in a PCR instrument according to the reaction program in Table 9.

[0134] Table 9 PCR2 amplification program

[0135]

[0136] 8. Purification of PCR2 amplification products: Add AMPure Xp Beads to the second-round PCR product system and mix well; wash with 80% ethanol (freshly prepared and used) to purify the target product, and perform quantitative quality inspection on the purified library.

[0137] 9. Sequence the library and perform data analysis.

[0138] The database construction process is as follows Figure 3 As shown in A.

[0139] Example 3 Construction of DNA & RNA libraries for detection of multiple gene mutation types

[0140] This example constructs a DNA & RNA library for detecting multiple gene mutation types.

[0141] 1. Preparation of experimental samples: Use nucleic acid extraction or purification reagents (Shanghai Silidi Biomedical Technology Co., Ltd.) to extract DNA and RNA from paraffin-embedded samples (FFPE) or other types of samples. For the extracted RNA, perform template switching (TSO) reaction and reverse transcription (RT) reaction according to the following procedures.

[0142] 2. Template switching (TSO) reaction: Prepare TSO reverse transcription system according to Table 10.

[0143] Table 10 TSO reverse transcription system

[0144]

[0145] Prepare the reaction system in Table 10, mix by pipetting, centrifuge briefly, incubate at 65°C for 5 min in a PCR instrument, and then incubate on ice for at least 1 min. Then add the template switching (TSO) reaction system to continue the reaction. The template switching reaction system is shown in Table 11. Perform the reaction program in a PCR instrument at 23°C for 10 min, 50-55°C for 10 min, 80°C for 10 min, and maintain at 4°C to generate template switching reverse transcription products.

[0146] Table 11 Template switching reaction system

[0147]

[0148] 3. Reverse transcription (RT) reaction: prepare the reverse transcription system according to Table 12.

[0149] Table 12 Reverse transcription system

[0150]

[0151] Prepare the above system, mix by pipetting, centrifuge briefly, set the heat cover of the PCR instrument to ≥85°C, and perform the reaction procedure of 25°C, 10 min, 42°C, 30 min, 80°C, 20 min, and maintain at 4°C to generate reverse transcription products.

[0152] 4. Product purification:

[0153] The reverse transcription product and template-switched reverse transcription product were purified separately, and 50 μL (2.5×) AMPure Xp Beads were added to each product and mixed well; after standing at room temperature for 5 min, the supernatant was discarded on a magnetic rack; then washed twice with 200 μL 80% ethanol, dried at room temperature for 5 min, and finally eluted with 15 μL H2O. The supernatant was recovered for downstream reactions.

[0154] 5. PCR1 specific amplification: Prepare the first round PCR (PCR1) reaction system (30uL) according to Table 13. The template switching (TSO) reaction product and the reverse transcription (RT) product are subjected to PCR1 reaction respectively, wherein Pool_FWD and Pool_REV refer to the forward primer mixture and the reverse primer mixture respectively, the forward primer mixture includes a DNA forward specific amplification primer and a 5' gene specific primer, and the reverse primer mixture includes a DNA reverse specific amplification primer and a 3' gene specific primer; the primer set in Table 13 is designed by the author of the present invention and synthesized at IDT; cDNA is the purified product of the reverse transcription product in step 4 or the purified product of the template switching reverse transcription product, and DNA is the DNA extracted in step 1.

[0155] Table 13 PCR1 amplification reaction system

[0156]

[0157] The first round of amplification of the target region was performed using a ProFlex PCR System PCR instrument (Applied biosystems by life technologies, model: ProFlex) according to the reaction program in Table 14.

[0158] Table 14 PCR1 amplification program

[0159]

[0160] 6. Purification of PCR1 amplification products:

[0161] Combine the products of template switching (TSO) cDNA amplified by PCR1 and reverse transcription (RT) cDNA amplified by PCR1, add Agencourt AMPure XP beads and mix well, wash with 80% ethanol (freshly prepared and used) to purify the target product.

[0162] 7. PCR2 specific amplification: Prepare the second round of PCR (PCR2) reaction system according to Table 15.

[0163] Table 15 PCR2 amplification reaction system

[0164]

[0165] Prepare the above reaction system and perform amplification in a PCR instrument according to the reaction program in Table 16.

[0166] Table 16 PCR2 amplification program

[0167]

[0168] 8. Purification of PCR2 amplification products: Add AMPure Xp Beads to the second-round PCR product system and mix well; wash with 80% ethanol (freshly prepared and used) to purify the target product, and perform quantitative quality inspection on the purified library.

[0169] 9. Sequence the library and perform data analysis.

[0170] The database construction process is as follows Figure 3 As shown in B.

[0171] Test Example 1

[0172] Six fusion-positive clinical samples (FFPE RNA samples) provided by Tianjin Cancer Hospital and Beijing Cancer Hospital and three standard RNA samples of cell line mixture purchased from TACC were selected, and the detailed information is shown in Table 17. According to the method of Example 2 of the present invention (only RNA library was used for library construction), all fusion-positive samples were verified by ddPCR. As shown in Table 17, the detection results of the method of the present invention were 100% consistent with ddPCR, and all positive samples could be detected.

[0173] Therefore, the primer combination and method of the present invention can efficiently detect unknown fusions in RNA.

[0174] Table 17 Fusion detection results

[0175]

[0176] Test Example 2

[0177] 13 positive clinical samples (FFPE samples) provided by Tianjin Cancer Hospital and Beijing Cancer Hospital and 3 cell line mixed standards purchased from TACC were selected for testing according to the method of Example 2 (DNA & RNA co-construction library). All fusion-positive samples and point mutation and insertion / deletion samples were verified by ddPCR, and the results are shown in Tables 18 and 19. The detection results of the method of the present invention were 100% consistent with ddPCR, and all positive samples could be detected.

[0178] All MSI-H samples and MSS samples provided by Tianjin Cancer Hospital and Beijing Cancer Hospital were verified by PCR gold standard. The results in Table 20 show that the test results according to the method of Example 2 (DNA & RNA co-constructed library) were 100% consistent with the PCR gold standard results.

[0179] Therefore, the primer combination and method of the present invention can efficiently detect various types of variations in DNA and unknown fusions in RNA.

[0180] Table 18 Fusion detection results

[0181]

[0182] Table 19 Point mutation, insertion / deletion detection results

[0183]

[0184] Table 20 Microsatellite status detection results

[0185]

[0186] The applicant declares that the present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method for constructing a library for detecting multiple gene mutation types, characterized in that: The method utilizes a primer combination and comprises the following steps: (1) Sample RNA is divided into two parts as templates, one part is subjected to a template displacement reverse transcription reaction using a first random primer and a template displacement primer to obtain a template displacement reverse transcription product; the other part is subjected to a reverse transcription reaction using a second random primer to obtain a reverse transcription product; (2) using the template-displaced reverse transcription product and the reverse transcription product as a template, using gene-specific primers and universal primers, to perform a first amplification reaction to obtain a product of the first amplification reaction; (3) performing a second amplification reaction on the product of the first amplification reaction using a sequencing adapter primer, and using the obtained amplification reaction product to construct a detection library for the plurality of gene mutation types; The primer combination comprises: a first random primer, a template displacement primer, a second random primer, a gene-specific primer, a universal primer, and a sequencing adapter primer pair; The first random primer includes a first random sequence; the second random primer includes a universal sequence and a second random sequence in sequence from the 5' to the 3' end; the template displacement primer includes the universal sequence; the gene-specific primer includes a linker sequence and a GSP primer in sequence from the 5' to the 3' end, and the GSP primer is reverse complementary to or identical to the driver gene RNA sequence of the gene to be detected; The universal primer includes the universal sequence; one primer in the sequencing adapter primer pair contains a sequence at the 3' end that is identical to part or all of the adapter sequence in the gene-specific primer, and the other primer in the sequencing adapter primer pair contains a sequence at the 3' end that is identical to part or all of the universal primer.

2. The method according to claim 1, characterized in that The step (1) or step (2) does not include the step of mixing the template-switching reverse transcription product with the reverse transcription product; in the step (2), the template-displacement reverse transcription product and the reverse transcription product are subjected to a first amplification reaction using a gene-specific primer and a universal primer, respectively, to obtain a product of the first amplification reaction of the template-displacement reaction and a product of the first amplification reaction of the reverse transcription reaction, respectively; In step (3), the product of the first amplification reaction of the template replacement reaction and the product of the first amplification reaction of the reverse transcription reaction are mixed to obtain a mixed product of the first amplification reaction, and a second amplification reaction is performed on the mixed product of the first amplification reaction using a sequencing adapter primer.

3. The method according to claim 1 or 2, characterized in that: The step (2) further comprises using the sample DNA as a template, using a DNA-specific amplification primer pair and a universal primer, to perform a first amplification reaction to obtain a product of the first amplification reaction; The primer combination further comprises a DNA-specific amplification primer pair; the two primers in the DNA-specific amplification primer pair are a DNA forward-specific amplification primer and a DNA reverse-specific amplification primer.

4. The method according to any one of claims 1 to 3, characterized in that: The universal primers include two universal primers with different sequences, wherein the DNA forward specific amplification primer and the DNA reverse specific amplification primer in the DNA specific amplification primer pair both include a linker sequence and a GSP primer sequence, the linker sequence of the DNA forward specific amplification primer is the same as the sequence of one universal primer; the linker sequence of the DNA reverse specific amplification primer is the same as the sequence of another universal primer; the GSP primer sequence of the DNA forward specific amplification primer is reversely complementary to the DNA template chain sequence, and the GSP primer sequence of the DNA reverse specific amplification primer is the same as the DNA template chain.

5. The method according to any one of claims 1 to 4, characterized in that: The universal sequence is located at the 5' end of the template displacement primer.

6. The method according to any one of claims 1 to 4, characterized in that: The universal sequence is located at the 3' end of the universal primer.

7. The method according to any one of claims 1 to 4, characterized in that: The sequence contained at the 3' end of one primer in the sequencing adapter primer pair is identical to at least a portion of the adapter sequence in the gene-specific primer and is located at the 5' end of the gene-specific primer.

8. The method according to any one of claims 1 to 4, characterized in that: The other primer in the sequencing adapter primer pair comprises at its 3' end a sequence identical to at least a portion of the universal primer, which is located at the 5' end of the universal primer.

9. The method according to any one of claims 1 to 8, characterized in that: The lengths of the first random primer sequence and the second random primer sequence are independently 6 to 70 nt.

10. The method according to any one of claims 1 to 8, characterized in that: The length of the universal sequence is 20-35 nt, and preferably the universal sequence is as shown in SEQ ID NO.

23.

11. The method according to any one of claims 1 to 8, characterized in that: The length of the universal sequence is 20-35 nt, and preferably the universal sequence is as shown in SEQ ID NO.

24.

12. The method according to any one of claims 1 to 8, characterized in that: The gene-specific primers include 3' gene-specific primers and / or 5' gene-specific primers, wherein the 3' gene-specific primer includes a linker sequence and a 3' GSP primer in sequence from the 5' to the 3' end, and the 3' GSP primer is reverse complementary to the 3' driver gene RNA sequence of the gene to be detected; the 5' gene-specific primer includes a linker sequence and a 5' GSP primer of the gene to be detected in sequence from the 5' to the 3' end, and the 5' GSP primer sequence is the same as the 5' driver gene RNA sequence.

13. The method according to any one of claims 1 to 8, characterized in that: The other primer in the sequencing adapter primer pair contains a sequence identical to at least a portion of the universal primer at the 3' end, and the sequence at the 5' end of the identical sequence that is different from the universal sequence of the template displacement primer is the second adapter sequence. Preferably, the length of the second adapter sequence is 0-7 nt.

14. The method according to any one of claims 1 to 8, characterized in that: The two primers in the sequencing adapter primer pair are respectively a P5 sequencing adapter primer and a P7 sequencing adapter primer, wherein the P5 sequencing adapter primer comprises a sequence identical to a part or all of the universal primer at the 3' end, and the P7 sequencing adapter primer comprises a sequence identical to a part or all of the adapter sequence in the gene-specific primer at the 3' end.

15. The method according to any one of claims 1 to 8, characterized in that: Wherein a part or all of the adapter sequence of the DNA forward specific amplification primer is identical to the 3' end sequence of the P5 sequencing adapter primer, or the 3' end of the P5 sequencing adapter primer contains a sequence identical to a part or all of the adapter sequence of the DNA forward specific amplification primer; a part or all of the adapter sequence of the DNA reverse specific amplification primer is identical to the 3' end sequence of the P7 sequencing adapter primer, or the 3' end of the P7 sequencing adapter primer contains a sequence identical to a part or all of the adapter sequence of the DNA reverse specific amplification primer.

16. The method according to claim 1, characterized in that The nucleic acid sequence of the template replacement primer includes the sequence shown in SEQ ID NO.1; Preferably, the nucleic acid sequence of the second random primer includes the sequence shown in SEQ ID NO.2; Preferably, the nucleic acid sequence of the linker sequence includes the sequence shown in SEQ ID NO.3; Preferably, the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.4; Preferably, the nucleic acid sequence of the sequencing adapter primer includes the sequence shown in SEQ ID NO.5 or SEQ ID NO.6; Preferably, the nucleic acid sequence of the other universal primer includes the sequence shown in SEQ ID NO.

3.

17. The method according to claim 1, characterized in that The nucleic acid sequence of the template replacement primer includes the sequence shown in SEQ ID NO.20; Preferably, the nucleic acid sequence of the second random primer includes the sequence shown in SEQ ID NO.7; Preferably, the nucleic acid sequence of the linker sequence includes the sequence shown in SEQ ID NO.4; Preferably, the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.3; Preferably, the nucleic acid sequence of the sequencing adapter primer includes the sequence shown in SEQ ID NO.5 or SEQ ID NO.6; Preferably, the nucleic acid sequence of the other universal primer includes the sequence shown in SEQ ID NO.

4.

18. The method according to claim 1 or 2, characterized in that: The universal primer in step (2) is the same universal primer, and preferably the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.4 or SEQ ID NO.

3.

19. The method according to any one of claims 1 to 18, characterized in that: The step (1) also includes the step of purifying the template replacement reverse transcription product and the reverse transcription product.

20. The method according to any one of claims 1 to 19, characterized in that: The step (2) also includes a step of purifying the product of the first amplification reaction.

21. The method according to any one of claims 1 to 20, characterized in that: The step (3) also includes a step of purifying the product of the second amplification reaction.

22. A method for detecting multiple gene mutation types, characterized in that: The method comprises constructing a library using the method described in any one of claims 1 to 21, and sequencing and analyzing the library.

23. Use of a product comprising the primers or primer combinations defined in any one of claims 1 to 18 in constructing a detection library for multiple gene mutation types, wherein the product optionally further comprises reverse transcriptase, dNTPs, DNA polymerase and reaction buffer, and the use is for use in the method according to any one of claims 1 to 22.

24. The product comprises the primers or primer combinations defined in any one of claims 1 to 18, and its use in detecting multiple types of gene mutations. The product optionally comprises reverse transcriptase, dNTPs, DNA polymerase and reaction buffer, and the use is for use in the method according to any one of claims 1 to 22.

Images