Primer combination and kit for detecting multiple gene mutation types and application of primer combination and kit

Abstract

The invention discloses a primer combination and a kit for detecting various gene mutation types and application of the primer combination and the kit. A specific primer combination system is designed, can be effectively applied to construction of detection libraries of various gene mutation types, and is particularly suitable for detection of unknown fusion; fusion forms of 5'and 3 'ends of a target gene can be detected at the same time, and the sequence of the designed template replacement primer and the universal sequence in the random primer with the universal sequence have the same sequence, so that linker sequences at two ends of a by-product during PCR amplification are complementary, intramolecular annealing is performed to form a loop structure, the proportion of RNA full-length by-products is greatly reduced, and the utilization rate of data is remarkably improved; unknown fusion can be accurately detected; meanwhile, DNA template amplification is carried out by utilizing a DNA specific amplification primer pair, a universal primer and a sequencing linker primer pair, so that rapid and comprehensive detection of various types of variation in the fusion gene and DNA is realized; by adding the universal primer into the PCR1, unknown fusion can be detected, the homogeneity of the library can be improved, and the cost can be reduced.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and relates to a primer combination for detecting multiple gene mutation types, a kit and applications thereof. Background Art

[0002] Fusion gene is a type of gene mutation, which refers to the fusion of all or part of the sequences of two genes into a new gene at the DNA or RNA level. It may be the result of chromosomal translocation, interstitial deletion or chromosomal inversion. In most cases, fusion genes can lead to the production of proteins with abnormal sequences or functions, or the dysregulation of certain gene expressions, thereby causing or promoting the occurrence of tumors. Since the discovery of the Philadelphia chromosome in 1973, with the development of detection technology, especially sequencing technology, scientists have successively discovered the existence of a large number of fusion genes in blood tumors such as leukemia and solid tumors such as lung cancer, prostate cancer, breast cancer, ovarian cancer, Ewing sarcoma, and synovial sarcoma. The results of the study show that fusion genes, as tumor driver genes, are of great significance in the diagnosis, prognosis, stratification, treatment and drug development of tumors. Therefore, the accurate detection of fusion genes is an important basis for targeted tumor therapy, and is also of great significance for drug development and precision medicine.

[0003] Currently, the methods for detecting fusion gene mutations mainly include reverse transcription polymerase chain reaction (RT-PCR), immunohistochemistry (IHC), and fluorescence in situ hybridization (FISH). Although these methods are low-cost, they are complex to operate, time-consuming, and can only detect known fusions, which has great limitations.

[0004] High-throughput sequencing (NGS) is one of the main means of detecting unknown fusion genes. It can detect multiple fusion variations of multiple genes at one time, and can detect known and unknown fusions at the same time, as well as point mutations, insertions / deletions, microsatellite instability, copy number variations, etc. However, most of the current library construction methods for detecting unknown fusion genes are time-consuming, difficult to operate, and costly, and need to be further improved.

[0005] Template switch oligo (TSO) is an oligonucleotide that hybridizes with the non-template base added to the 3' end of cDNA after reverse transcription by reverse transcriptase during the reverse transcription process, and then extends its reverse complementary sequence at the 3' end of cDNA through the action of reverse transcriptase. This fixed sequence can be used as a primer anchor site for downstream cDNA amplification. Existing literature has proposed using TSO technology to add a universal sequence to the 3' end of the reverse transcription product, so as to achieve amplification and sequencing of the corresponding fusion gene of the target gene (i.e., driver gene). Since TSO technology can only add a universal sequence to the 3' end of cDNA, the current library construction method using TSO technology to detect unknown fusion genes can only detect the unknown fusion form of the driver gene at the 3' end of the RNA sequence, but cannot simultaneously detect the fusion of the driver gene at the 5' end of the target gene.

[0006] The occurrence and development of tumors is a complex process involving multiple factors, multiple steps and multiple genes. Tumor genetics research has revealed nearly 140 driver genes, including EGFR, KRAS, ALK, ROS1, BRAF, PI3KCA, AKT1, FGFR2, FGFR3, MET, HER2, RET, NTRK1, NTRK2, and NTRK3. These genes are distributed in 12 signaling pathways, regulating cell proliferation, apoptosis and cell differentiation. The mutation status of tumor-related genes plays a very important role in the personalized treatment of tumors, such as diagnosis, treatment and prognosis. As more and more markers are identified, the treatment of tumors will become more and more precise according to patient-specific biomarkers. Current tumor treatment is gradually shifting from the treatment of "a certain disease" to the treatment of "a certain gene". Through the detection of mutations in related driver genes, appropriate targeted drugs are selected in a targeted manner, thereby realizing personalized medicine and achieving the best treatment effect for patients. Amplicon methods detect unknown fusions. For example, CN115074422A discloses a method for detecting unknown fusion genes. However, it is difficult to fully cover the detection and can only detect unknown fusions of 3'-end driver genes, but not 5'-end driver gene fusions, point mutations, short fragment insertions and deletions, and other common variations. The detected mutation types are incomplete.

[0007] However, it is not easy to detect the tumor driver genes of patients. On the one hand, the types of molecular targets involved are complex, including point mutations, short fragment insertion / deletion and fusion mutations. The missed detection of mutation types of related targets will greatly reduce the guidance of targeted medication for patients. On the other hand, the cost of detection is relatively expensive, the operation is complicated, and the cycle is long, which is not conducive to the popularization and application of cancer patients in second- and third-tier cities. At present, the most commonly used technical method for the detection of driver genes is RT-PCR technology. Although this method is simple and fast, it has limitations such as only detecting known mutation sites, incomplete detection of mutation types, and low sensitivity. In addition, the NGS method for detecting driver genes is mainly the capture method, which is time-consuming, difficult to operate and costly, and it is difficult to meet the detection needs of a large number of cancer patients. Summary of the invention

[0008] In view of the shortcomings of existing technologies and actual needs, this field needs a new technology that is comprehensive, highly sensitive, high-throughput, and can accurately detect multiple mutation types simultaneously, so as to effectively supplement and improve the existing personalized diagnosis and treatment of tumors.

[0009] The present invention provides primer combinations, kits and applications thereof for constructing a detection library for various gene mutation types, in order to achieve rapid and comprehensive detection of target fusions, point mutations, short fragment insertion / deletion and other mutations, reduce byproducts, and have simple operation and low cost.

[0010] To achieve the above object, the present invention adopts the following technical solutions:

[0011] In a first aspect, the present invention provides a primer combination for constructing a detection library for multiple gene mutation types, characterized in that the primer combination comprises:

[0012] a first random primer, a template displacement primer, a second random primer, a gene-specific primer, a universal primer, and a sequencing adapter primer pair;

[0013] The first random primer includes a first random sequence; the second random primer includes a universal sequence and a second random sequence in sequence from the 5' to the 3' end; the template displacement primer includes the universal sequence; the gene-specific primer includes a linker sequence and a GSP primer in sequence from the 5' to the 3' end, and the GSP primer is reverse complementary to or identical to the driver gene RNA sequence of the gene to be detected;

[0014] The universal primer includes the universal sequence; one primer in the sequencing adapter primer pair contains a sequence at the 3' end that is identical to part or all of the adapter sequence in the gene-specific primer, and the other primer in the sequencing adapter primer pair contains a sequence at the 3' end that is identical to part or all of the universal primer.

[0015] Preferably, the gene-specific primers include a 5' gene-specific primer and a 3' gene-specific primer.

[0016] Preferably, the gene-specific primers comprise a DNA-specific amplification primer pair; the DNA-specific amplification primer pair comprises a DNA forward-specific amplification primer and a DNA reverse-specific amplification primer.

[0017] Preferably, the DNA forward specific amplification primer and the DNA reverse specific amplification primer in the DNA specific amplification primer pair both include a linker sequence and a GSP primer sequence from the 5' end to the 3' end.

[0018] Preferably, the linker sequence of the DNA forward specific amplification primer is different from the linker sequence of the DNA reverse specific amplification primer, and the linker sequence of the DNA forward specific amplification primer or the linker sequence of the DNA reverse specific amplification primer is the same as the sequence of the universal primer.

[0019] Preferably, the universal primers include two universal primers with different sequences, the linker sequence of the DNA forward specific amplification primer is the same as the sequence of one universal primer; the linker sequence of the DNA reverse specific amplification primer is the same as the sequence of another universal primer; the GSP primer sequence of the DNA forward specific amplification primer is reverse complementary to the DNA template chain sequence, and the GSP primer sequence of the DNA reverse specific amplification primer is the same as the DNA template chain.

[0020] Preferably, the universal sequence is located at the 5' end of the template displacement primer, so as to connect the reverse complementary sequence of the universal sequence to the 3' end of the template displacement reverse transcription product cDNA of the RNA sequence of the gene to be detected after reverse transcription and template displacement of the RNA sequence of the gene to be detected.

[0021] Preferably, the universal sequence is located at the 5' end of the second random primer, and is used for connecting the universal sequence to the 5' end of the cDNA of the reverse transcription product of the RNA sequence of the gene to be detected after reverse transcription of the RNA sequence of the gene to be detected.

[0022] Preferably, the sequence identical to at least a portion of the adapter sequence in the gene-specific primer contained at the 3' end of one primer in the sequencing adapter primer pair is located at the 5' end of the gene-specific primer. Preferably, the sequence identical to at least a portion of the universal primer contained at the 3' end of the other primer in the sequencing adapter primer pair is located at the 5' end of the universal primer.

[0023] Preferably, the gene-specific primers include a 3' gene-specific primer and / or a 5' gene-specific primer, wherein the 3' gene-specific primer includes a linker sequence and a 3'GSP primer in sequence from the 5' to the 3' end, and the 3'GSP primer is reverse complementary to the 3' driver gene RNA sequence of the gene to be detected; the 5' gene-specific primer includes a linker sequence and a 5'GSP primer of the gene to be detected in sequence from the 5' to the 3' end, and the 5'GSP primer sequence is the same as the 5' driver gene RNA sequence.

[0024] In the present invention, a specific primer combination system is designed, which can be effectively applied to construct a detection library for various gene mutation types. A fixed sequence is added to the 3' end and the 5' end of the reverse transcribed cDNA by using a random primer, a template replacement primer and a random primer with a universal sequence, respectively, so that the fusion forms of the 3' and 5' ends of the target gene can be detected simultaneously by amplifying the target fragment by using a 3' / 5' gene-specific primer and a universal primer. The sequence of the template replacement primer and the universal sequence in the random primer with a universal sequence are designed to have the same sequence, so that the adapter sequences at both ends of the byproduct are complementary during PCR amplification, and a loop structure is formed by intramolecular annealing, thereby greatly reducing the proportion of RNA full-length byproducts and realizing rapid and comprehensive detection of target fusion.

[0025] Preferably, the length of the sequence of the first random primer and the sequence of the second random primer are each independently 6 to 70 nt, including but not limited to 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 66 nt, 67 nt, 68 nt, 69 nt or 70 nt.

[0026] Preferably, the first random sequence is an N6 random sequence; and the second random sequence is an N6 random sequence.

[0027] Preferably, the length of the universal sequence is 20 to 35 nt, including but not limited to 20 nt, 21 nt, 22 nt, 25 nt, 26 nt, 28 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt or 35 nt.

[0028] In some embodiments, the common sequence is TTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO. 23).

[0029] In some embodiments, the common sequence is GGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO. 24).

[0030] Preferably, the length of the sequence at the 3' end of one primer in the sequencing adapter primer pair that is identical to a part or all of the adapter sequence in the gene-specific primer is about 20 nt (e.g., 20-21 nt), preferably about 20 nt (e.g., 20-21 nt) from the 5' end of the adapter sequence in the gene-specific primer.

[0031] Preferably, the length of the sequence at the 3' end of the other primer in the sequencing adapter primer pair that is identical to part or all of the universal primer is about 20 nt (e.g., 20-21 nt), preferably about 20 nt (e.g., 20-21 nt) from the 5' end of the universal primer.

[0032] Preferably, the other primer in the sequencing adapter primer pair contains a sequence identical to at least a portion of the universal primer at the 3' end, and the sequence at the 5' end of the identical sequence that is different from the universal sequence of the template displacement primer is the second adapter sequence.

[0033] Preferably, the length of the second linker sequence is 0-7 nt, including but not limited to 0 nt, 1 nt, 2 nt, 3nt, 4 nt, 5 nt, 6 nt, and 7 nt.

[0034] Preferably, the second linker sequence is ACACTCT (SEQ ID NO. 19).

[0035] Preferably, the second linker sequence is GTGACT (SEQ ID NO. 21).

[0036] Preferably, the two primers in the sequencing adapter primer pair are a P5 sequencing adapter primer and a P7 sequencing adapter primer, respectively, the P5 sequencing adapter primer comprises a sequence identical to part or all of the universal primer at its 3' end, and the P7 sequencing adapter primer comprises a sequence identical to part or all of the adapter sequence in the gene-specific primer at its 3' end.

[0037] Preferably, part or all of the adapter sequence of the DNA forward specific amplification primer is identical to the sequence at the 3' end of the P5 sequencing adapter primer; part or all of the adapter sequence of the DNA reverse specific amplification primer is identical to the sequence at the 3' end of the P7 sequencing adapter primer.

[0038] Preferably, the 3' end of the P5 sequencing adapter primer contains a sequence identical to part or all of the adapter sequence of the DNA forward specific amplification primer; the 3' end of the P7 sequencing adapter primer contains a sequence identical to part or all of the adapter sequence of the DNA reverse specific amplification primer.

[0039] Preferably, the nucleic acid sequence of the template replacement primer includes the sequence shown in SEQ ID NO.1, and rG is the ribonucleic acid G base.

[0040] Preferably, the nucleic acid sequence of the second random primer includes the sequence shown in SEQ ID NO.2.

[0041] Preferably, the nucleic acid sequence of the linker sequence includes the sequence shown in SEQ ID NO.3.

[0042] Preferably, the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.4.

[0043] Preferably, the nucleic acid sequence of the sequencing adapter primer includes the sequence shown in SEQ ID NO.5 or SEQ ID NO.6.

[0044] Preferably, the nucleic acid sequence of the other universal primer includes the sequence shown in SEQ ID NO.3.

[0045] SEQ ID NO. 1: TTCCTACACGACGCTCTCCGATCTrGrGrG.

[0046] SEQ ID NO. 2: TTCCCTACACGACGCTCTCCGATCTNNNNNN.

[0047] SEQ ID NO. 3: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT.

[0048] SEQ ID NO. 4: ACACTCTTTCCCTACACGACCGCTTCCGATCT.

[0049] SEQ ID NO.5:

[0050] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGAC.

[0051] SEQ ID NO.6:

[0052] CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGT.

[0053] Preferably, the nucleic acid sequence of the template replacement primer includes the sequence shown in SEQ ID NO.20, and rG is the ribonucleic acid G base.

[0054] Preferably, the nucleic acid sequence of the second random primer includes the sequence shown in SEQ ID NO.7.

[0055] Preferably, the nucleic acid sequence of the linker sequence includes the sequence shown in SEQ ID NO.4.

[0056] Preferably, the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.3.

[0057] Preferably, the nucleic acid sequence of the sequencing adapter primer includes the sequence shown in SEQ ID NO.5 or SEQ ID NO.6.

[0058] Preferably, the nucleic acid sequence of the other universal primer includes the sequence shown in SEQ ID NO.4.

[0059] Preferably, the gene to be detected is selected from: FGFR2, FGFR3, ALK, BRAF, NTRK1, NTRK3, RET, ROS1 or MET. Preferably, a 5'GSP primer comprising the following nucleic acid sequence can be used: ACCTGGACCGTGTCCTTArCCGTGA (SEQ ID NO.9); and a 3'GSP primer comprising the following nucleic acid sequence can be used: TCATGATGGTCGAGGTGCrGGAGCT (SEQ ID NO.10), ATGATCTTCATCTGCTGGTCGrGAAGGG (SEQ ID NO.11), TCCACATTTGTTGAGCACAArGGAGCA (SEQ ID NO.12), CACCGGGTCTCCAGATGrUGCTGT (SEQ ID NO.13), GTCTCTCCTCTTAATGTGCTrGCACAA (SEQ ID NO.14), CCAAGAACCAAGTTCTTCCGAGrGGAATA (SEQ ID NO.15), AAGGAGAAGAGGACAGCGrGCTGCG (SEQ ID NO.16), TGTAACAACCAGAAATATTCCAACTATrAATAGT (SEQ ID NO.17). NO.17) or TAGTTAGGATGGGGGACATGrUCTGTC (SEQ ID NO.18).

[0060] In a second aspect, the present invention provides the use of the primer combination for constructing a detection library for multiple gene mutation types described in the first aspect in preparing a product for constructing a detection library for multiple gene mutation types.

[0061] Preferably, the present invention provides the use of the primer combination for constructing a detection library for multiple gene mutation types described in the first aspect in the preparation of a product for constructing a detection library for simultaneously detecting multiple gene mutation types.

[0062] Preferably, the product is in the form of a reagent or a kit.

[0063] In a third aspect, the present invention provides a product for constructing a detection library for multiple gene mutation types or a product for detecting multiple gene mutation types, wherein the product comprises a primer combination for constructing a detection library for multiple gene mutation types as defined in the first aspect and optional reverse transcriptase, dNTP, DNA polymerase and reaction buffer.

[0064] Preferably, the present invention provides a product for constructing a detection library for simultaneously detecting multiple types of gene mutations, the product comprising the primer combination for constructing a detection library for multiple types of gene mutations as described in the first aspect and optional reverse transcriptase, dNTP, DNA polymerase and reaction buffer.

[0065] Preferably, the product is in the form of a reagent or a kit.

[0066] Preferably, the product comprises the primer combination for constructing a detection library for various gene mutation types as described in the first aspect, template-displacing reverse transcriptase, dNTP, DNA polymerase, reaction buffer, and reverse transcription and PCR-related reagents.

[0067] In a fourth aspect, the present invention provides the use of the primer combination for constructing a detection library for multiple gene mutation types described in the first aspect in constructing a detection library for multiple gene mutation types.

[0068] Preferably, the present invention provides the use of the primer combination for constructing a detection library for multiple gene mutation types described in the first aspect in constructing a detection library for simultaneously detecting multiple gene mutation types.

[0069] In a fifth aspect, the present invention provides a method for constructing a detection library for multiple gene mutation types. Preferably, a method for constructing a detection library for simultaneously detecting multiple gene mutation types is provided. The method uses the primer combination for constructing a detection library for multiple gene mutation types described in the first aspect, and comprises the following steps:

[0070] (1) Sample RNA is divided into two parts as templates, one part is subjected to a template displacement reverse transcription reaction using a first random primer and a template displacement primer to obtain a template displacement reverse transcription product; the other part is subjected to a reverse transcription reaction using a second random primer to obtain a reverse transcription product;

[0071] (2) using the template-displaced reverse transcription product and the reverse transcription product as a template, using gene-specific primers and universal primers, to perform a first amplification reaction to obtain a product of the first amplification reaction;

[0072] (3) Performing a second amplification reaction on the product of the first amplification reaction using a sequencing adapter primer to obtain a product of the second amplification reaction, which is used to construct a detection library for the multiple gene mutation types.

[0073] Preferably, step (2) further comprises using the sample DNA as a template, using a DNA-specific amplification primer pair and a universal primer, to perform a first amplification reaction to obtain a product of the first amplification reaction.

[0074] Preferably, the universal primer in step (2) is the same universal primer; preferably, the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.4 or SEQ ID NO.3.

[0075] Preferably, step (1) or step (2) further comprises the step of mixing the template-switched reverse transcription product with the reverse transcription product, and combining them with a DNA-specific amplification primer pair and a universal primer in step (2) to carry out a first amplification reaction.

[0076] Preferably, step (1) further comprises the step of purifying the template replacement reverse transcription product and the reverse transcription product.

[0077] Preferably, step (2) further comprises the step of purifying the product of the first amplification reaction.

[0078] Preferably, step (3) also includes the step of purifying the product of the second amplification reaction.

[0079] In a sixth aspect, the present invention provides a method for detecting multiple types of gene mutations. Preferably, a method for simultaneously detecting multiple types of gene mutations is provided, the method comprising constructing a library using the method for constructing a detection library for multiple types of gene mutations described in the fifth aspect, and sequencing and analyzing the library.

[0080] In the present invention, a method for rapidly and comprehensively detecting various types of gene mutations is designed, which has broad application prospects, such as the study of the basic behavior of fusion genes for non-disease diagnosis or treatment purposes, etc.

[0081] In the present invention, the P5 sequencing adapter primer and the P5 universal primer can be used interchangeably; the P7 sequencing adapter primer and the P7 universal primer can be used interchangeably.

[0082] the term

[0083] The full name of Variant Allele Frequency (Variant Allele Frequency) or Variant Allele Fraction (Variant Allele Fraction).

[0084] ddPCR (Droplet Digital PCR) is a droplet digital PCR that provides an ultra-high-similarity nucleic acid detection and absolute quantification method.

[0085] The various gene mutation types described in the present invention include, but are not limited to, point mutation, short fragment insertion / deletion, fusion mutation, microsatellite instability or copy number variation.

[0086] Compared with the prior art, the present invention has the following beneficial effects:

[0087] The unknown fusion gene detection method based on TSO technology developed by the present invention uses random primers with universal sequences and random primers and template replacement primers to add universal sequences at both ends of the cDNA sequence, which can realize the detection of the fusion situation on both sides of the target gene; it can realize the amplification and sequencing of multiple target genes with gene fusion occurring on different ends at the same time, and the detection results are more comprehensive. The present invention can detect the unknown fusion of the 3' driver gene in the RNA template and the unknown fusion of the 5' driver gene through the amplicon method, and can also detect point mutations, insertions / deletions and microsatellite instability in the DNA template. The method is simple to operate, low cost, and has a wide audience, which is more conducive to the popularization and application of tumor patients. In addition, by designing the template replacement primer and the second random primer (random primer with universal sequence) with the same universal sequence, the universal sequence is the same as the 3' end sequence of the universal primer, so that the adapter sequences at both ends of the byproduct in the first PCR amplification reaction are complementary, and the intramolecular annealing forms a loop structure, effectively inhibiting the amplification of the full-length byproduct, especially the formation of byproducts represented by rRNA, improving the detection sensitivity of the variation, and realizing the rapid and comprehensive detection of RNA target fusion genes, which is conducive to subsequent sequencing and analysis. At the same time, adding universal primers to PCR1 can also improve the uniformity of the library, which is beneficial to cost saving and can more accurately, efficiently and cost-effectively detect point mutations, insertions / deletions, and microsatellite instability in individual DNA templates. BRIEF DESCRIPTION OF THE DRAWINGS

[0088] Figure 1 This is a schematic diagram of the RNA template amplification principle. The i5-i5 system is applicable to this diagram.

[0089] Figure 2 This is a schematic diagram of the RNA template amplification principle for the comparative example. The i5-i7 system is suitable for this diagram.

[0090] Figure 3 Schematic diagram of DNA template amplification.

[0091] Figure 4 Figure 1 is a flowchart of library construction, where A is the flowchart of RNA library construction and B is the flowchart of DNA & RNA co-construction library.

[0092] Figure 5 The figure shows the detection results of 13 fusion forms under the same conditions using the i5-i5 primer system and the i5-i7 primer system.

[0093] Figure 6 This is a graph showing the percentage of valid reads detected for DNA, mRNA, rRNA, and byproducts using the i5-i5 primer system and the i5-i7 primer system.

[0094] Figure 7 This is a graph of SNV variation detection results.

[0095] Figure 8 The results of MSI-H and MSS are shown in Figure 2.

[0096] Fig. 9 The results of library uniformity of test samples were respectively performed using the method of the present invention (adding universal primer 1 to PCR1, or adding universal primer 1 and universal primer 2 at the same time) and the comparative method (not adding universal primer to PCR1). DETAILED DESCRIPTION

[0097] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0098] If no specific technology or conditions are specified in the examples, the technology or conditions described in the literature in the field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels. In addition, "reverse transcription" in the claims, description and examples of the present invention is synonymous with "reverse transcription".

[0099] The present invention develops a method for constructing an unknown fusion gene detection library based on template switch oligo, and the technical principle is: A cDNA library with a fixed sequence at the 3' end is generated by reverse transcription reaction using random primers and template displacement primers. At the same time, a cDNA library with a fixed sequence at the 5' end is generated by reverse transcription reaction using random primers with a universal sequence. The fixed sequences at both ends are in a reverse complementary relationship, and the universal primers are shared in the downstream PCR reaction. Gene specific primers (GSP) are designed according to the position of the target gene on the RNA sequence; if the fusion of the 3' end of the target gene on the RNA sequence is detected, the GSP should carry the reverse complementary sequence of the 3' end region of the target gene on the RNA sequence. If the fusion of the 5' end of the target gene on the RNA sequence is detected, the GSP should carry the same sequence as the 5' end region of the target gene on the RNA sequence. After effective amplification with gene specific primers, unknown fusion events of the target gene can be detected.

[0100] Example 1

[0101] This example designs primers used in constructing a detection library for various gene mutation types.

[0102] The primer sequences are shown in Table 1.

[0103] Table 1 Primers required for the construction of detection libraries for various gene mutation types

[0104]

[0105] Where N is a random base, A, G, C or T; rG is the RNA G base. The primer sequences were synthesized by IntegratedDNA Technologies (USA) (IDT). The product was delivered in the form of dry powder, and IDTE buffer (IDT) was added according to the volume recommended by the manufacturer, and the quality control was performed using a NanoDrop spectrophotometer (Thermo Fisher).

[0106] The technical principle of the primer system (named as i5-i5 system) including the N6 random primer, the random primer with universal sequence 1, the template displacement primer, the universal primer 1, the 3' gene-specific primer, the 5' gene-specific primer, the P5 universal primer and the P7 universal primer as shown in Table 1 is as follows Figure 1 and Figure 3 As shown, Driver refers to the driver gene, Partner refers to the partner gene, and fusion genes include many types. The fusion of a proto-oncogene with another gene (called the "partner gene") leads to the occurrence and progression of cancer.

[0107] ① Reverse transcription step: RNA is divided into two tubes. One tube is reverse transcribed to the 5' end of RNA using random primers, and then non-template bases are added. Finally, a DNA-dependent DNA polymerase reaction is carried out under the guidance of template displacement primers to synthesize a cDNA library with a fixed sequence at the 3' end. The other tube is reverse transcribed using random primers with universal sequence 1 to generate a cDNA library with a fixed sequence at the 5' end. The two cDNA libraries are mixed and purified.

[0108] ② One round of PCR step (PCR1): Gene-specific primers are designed according to the position of the target gene on the RNA sequence. If the 3'-driven gene fusion is detected, the target fragment is amplified by the 3'-gene-specific primer and the universal primer 1. If the 5'-driven gene fusion is detected, the target fragment is amplified by the 5'-gene-specific primer and the universal primer 1; DNA-specific amplification primer pairs (including DNA forward-specific amplification primers and DNA reverse-specific amplification primers) are designed according to the position of the target gene on the DNA sequence. The target fragment is amplified using the DNA forward-specific amplification primer and the DNA reverse-specific amplification primer and the universal primer 1, and then the product is purified. In addition, the same cDNA from the two tubes of RT will produce byproducts during amplification. The byproduct type can be any form contained in RNA, including fusion type / wild type / rRNA / mRNA, etc. In this regard, the template replacement primer and the random primer with a universal sequence designed in this embodiment have a common sequence, so that the adapter sequences at both ends of the full-length byproduct are complementary, and can be annealed intramolecularly to form a loop structure, inhibit PCR formation, and greatly reduce the proportion of RNA full-length byproducts. The template replacement primer and the random primer with universal sequence have a common sequence so that the two tubes of cDNA can share the universal primer in the first round of PCR after mixing. In addition, the 3' gene-specific primer and the 5' gene-specific primer have the same adapter primer sequence, and part or all of the adapter primer sequence is the same as the 3' end sequence of the P7 universal primer. The universal sequence in the template replacement primer is the same as the random primer with universal sequence 1 and the universal sequence in universal primer 1, and the sequence at the 3' end of the P5 universal primer is partially the same as the above universal sequence.

[0109] Preferably, the universal sequence in the template replacement primer is TTCCCTACACGACGCTCTTCCGATCT, the universal sequence of the random primer with universal sequence 1 is TTCCCTACACGACGCTCTTCCGATCT at the 5' end, the universal sequence in universal primer 1 is TTCCCTACACGACGCTCTTCCGATCT at 5' 8-33 bp, and the universal sequence in the P5 universal primer is ACACTCTTTCCCTACACGAC, wherein the partial sequence (TTCCCTACACGAC) is the same as the 5' first 13 bp sequence (TTCCCTACACGAC) in the above universal sequence. The combination of these primers can produce a loop structure and reduce byproducts. The present invention selects this combination to fully demonstrate in the embodiment.

[0110] If the linker sequence of the 3' gene-specific primer is replaced with the corresponding sequence in the P5 universal primer, preferably the 3' gene-specific primer is replaced with the 3' gene-specific primer-2; the linker sequence of the 5' gene-specific primer is replaced with the sequence corresponding to the P5 universal primer, preferably the 5' gene-specific primer is replaced with the 5' gene-specific primer-2; at the same time, the random primer with universal sequence 1 (random primer 1) is replaced with a random primer with universal sequence 2 (i.e., random primer 2), and the universal sequence in the template replacement primer is replaced with a sequence identical to universal sequence 2 (which is also identical to universal sequence 2). The 3' partial sequence of universal primer 2 is the same), preferably the template replacement primer is replaced by template replacement primer-2; and the universal sequence in the P7 universal primer is the same as the partial sequence in universal sequence 2. The combination of these primers (such as the N6 random primer, the random primer with universal sequence 2, template replacement primer-2, universal primer 2, 3' gene specific primer-2, 5' gene specific primer-2, P5 universal primer-2 and P7 universal primer-2 shown in Table 1) (i7-i7 system) can also form a loop structure in PCR1 to reduce the generation of by-products.

[0111] Preferably, the linker sequence of the 3' gene-specific primer is ACACTCTTTCCCTACACGACGCTCTTCCGATCT, the corresponding sequence in the P5 universal primer is ACACTCTTTCCCTACACGAC, the linker sequence of the 5' gene-specific primer is ACACTCTTTCCCTACACGACGCTCTTCCGATCT, the universal sequence in the template-displacing primer is GGAGTTCAGACGTGTGCTCTTCCGATCT, and the corresponding universal sequence in the P7 universal primer is GTGACTGGAGTTCAGACGTGT, wherein a partial sequence (GGAGTTCAGACGTGT) is identical to the 5' first 15 bp sequence (GGAGTTCAGACGTGT) in universal sequence 2.

[0112] The 3' gene-specific primer includes a linker sequence and a 3' GSP primer from the 5' to the 3' end, and the 3' GSP primer is reverse complementary to the 3' driver gene RNA sequence of the gene to be detected; the 5' gene-specific primer includes a linker sequence and a 5' GSP primer of the gene to be detected from the 5' to the 3' end, and the 5' GSP primer sequence is the same as the 5' driver gene RNA sequence.

[0113] The DNA specific amplification primer pair corresponding to point mutation, insertion / deletion and MSI detection includes a linker sequence and a GSP primer sequence from 5' to 3' end in sequence, and the DNA specific amplification primer pair includes a DNA forward specific amplification primer and a DNA reverse specific amplification primer. The GSP primer sequence of the DNA forward specific amplification primer is reverse complementary to the DNA template chain sequence, and the GSP primer sequence of the DNA reverse specific amplification primer is the same as the DNA template chain. The linker sequences in the DNA forward specific amplification primer and the DNA reverse specific amplification primer are different sequences, respectively, and are different sequences in the sequencing linker primer. The linker sequence of the DNA forward specific amplification primer of the present invention is the same as the sequence of universal primer 1, and part or all of the linker sequence of the DNA forward specific amplification primer is the same as the sequence of the 3' end in the P5 universal primer (sequencing linker primer); part or all of the linker sequence of the DNA reverse specific amplification primer is the same as the sequence of the 3' end in the P7 universal primer (sequencing linker primer), and is the same as the sequence of the universal primer 2 sequence. For example, the DNA forward specific amplification primer sequence for detecting EGFR_p.L858R_c.2573T>G mutation is: acactctttccctacacgacgctcttccgatctAAACACCGCAGCATGTCAArGATCAG / 3SPC3 / ; the DNA reverse specific amplification primer sequence is: gtgactggagttcagacgtgtgctcttccgatctTACAGCTAGTGGGAAGGCAGrCCTGGA / 3SPC3 / ; the lowercase sequence is the linker sequence.

[0114] It is understandable that only universal primer 1 or only universal primer 2 can be selected from universal primer 1 and universal primer 2 for DNA template amplification. For example, when only universal primer 1 is used, the adapter sequence of the DNA forward specific amplification primer of the present invention is the same as the sequence of universal primer 1, and part or all of the adapter sequence of the DNA forward specific amplification primer is the same as the sequence of the 3' end of the P5 universal primer (sequencing adapter primer); part or all of the adapter sequence of the DNA reverse specific amplification primer is the same as the sequence of the 3' end of the P7 universal primer (sequencing adapter primer), and universal primer 2 is omitted. Similarly, when only universal primer 2 is used, part or all of the adapter sequence of the DNA forward specific amplification primer of the present invention is the same as the sequence of the 3' end of the P5 universal primer (sequencing adapter primer), and universal primer 1 is omitted; part or all of the adapter sequence of the DNA reverse specific amplification primer is the same as the sequence of the 3' end of the P7 universal primer (sequencing adapter primer), and the same as the sequence of universal primer 2. Although the uniformity effect of using only universal primer 1 or only universal primer 2 for DNA template amplification may not be as good as using both universal primer 1 and universal primer 2, it can also improve amplification uniformity to a certain extent.

[0115] ③ Second round of PCR (PCR2): Use P5 and P7 sequencing adapter primers to amplify the purified PCR1 product. After amplification, purify the library (in Figure 1 In the figure, the P5 sequencing adapter primer is shown as the P5 universal primer, and the P7 sequencing adapter primer is shown as the P5 universal primer. Figure 1 The P7 universal primer is shown in Figure ).

[0116] The random primer or the random sequence in the random primer can be a plurality of random bases, for example, 6 to 70 random bases, including but not limited to 7, 8, 9, 10, 11, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 66, 67, 68, 69 bases, etc., for reverse transcribing RNA into cDNA.

[0117] It should be noted that although Table 1 shows that the P7 universal primer contains a sequence identical to a portion of the adapter sequence in the gene-specific primer (3' gene-specific primer or 5' gene-specific primer) at the 3' end, the sequence of the identical portion is located at the 5' end of the gene-specific primer, so as to amplify the target and tail the target using the P7 universal primer. For this purpose, those skilled in the art can also set the sequence at the 3' end of the P7 universal primer (the sequence between the barcode and the 3' end) to be completely identical to the adapter sequence of the gene-specific primer. Although Table 1 shows that the P5 universal primer contains a sequence identical to a portion of the universal primer at the 3' end, the identical sequence is located at the 5' end of the universal primer, so as to achieve the purpose of tailing, so as to amplify the target and tail the target using the P5 universal primer, for this purpose, those skilled in the art can also set the sequence at the 3' end of the P5 sequencing adapter primer (the sequence between the barcode and the 3' end) to be completely identical to the universal sequence.

[0118] GSP primers can be designed according to the gene to be detected, and an exemplary display is shown in Table 2.

[0119] Table 2

[0120]

[0121] Example 2 Construction of RNA library for unknown fusion gene detection

[0122] This example constructs an RNA library for detecting unknown fusion genes.

[0123] 1. Preparation of experimental samples: Use nucleic acid extraction or purification reagents (Shanghai Silidi Biomedical Technology Co., Ltd.) to extract RNA from paraffin-embedded samples (FFPE) or other types of samples. For the extracted RNA, perform template switching (TSO) reaction and reverse transcription (RT) reaction according to the following procedures.

[0124] 2. Template switching (TSO) reaction: Prepare TSO reverse transcription system according to Table 3.

[0125] Table 3 TSO reverse transcription system

[0126]

[0127] Prepare the reaction system in Table 3, mix by pipetting, centrifuge briefly, incubate at 65°C for 5 min in a PCR instrument, and then incubate on ice for at least 1 min. Then add the template switching (TSO) reaction system to continue the reaction. The template switching reaction system is shown in Table 4. Perform the reaction program in a PCR instrument at 23°C for 10 min, 50-55°C for 10 min, 80°C for 10 min, and maintain at 4°C to generate template switching reverse transcription products.

[0128] Table 4 Template switching reaction system

[0129]

[0130] 3. Reverse transcription (RT) reaction: Prepare the reverse transcription system according to Table 5.

[0131] Table 5 Reverse transcription system

[0132]

[0133] Prepare the reaction system in Table 5, mix by pipetting, centrifuge briefly, set the heat cover of the PCR instrument to ≥ 85°C, and perform the reaction procedure of 25°C, 10 min, 42°C, 30 min, 80°C, 20 min, and maintain at 4°C to generate reverse transcription products.

[0134] 4. Product purification:

[0135] The reverse transcription product was transferred to the template-switched reverse transcription product, and 100 μL (2.5×) AMPure XpBeads was added to mix, centrifuged, and purified; after standing at room temperature for 5 min, the supernatant was discarded on a magnetic rack; then washed twice with 200 μL 80% ethanol, dried at room temperature for 5 min, and finally washed with 15 μL H 2 O to elute the purified product. Recover the supernatant for use in downstream reactions. It is understandable that the template-switched reverse transcription product can also be transferred to the reverse transcription product. In short, the template-switched reverse transcription product can be mixed with the reverse transcription product. In this way, the template-switched reverse transcription product and the reverse transcription product can be mixed for subsequent amplification process, and there is no need to perform subsequent amplification separately, which greatly simplifies the experimental process.

[0136] 5. PCR1 specific amplification: The first round of PCR (PCR1) reaction system (30uL) was prepared according to Table 6. The primer set in Table 6 was designed by the authors of the present invention and synthesized at IDT; cDNA was the purified product in step 4.

[0137] Table 6 PCR1 amplification reaction system

[0138]

[0139] The first round of amplification of the target region was performed using a ProFlex PCR System PCR instrument (Applied biosystems by life technologies, model: ProFlex) according to the reaction program in Table 7.

[0140] Table 7 PCR1 amplification program

[0141]

[0142] 6. Purification of PCR1 amplification products:

[0143] Add Agencourt AMPure XP beads and mix well, then wash with 80% ethanol (freshly prepared and used) to purify the target product.

[0144] 7. PCR2 specific amplification: Prepare the second round of PCR (PCR2) reaction system according to Table 8.

[0145] Table 8 PCR2 amplification reaction system

[0146]

[0147] Prepare the reaction system in Table 8 and perform amplification in a PCR instrument according to the reaction program in Table 9.

[0148] Table 9 PCR2 amplification program

[0149]

[0150] 8. Purification of PCR2 amplification products: Add AMPure Xp Beads to the second-round PCR product system and mix well; wash with 80% ethanol (freshly prepared and used) to purify the target product, and perform quantitative quality inspection on the purified library.

[0151] 9. Sequence the library and perform data analysis.

[0152] The database construction process is as follows Figure 4 As shown in A.

[0153] Example 3 Construction of DNA & RNA libraries for detection of multiple gene mutation types

[0154] This example constructs a DNA & RNA library for detecting multiple gene mutation types.

[0155] 1. Preparation of experimental samples: Use nucleic acid extraction or purification reagents (Shanghai Silidi Biomedical Technology Co., Ltd.) to extract DNA and RNA from paraffin-embedded samples (FFPE) or other types of samples. For the extracted RNA, perform template switching (TSO) reaction and reverse transcription (RT) reaction according to the following procedures.

[0156] 2. Template switching (TSO) reaction: Prepare TSO reverse transcription system according to Table 10.

[0157] Table 10 TSO reverse transcription system

[0158]

[0159] Prepare the reaction system in Table 10, mix by pipetting, centrifuge briefly, incubate at 65°C for 5 min in a PCR instrument, and then incubate on ice for at least 1 min. Then add the template switching (TSO) reaction system to continue the reaction. The template switching reaction system is shown in Table 11. Perform the reaction program in a PCR instrument at 23°C for 10 min, 50-55°C for 10 min, 80°C for 10 min, and maintain at 4°C to generate template switching reverse transcription products.

[0160] Table 11 Template switching reaction system

[0161]

[0162] 3. Reverse transcription (RT) reaction: prepare the reverse transcription system according to Table 12.

[0163] Table 12 Reverse transcription system

[0164]

[0165] Prepare the above system, mix by pipetting, centrifuge briefly, set the heat cover of the PCR instrument to ≥85°C, and perform the reaction procedure of 25°C, 10 min, 42°C, 30 min, 80°C, 20 min, and maintain at 4°C to generate reverse transcription products.

[0166] 4. Product purification:

[0167] The reverse transcription product was transferred to the template-switched reverse transcription product, and 100 μL (2.5×) AMPure XpBeads was added to mix, centrifuged, and purified; after standing at room temperature for 5 min, the supernatant was discarded on a magnetic rack; then washed twice with 200 μL 80% ethanol, dried at room temperature for 5 min, and finally washed with 15 μL H 2O to elute the purified product. Recover the supernatant for use in downstream reactions. It is understandable that the template-switched reverse transcription product can also be transferred to the reverse transcription product. In short, the template-switched reverse transcription product can be mixed with the reverse transcription product. In this way, the template-switched reverse transcription product and the reverse transcription product can be mixed for subsequent amplification process, and there is no need to perform subsequent amplification separately, which greatly simplifies the experimental process.

[0168] 5. PCR1 specific amplification: The first round of PCR (PCR1) reaction system was prepared according to Table 13. Pool_FWD and Pool_REV refer to the forward primer mixture and the reverse primer mixture, respectively. The forward primer mixture includes a DNA forward specific amplification primer and a 5' gene specific primer, and the reverse primer mixture includes a DNA reverse specific amplification primer and a 3' gene specific primer; the primer set in Table 13 was designed by the authors of the present invention and synthesized at IDT; cDNA is the purified product in step 4, and DNA is the DNA extracted in step 1.

[0169] Table 13 PCR1 amplification reaction system

[0170]

[0171] The first round of amplification of the target region was performed using a ProFlex PCR System PCR instrument (Applied biosystems by life technologies, model: ProFlex) according to the reaction program in Table 14.

[0172] Table 14 PCR1 amplification program

[0173]

[0174] 6. Purification of PCR1 amplification products:

[0175] Add Agencourt AMPure XP beads and mix well, then wash with 80% ethanol (freshly prepared and used) to purify the target product.

[0176] 7. PCR2 specific amplification: Prepare the second round of PCR (PCR2) reaction system according to Table 15.

[0177] Table 15 PCR2 amplification reaction system

[0178]

[0179] Prepare the above reaction system and perform amplification in a PCR instrument according to the reaction program in Table 16.

[0180] Table 16 PCR2 amplification program

[0181]

[0182] 8. Purification of PCR2 amplification products: Add AMPure Xp Beads to the second-round PCR product system and mix well; wash with 80% ethanol (freshly prepared and used) to purify the target product, and perform quantitative quality inspection on the purified library.

[0183] 9. Sequence the library and perform data analysis.

[0184] The database construction process is as follows Figure 4 As shown in B.

[0185] Comparative Example 1

[0186] In this comparative example, a primer system i5-i7 is designed, and the template replacement primer and the random primer with a universal sequence are not designed to have a common sequence, that is, the two ends of the byproduct of one round of PCR cannot be complementary and cannot form an intramolecular loop, which is compared with the i5-i5 system in Example 1 to prove that the specially designed primer system of the present invention can reduce the proportion of full-length byproducts. The primer sequences used are shown in Table 1.

[0187] The primer sequences of the i5-i7 system are selected from Table 1. The main differences between the i5-i7 system and the i5-i5 system are: 1) random primer 2 (random primer with universal sequence 2) replaces random primer 1 (random primer with universal sequence 1); 2) 5' gene-specific primer-2 replaces 5' gene-specific primer, and universal sequence 2 replaces universal sequence 1. The other primers are the same as those of the i5-i5 system, and the amplification of the 5' driven fusion form can be completed.

[0188] The technical principles of the i5-i7 system are as follows Figure 2 As shown, Reverse transcription step: RNA is divided into two tubes. One tube is reverse transcribed to the 5' end of RNA by random primers, then non-template bases are added, and finally a DNA-dependent DNA polymerase reaction is carried out under the guidance of template displacement primers to synthesize a cDNA library with a fixed sequence at the 3' end. The other tube is reverse transcribed using random primers with universal sequence 2 to generate a cDNA library with a fixed sequence at the 5' end. The two tubes of cDNA libraries are mixed and purified; PCR1 step: Design gene-specific primers according to the position of the target gene on the RNA sequence. If the 3'-driven gene fusion is detected, the target fragment is amplified by the 3'-gene-specific primer and universal primer 1. If the 5'-driven gene fusion is detected, the target fragment is amplified by the 5'-gene-specific primer-2 and universal primer 2. At the same time, the same cDNA from the two tubes of RT will produce byproducts during amplification. The byproduct type can be any form contained in RNA, including fusion type / wild type / rRNA / mRNA, etc. The product is purified; PCR2 step: Use P5 and P7 sequencing adapter primers to amplify the purified PCR1 product, and purify the library after amplification (in Figure 2 In the figure, the P5 sequencing adapter primer is shown as the P5 universal primer, and the P7 sequencing adapter primer is shown as the P5 universal primer. Figure 1 The P7 universal primer is shown in Figure ).

[0189] The template switching (TSO) reaction and reverse transcription (RT) reaction were carried out as described in Example 2.

[0190] Test Example 1

[0191] The libraries prepared in Example 2 (a system in which the universal sequences in the template-replacing primers and the random primers with universal sequence 1 are the same, referred to as the i5-i5 system) and Comparative Example 1 (a system in which the universal sequences in the template-replacing primers and the random primers with universal sequence 2 are different, referred to as the i5-i7 system) were sequenced and analyzed by bioinformatics.

[0192] The i5-i5 system and the i5-i7 system were tested for 13 common fusion forms under the same conditions using Seracare standards. After quantification of the standards by ddPCR, 100 copies / 10 ng were added to each fusion, and 2 replicates were performed for each sample. The results are as follows Figure 5 As shown in the figure, the i5-i5 system uses PCR suppression technology to suppress byproducts, and the average fusion reads detected are significantly higher than those of the i5-i7 system, and the detection sensitivity is significantly improved.

[0193] The quality control (QC) comparison chart of i5-i5 system and i5-i7 system under the same conditions is as follows Figure 6 As shown, the byproducts and rRNA reads of the method of the present invention are significantly reduced, the proportion of valid reads including DNA and mRNA is significantly increased, and the effective utilization rate of data is significantly improved.

[0194] In summary, the unknown fusion gene detection method based on TSO technology developed by the present invention uses random primers with universal sequences and random primers and template replacement primers to add universal sequences at both ends of the cDNA sequence, so as to detect the fusion situation on both sides of the target gene; in addition, the present invention designs specific primers, uses the complementary adapter sequences at both ends of the full-length byproducts, can anneal intramolecularly to form a loop structure, inhibit PCR, and the target product is effectively amplified using 5' / 3' gene-specific primers and universal primers, thereby effectively inhibiting the formation of full-length byproducts, especially byproducts represented by rRNA.

[0195] Test Example 2

[0196] SNV positive cell lines (purchased from ATCC) were selected for SNV variation detection. Eight sites in the panel were selected, and the mutation frequency was verified by ddPCR. The samples were prepared into VAF2% and tested using the method of the present invention (i5-i5 system). Each SNV site was repeated 10 times. The results are as follows Figure 7 As shown, SNVs can be accurately detected.

[0197] Test Example 3

[0198] 40 microsatellite instability (MSI-H) and 160 microsatellite stability (MSS) clinical FFPE samples provided by Tianjin Cancer Hospital and Beijing Cancer Hospital were selected for testing according to the method of the present invention (i5-i5 system). All samples were verified by PCR gold standard. The results are as follows Figure 8 As shown, the detection result of the method of the present invention is 100% consistent with the PCR gold standard.

[0199] Test Example 3

[0200] Three clinical FFPE samples provided by Tianjin Cancer Hospital and Beijing Cancer Hospital were selected and tested using the method of the present invention (referring to the method described in Example 3, adding universal primer 1 to PCR1, or adding universal primer 1 and universal primer 2 at the same time) and the comparative method (referring to the method described in Example 3, except that universal primers were not added to PCR1). The results are as follows Fig. 9 As shown in the figure, the addition of universal primers in PCR1 significantly improved the uniformity of the library compared with not adding universal primers.

[0201] The applicant declares that the present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A primer combination for constructing a library for detecting multiple gene mutation types, characterized in that: The primer combination comprises: a first random primer, a template displacement primer, a second random primer, a gene-specific primer, a universal primer, and a sequencing adapter primer pair; The first random primer includes a first random sequence; the second random primer includes a universal sequence and a second random sequence in sequence from the 5' to the 3' end; the template displacement primer includes the universal sequence; the gene-specific primer includes a linker sequence and a GSP primer in sequence from the 5' to the 3' end, and the GSP primer is reverse complementary to or identical to the driver gene RNA sequence of the gene to be detected; The universal primer includes the universal sequence; one primer in the sequencing adapter primer pair contains a sequence at the 3' end that is identical to part or all of the adapter sequence in the gene-specific primer, and the other primer in the sequencing adapter primer pair contains a sequence at the 3' end that is identical to part or all of the universal primer.

2. The primer combination according to claim 1, characterized in that The gene-specific primers include a DNA-specific amplification primer pair; the DNA-specific amplification primer pair includes a DNA forward-specific amplification primer and a DNA reverse-specific amplification primer.

3. The primer combination according to claim 1 or 2, characterized in that: The DNA forward specific amplification primer and the DNA reverse specific amplification primer both include a linker sequence and a GSP primer sequence from the 5' to the 3' end, the linker sequence of the DNA forward specific amplification primer is different from the linker sequence of the DNA reverse specific amplification primer, and the linker sequence of the DNA forward specific amplification primer or the linker sequence of the DNA reverse specific amplification primer is the same as the sequence of the universal primer.

4. The primer combination according to claim 1 or 2, characterized in that: The universal primers include two universal primers, the linker sequence of the DNA forward specific amplification primer is the same as the sequence of one universal primer; the linker sequence of the DNA reverse specific amplification primer is the same as the sequence of another universal primer; the GSP primer sequence of the DNA forward specific amplification primer is reverse complementary to the DNA template chain sequence, and the GSP primer sequence of the DNA reverse specific amplification primer is the same as the DNA template chain.

5. The primer combination according to any one of claims 1 to 4, characterized in that: The universal sequence is located at the 5' end of the template displacement primer.

6. The primer combination according to any one of claims 1 to 4, characterized in that: The universal sequence is located at the 3' end of the universal primer.

7. The primer combination according to any one of claims 1 to 4, characterized in that: The sequence contained at the 3' end of one primer in the sequencing adapter primer pair is identical to at least a portion of the adapter sequence in the gene-specific primer and is located at the 5' end of the gene-specific primer.

8. The primer combination according to any one of claims 1 to 4, characterized in that: The other primer in the sequencing adapter primer pair comprises at its 3' end a sequence identical to at least a portion of the universal primer, which is located at the 5' end of the universal primer.

9. The primer combination according to any one of claims 1 to 8, characterized in that: The lengths of the first random primer sequence and the second random primer sequence are each independently 6 to 70 nt.

10. The primer combination according to any one of claims 1 to 8, characterized in that: The length of the universal sequence is 20-35 nt, and preferably the universal sequence is as shown in SEQ ID NO.

23.

11. The primer combination according to any one of claims 1 to 8, characterized in that: The length of the universal sequence is 20-35 nt, and preferably the universal sequence is as shown in SEQ ID NO.

24.

12. The primer combination according to any one of claims 1 to 8, characterized in that: The gene-specific primers include a 3' gene-specific primer and / or a 5' gene-specific primer, wherein the 3' gene-specific primer includes a linker sequence and a 3' GSP primer in sequence from the 5' to the 3' end, and the 3' GSP primer is reverse complementary to the 3' driver gene RNA sequence of the gene to be detected; the 5' gene-specific primer includes a linker sequence and a 5' GSP primer of the gene to be detected in sequence from the 5' to the 3' end, and the 5' GSP primer sequence is the same as the 5' driver gene RNA sequence.

13. The primer combination according to any one of claims 1 to 8, characterized in that: The other primer in the sequencing adapter primer pair contains a sequence identical to at least a portion of the universal primer at the 3' end, and the sequence at the 5' end of the identical sequence that is different from the universal sequence of the template displacement primer is the second adapter sequence. Preferably, the length of the second adapter sequence is 0-7 nt.

14. The primer combination according to any one of claims 1 to 8, characterized in that: The two primers in the sequencing adapter primer pair are respectively a P5 sequencing adapter primer and a P7 sequencing adapter primer, wherein the P5 sequencing adapter primer comprises a sequence identical to a part or all of the universal primer at its 3' end, and the P7 sequencing adapter primer comprises a sequence identical to a part or all of the adapter sequence in the gene-specific primer at its 3' end.

15. The primer combination according to any one of claims 1 to 8, characterized in that: A part or all of the adapter sequence of the DNA forward specific amplification primer is identical to the 3' end sequence of the P5 sequencing adapter primer, or the 3' end of the P5 sequencing adapter primer contains a sequence identical to a part or all of the adapter sequence of the DNA forward specific amplification primer; a part or all of the adapter sequence of the DNA reverse specific amplification primer is identical to the 3' end sequence of the P7 sequencing adapter primer, or the 3' end of the P7 sequencing adapter primer contains a sequence identical to a part or all of the adapter sequence of the DNA reverse specific amplification primer.

16. The primer combination according to claim 1, characterized in that: The nucleic acid sequence of the template replacement primer includes the sequence shown in SEQ ID NO.1; Preferably, the nucleic acid sequence of the second random primer includes the sequence shown in SEQ ID NO.2; Preferably, the nucleic acid sequence of the linker sequence includes the sequence shown in SEQ ID NO.3; Preferably, the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.4; Preferably, the nucleic acid sequence of the sequencing adapter primer includes the sequence shown in SEQ ID NO.5 or SEQ ID NO.6; Preferably, the nucleic acid sequence of the other universal primer includes the sequence shown in SEQ ID NO.

3.

17. The primer combination according to claim 1, characterized in that: The nucleic acid sequence of the template replacement primer includes the sequence shown in SEQ ID NO.20; Preferably, the nucleic acid sequence of the second random primer includes the sequence shown in SEQ ID NO.7; Preferably, the nucleic acid sequence of the linker sequence includes the sequence shown in SEQ ID NO.4; Preferably, the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.3; Preferably, the nucleic acid sequence of the sequencing adapter primer includes the sequence shown in SEQ ID NO.5 or SEQ ID NO.6; Preferably, the nucleic acid sequence of the other universal primer includes the sequence shown in SEQ ID NO.

4.

18. Use of the primer combination according to any one of claims 1 to 17 in preparing a product for constructing a detection library for various gene mutation types.

19. A product for constructing a library for detecting multiple gene mutation types, the product comprising the primer or primer combination according to any one of claims 1 to 17 and optionally a reverse transcriptase, dNTP, DNA polymerase and a reaction buffer.

20. A product for detecting multiple types of gene mutations, the product comprising the primer or primer combination according to any one of claims 1 to 17 and optionally reverse transcriptase, dNTP, DNA polymerase and reaction buffer.

21. Use of the primer or primer combination according to any one of claims 1 to 17 in constructing a detection library for multiple gene mutation types.

22. A method for constructing a library for detecting multiple gene mutation types, characterized in that: The method uses a primer or a primer combination according to any one of claims 1 to 17, comprising the following steps: (1) Sample RNA is divided into two parts as templates, one part is subjected to a template displacement reverse transcription reaction using a first random primer and a template displacement primer to obtain a template displacement reverse transcription product; the other part is subjected to a reverse transcription reaction using a second random primer to obtain a reverse transcription product; (2) using the template-displaced reverse transcription product and the reverse transcription product as a template, using gene-specific primers and universal primers, to perform a first amplification reaction to obtain a product of the first amplification reaction; (3) Performing a second amplification reaction on the product of the first amplification reaction using a sequencing adapter primer to obtain a product of the second amplification reaction, which is used to construct a detection library for the multiple gene mutation types.

23. The method according to claim 22, characterized in that The step (2) further comprises using the sample DNA as a template, using a DNA-specific amplification primer pair and a universal primer, to perform a first amplification reaction to obtain a product of the first amplification reaction.

24. The method according to claim 23, characterized in that The universal primer in step (2) is the same universal primer, and preferably the nucleic acid sequence of the universal primer includes the sequence shown in SEQ ID NO.4 or SEQ ID NO.

3.

25. The method according to any one of claims 22 to 24, characterized in that: The step (1) or step (2) further comprises the step of mixing the template conversion reverse transcription product with the reverse transcription product and the DNA template, and combining them with a DNA-specific amplification primer pair and a universal primer in step (2) to carry out a first amplification reaction.

26. The method according to any one of claims 22 to 25, characterized in that: The step (1) also includes the step of purifying the template replacement reverse transcription product and the reverse transcription product.

27. The method according to any one of claims 22 to 26, characterized in that: The step (2) also includes a step of purifying the product of the first amplification reaction.

28. The method according to any one of claims 22 to 27, characterized in that: The step (3) also includes a step of purifying the product of the second amplification reaction.

29. A method for detecting multiple gene mutation types, characterized in that: The method comprises constructing a library using the method described in any one of claims 22 to 28, and sequencing and analyzing the library.

Images