Colorectal cancer biomarker and application thereof

Abstract

The invention discloses a colorectal cancer biomarker which comprises FKBP9 and is used for diagnosis and treatment of colorectal cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and more specifically, to colorectal cancer biomarkers and applications thereof. Background Art

[0002] Colorectal cancer (CRC) is the malignant tumor of the digestive tract with the highest incidence and mortality rate. In 2020, there were approximately 560,000 new patients in my country, resulting in approximately 290,000 deaths. The 5-year survival rate of stage I patients can reach over 90%, while the 5-year survival rate of stage IV patients is only about 10%. The main reasons for the decline in patient survival are: 1) The early symptoms are hidden, so that about 60% of patients are already in the middle and late stages when diagnosed; 2) More than half of the patients will relapse and metastasize during the course of the disease. Therefore, early diagnosis and treatment of CRC, accurate assessment of the risk of recurrence and metastasis, and intervention are key measures to improve patient survival and prognosis.

[0003] Tumor-associated proteins are closely related to the occurrence and development of tumors and have become important detection indicators for early diagnosis and prognosis assessment of tumors. The widely used CRC tumor markers in clinical practice include CEA, CA19-9, CA24-2, CA72-4, etc. However, the sensitivity and specificity of traditional markers are low, resulting in limited clinical application value. Summary of the invention

[0004] In one aspect, the present invention provides colorectal cancer biomarkers for the diagnosis and treatment of colorectal cancer, wherein the biomarkers include FKBP9.

[0005] Among them, FKBP9 is FK506-binding protein 9 (FKBP9).

[0006] In another aspect, the present invention provides a dual-gate multi-channel SiNW-FET biosensor, wherein the biosensor is modified with a biomarker FKBP9 antibody, wherein the biomarker FKBP9 antibody is a specific monoclonal antibody of FKBP9.

[0007] Preferably, the biosensor includes multiple groups of detection channels, the detection channels include a first sub-detection channel and a second sub-detection channel, the first sub-detection channel and the second sub-detection channel are arranged relatively to each other; the first sub-detection channel has a first detection part for detecting a biomarker, the second sub-detection channel has a second detection part for detecting a biomarker, and the first detection part and the second detection part are close to each other.

[0008] Preferably, the first sub-detection channel has a first detection area, a first silicon nanowire, a first source, a first drain and a first gate, the first source, the first drain and the first gate are all coated, and the first detection area is not coated. Preferably, the second sub-detection channel also has a second detection area, a second silicon nanowire, a second source, a second drain and a second gate, the second source, the second drain and the second gate are all coated, and the second detection area is not coated.

[0009] Preferably, the biosensor is modified with antibodies of biomarkers FKBP9, CEA, CA19-9, and CA24-2, wherein the antibodies of biomarkers FKBP9, CEA, CA19-9, and CA24-2 are specific monoclonal antibodies of FKBP9, CEA, CA19-9, and CA24-2, respectively.

[0010] Preferably, the multiple groups of detection channels detect different biomarkers respectively.

[0011] Preferably, the voltages applied to the multiple groups of detection channels are different.

[0012] On the other hand, the above-mentioned colorectal cancer biomarkers and the above-mentioned dual-gate multi-channel SiNW-FET biosensors are used in the diagnosis and treatment of colorectal cancer.

[0013] In summary, the present invention has the following beneficial effects:

[0014] 1. The present invention provides a biomarker FKBP9, which is not only overexpressed in CRC tissues, but also participates in malignant processes such as CRC cell invasion and metastasis, indicating that it is closely related to the occurrence and development of CRC and has the potential to become a CRC tumor marker;

[0015] 2. The dual-gate multi-channel SiNW-FET biosensor of the present invention has higher flexibility and controllability: in a multi-channel silicon nanowire field effect transistor with independent electrodes, the electrodes of each channel are independent, and each channel can be controlled and adjusted separately, providing higher flexibility;

[0016] 3. The present invention has better performance: Since each electrode is independent, the multi-channel silicon nanowire field effect transistor can more effectively avoid signal interference between different channels, thereby improving the overall performance of the circuit; in addition, the independent electrode design also helps to reduce the noise and power consumption of the circuit, and improve the efficiency and stability of the circuit. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is the expression level of FKBP9 gene in CRC tissues;

[0018] The expression level of FKBP9 gene in CRC tissues was significantly upregulated compared with that in adjacent normal colorectal tissues;

[0019] Figure 2 The qPCR results show the expression level of FKBP9 gene in CRC cell lines;

[0020] qPCR results indicated that the expression abundance of FKBP9 gene was high in CRC cell lines (RKO, HT29, HCT116);

[0021] Figure 3 is the expression level of FKBP9 protein in CRC cell lines;

[0022] Compared with normal colon epithelial cells NCM460, FKBP9 protein expression was upregulated in CRC cell lines;

[0023] Figure 4 This is a diagram showing the effect of down-regulating FKBP9 expression on the migration and invasion ability of CRC cells;

[0024] Down-regulating FKBP9 expression can inhibit the migration and invasion ability of CRC cells;

[0025] Figure 5 Flow chart for preparing dual-gate multi-channel SiNW-FET chips;

[0026] Figure 6 Flow chart for SiNW surface functional modification;

[0027] Figure 7 A microfluidic channel mold;

[0028] Figure 8 It is a multi-channel PDMS microfluidic channel;

[0029] Fig. 9 Schematic diagram of sealing of PDMS microfluidic system;

[0030] Fig.10 Schematic diagram of the structure of the dual-gate multi-channel SiNW-FET biosensor;

[0031] Fig.11 for Fig.10 A structural diagram from another perspective;

[0032] Fig.12 for Fig.11 An enlarged schematic diagram of point A;

[0033] Fig.13 The SiNW-FET chip has excellent electrical performance.

[0034] Among them, (A) transfer characteristic curve of SiNW-FET chip; (B) output characteristic curve of SiNW-FET chip

[0035] Fig.14 Combined detection of tumor markers for multi-channel SiNW-FET chips;

[0036] Among them, (A) detects FKBP9; (B) detects CEA; (C) detects CA19-9; (D) detects CA24-2. DETAILED DESCRIPTION

[0037] The above scheme is further described below in conjunction with specific examples. It should be understood that these examples are used to illustrate the present invention and are not limited to the scope of the present invention. The implementation conditions adopted in the examples can be further adjusted according to the conditions of the specific manufacturer, and the implementation conditions not indicated are usually the conditions in conventional experiments.

[0038] This embodiment discloses a SiNW-FET biosensor capable of detecting tumor markers, which has the advantages of high sensitivity, high specificity, label-free and instant response.

[0039] This embodiment discloses a novel CRC tumor marker FKBP9. FKBP9 is highly expressed in multiple organs, and is involved in controlling the release of Ca2+ into the cytoplasm. Its peptidyl prolyl isomerase (PPIase) activity plays an important role in protein folding and transport. FKBP9 can be used as a novel tumor marker for early diagnosis of CRC and assessment of invasion and metastasis.

[0040] Marker screening:

[0041] (I) Methodology used in the screening process of the new tumor marker FKBP9

[0042] 1. Specimen collection

[0043] Tumor tissues and adjacent normal colorectal tissues were collected from 20 CRC patients during surgery, and the collected tissue specimens were placed in cryopreservation tubes and stored in liquid nitrogen tanks. All patients were diagnosed with CRC by pathological examination and had not received radiotherapy or chemotherapy before surgery.

[0044] 2. Screening of differentially expressed genes between CRC tissues and adjacent normal colorectal tissues

[0045] Affymetrix expression microarray technology was used to screen genes with significant differential expression between 20 pairs of CRC tissues and adjacent normal colorectal tissues, with |Fold Change|>1.5 and FDR (false discovery rate)<0.05 as the screening criteria. Total RNA was extracted from 20 pairs of CRC tissues and adjacent normal colorectal tissues using the Agilent RNA 6000 Nano Kit for screening of differentially expressed genes. Affymetrix gene chip hybridization, washing and staining kits were used to perform RNA labeling and hybridization on the Affymetrix gene expression microarray.

[0046] 3. Use real-time quantitative gene amplification fluorescence detection system (qPCR) to detect the expression of FKBP9 gene in CRC cells.

[0047] (1) The reference gene and target gene primers were designed and synthesized by GeneCare Genetics (Shanghai).

[0048] (2) The internal reference gene is GAPDH; the upstream primer sequence is TGACTTCAACAGCGACACCCA; the downstream primer sequence is CACCCTGTTGCTGTAGCCAAA; the amplified fragment size is 121 (bp).

[0049] (3) The target gene is FKBP9; the upstream primer sequence is TGGGGACTTTCTCAGGTATCA; the downstream primer sequence is ACCAATCCTTCGCTTTTC; the amplified fragment size is 174 (bp).

[0050] 4. Use Western blot analysis to detect protein expression in CRC cells.

[0051] (1) Extraction of cell proteins

[0052] 1) The cells were passaged into six-well plates and cultured to 80% density.

[0053] 2) Take out the six-well plate, remove the culture medium, add 1 mL of 10% PBS to each well and rinse twice (inject PBS to adhere to the wall to avoid rinsing the cells), add 120 uL of lysis buffer to each well, and use a cell scraper to remove the cells in the well.

[0054] 3) Transfer the cell lysate containing the cells to a 1.5 mL EP tube using a pipette, place it in an ice box at 4°C for 2 hours, and then centrifuge it at 14,000 rpm for 15 minutes using a low-temperature ultracentrifuge. Transfer the supernatant to a new EP tube and use a protein concentration analyzer to detect the protein concentration in the supernatant.

[0055] 4) Add 5×SDS-PAGE Loading Buffer to 1 / 4 of the supernatant volume, mix well, and boil for 5 minutes to denature the protein. The supernatant can be stored at -20°C until use.

[0056] (2) Glue making

[0057] 1) Clean the glass plate, dry it, and then clamp it, and make a mark 0.5-1cm below the comb.

[0058] 2) Prepare a lower layer of glue of appropriate concentration according to the molecular weight of the protein, pour the lower layer of glue into the splint to the marked position, add 1 mL of isopropanol sealing solution, and let it stand for 30 minutes until the lower layer of glue solidifies.

[0059] 3) Prepare the upper layer of 5% concentrated gel, quickly discard the isopropanol in the lower layer of gel, absorb it with filter paper, quickly add the upper layer of gel until it overflows, insert a comb (to avoid bubbles), add gel, and let it stand for 15 minutes until the upper layer of gel solidifies.

[0060] (3) Electrophoresis

[0061] 1) Prepare 1× electrophoresis fluid.

[0062] 2) Carefully remove the comb, rinse the bubbles and broken glue inside with electrophoresis solution, and fix the splint and electrophoresis device.

[0063] 3) Add electrophoresis solution to the inner tank until it is full, and add half of the solution to the outer tank.

[0064] 4) Add 5uLmark and 20ug sample into the hole formed after the comb is pulled out (avoid bubbles).

[0065] 5) Run the gel to the bottom of the mark. The initial electrophoresis voltage is 60V. After the mark passes through the concentrated gel, the voltage is increased to 160V.

[0066] (4) Transfer

[0067] 1) Cut the PVDF membrane of the same size as the required glue and soak it in anhydrous methanol.

[0068] 2) Place the transfer solution in a plate, and immerse the transfer clips, sponge and four filter papers in it.

[0069] 3) Take out the gel, remove the upper layer of gel and cut it into the required size, separate the gel plate in the transfer solution, place it on the filter paper, cover the gel surface with PVDF membrane, remove bubbles, close the transfer clamp, remove bubbles again, and close the transfer clamp.

[0070] 4) Place the transfer clip into the transfer tank, place in a 4°C refrigerator, and transfer at 250 mA for 2 hours.

[0071] (5) Closed

[0072] 1) Prepare blocking milk: 1.5 g milk powder + 30 mL 1×TBST.

[0073] 2) Remove the membrane and place it in the prepared skim milk at room temperature on a shaker for 2 hours.

[0074] (6) Incubation with primary antibody

[0075] 1) Wash the membrane three times with 1× TBST, 10 min each time.

[0076] 2) Cut the membrane to the required size.

[0077] 3) Incubate with primary antibody: Place the membrane in milk containing primary antibody and shake slowly overnight at 4°C. Primary antibody milk formula (1:1000): 0.05g milk powder + 6mL 1×TBST + 6uL primary antibody.

[0078] 4) Remove the membrane and wash it three times with 1× TBST, each time for 10 min.

[0079] 5) Incubate with secondary antibody: Place the membrane in milk containing secondary antibody and shake slowly for 1 hour at room temperature. Secondary antibody milk formula (1:2000): 0.05g milk powder + 6mL 1×TBST + 3uL secondary antibody.

[0080] 6) Remove the membrane and wash it three times with 1× TBST, each time for 10 min.

[0081] (7) Exposure and imaging

[0082] 1) Prepare chemiluminescent developer.

[0083] 2) Place the membrane on the inner plate of the luminescence imaging instrument and drop the developer evenly on the membrane.

[0084] 3) Use the luminescence imaging system software to expose, capture, and save images.

[0085] (8) Western blot analysis

[0086] ImageJ software was used to analyze the grayscale of protein blot bands.

[0087] 5. Lentivirus transfection and stable transfection cell line screening

[0088] (1) The shRNA sequence (shFKBP9) used to silence the FKBP9 gene in CRC cells and the negative control sequence shRNA (shCtrl) were synthesized by GeneCare Gene Co., Ltd. (Shanghai). The shFKBP9 vector sequence is as follows: 5′-GCTGAGTAAGAAGGGAGATTA-3′ (target number: psc53537). The corresponding lentiviral expression plasmid and lentiviral packaging plasmid were purchased from the company, and the lentiviral expression plasmid contained a green fluorescent expression sequence and a puromycin resistance gene sequence.

[0089] (2) Lentivirus transfection and stable transfection cell line screening steps:

[0090] The lentiviral expression plasmid and lentiviral packaging plasmid were co-transfected into 293T cells using Lipofectamine 2000. After 72 h, the cell supernatant containing lentiviral particles was collected and concentrated and purified lentiviral particles were obtained by ultracentrifugation.

[0091] Concentrated and purified lentiviral particles were added to CRC cell lines HCT116 and RKO cells at an MOI value of 10.

[0092] 3) After 12 hours, observe the cell status and replace the culture medium.

[0093] 4) After 72 hours, observe the green fluorescence expression under a fluorescence microscope to preliminarily judge the virus transfection efficiency. If the green fluorescence rate exceeds 70%, continue to culture the cells until the cell confluence reaches 80-90%, and then collect the cells for subsequent experiments.

[0094] Puromycin at a concentration of 0.2ug / ml was used to screen the infected cell lines to obtain stable expression cell lines.

[0095] 6. Transwell assay was used to evaluate tumor invasion / migration ability.

[0096] (1) The Transwell assay was used to evaluate the migration and invasion ability of CRC cells.

[0097] 1) Place the 8um pore chamber in a 24-well cell culture plate, add 300uL serum-free DMEM high-glucose medium containing 2×105 cells to the upper chamber, and add 0.5mL DMEM high-glucose medium containing 10% FBS to the 24-well plate (lower chamber) and place in an incubator for 48h. The difference between the Transwell invasion assay and the Transwell migration assay is that the upper chamber needs to be pre-treated with a total of about 40ul of diluted matrix gel (matrix gel: serum-free DMEM high-glucose medium = 1:5 mix) evenly spread in the upper chamber, and the rest of the steps are the same as the Transwell migration assay.

[0098] 2) After 48 hours, take out the chamber and use a cotton swab to remove the culture medium and cells in the upper chamber. The cells attached under the membrane are the cells that have successfully migrated and invaded.

[0099] 3) Fix the cells on the outer membrane surface with 4% paraformaldehyde solution for 30 minutes and then stain with crystal violet for 30 minutes.

[0100] 4) After drying, count the cells that have successfully migrated and invaded under an optical microscope.

[0101] (II) Research results during FKBP9 screening

[0102] 1. The expression level of FKBP9 gene in CRC tissue was significantly upregulated compared with that in adjacent normal colorectal tissue.

[0103] A total of 1971 significantly differentially expressed genes were screened using Affymetrix expression profile chip technology, of which 1414 genes were significantly upregulated and 557 genes were significantly downregulated. Figure 1 As shown in the figure, the expression level of FKBP9 in CRC tissues was significantly higher than that in adjacent normal colorectal tissues, and the fold change of gene expression between the two groups of samples was approximately equal to 3.0.

[0104] 2. qPCR results suggested that the expression abundance of FKBP9 gene was high in CRC cell lines (RKO, HT29, HCT116).

[0105] qPCR detection data, ΔCt = Ct value of target gene - Ct value of reference gene.

[0106] Ct: Cycle threshold, threshold cycle number. qPCR results suggest that the expression abundance of FKBP9 gene in CRC cell lines (RKO, HT29, HCT116) is high. Figure 2 shown.

[0107]

[0108] 3. Compared with normal colon epithelial cells NCM460, FKBP9 protein expression was upregulated in CRC cell lines.

[0109] like Figure 3 As shown, Western blot was used to detect the expression of FKBP9 in three types of human CRC cell lines (RKO, HT29, HCT116) and the normal colon epithelial cell line NCM460. The results showed that compared with NCM460, FKBP9 was upregulated in the three CRC cell lines and was relatively highly expressed in HCT116 cells.

[0110] 4. Down-regulating FKBP9 expression can inhibit CRC cell migration and invasion

[0111] like Figure 4 As shown in the figure, the FKBP9 gene in HCT116 cells was knocked down by lentiviral transfection technology to reduce the expression level of FKBP9 protein. The results of Transwell migration and invasion experiments showed that compared with the shCtrl group (control group), the number of cells penetrating the chamber membrane in the shFKBP9 group (FKBP9 knockdown group) was significantly reduced, and the difference was statistically significant (P<0.05), that is, downregulation of FKBP9 expression can inhibit the migration and invasion ability of CRC cells. The experimental results show that FKBP9 expression has a positive effect on the migration and invasion ability of CRC cells, and it plays a promoting role in the progression of colorectal cancer.

[0112] SiNW-FET Biosensors:

[0113] SiNW-FET biosensor and detection principle: SiNW-FET is a voltage-controlled semiconductor device. The electric field effect formed by the gate voltage VG will cause the carrier density inside the SiNW to change, thereby adjusting the conductivity of the SiNW. Modifying specific probe molecules on the surface of SiNW can make SiNW-FET a biosensor for detecting target molecules. When the probe molecules specifically capture the target molecules, the electric field effect generated by the charged target molecules will cause the conductivity and current of the SiNW to change, and the current change is linearly related to the concentration of the target molecules within a certain range, which can achieve qualitative and quantitative detection.

[0114] 1. Fabrication of dual-gate multi-channel SiNW-FET devices (such as Figure 5 (shown)

[0115] Take the production of two channels as an example, the details are as follows:

[0116] (1) Thinning the top silicon layer of the SOI wafer. The top silicon layer of the 6-inch p-type SOI wafer is thinned to 30nm using thermal oxidation and BOE etching;

[0117] (2) SiNW preparation. Use a stepper lithography machine to form SiNW (500 nm in width and 30 nm in height), electrodes, and circuits, and then use RIE etching to form raised SiNWs.

[0118] (3) Preparation of the top gate insulating layer. A SiO2 insulating layer with a thickness of about 50 nm is deposited on a specific area using photolithography and inductively coupled plasma chemical vapor deposition (ICPCVD);

[0119] (4) Electrode preparation (top gate, source, drain and back gate). Use photolithography and physical vapor deposition (PVD) to plate a Ti / Au electrode layer (5nm / 100nm) on the front SiNW outer pattern area; plate a Ti / Au / Ti electrode layer (5nm / 100nm / 5nm) on the back;

[0120] (5) Forming good ohmic contact between the metal electrode and Si. The wafer is rapidly heated to 300°C in a rapid annealing furnace, maintained for 10 seconds, and then cooled at a rate of 10°C / s.

[0121] (6) Preparation of passivation layer. A SiO2 / SiNx passivation layer (100nm / 160nm) is plated on the front side of the wafer except for the detection area using UV photolithography and ICPCVD.

[0122] (7) Device electrical performance testing: Use Agilent B1500A semiconductor analyzer to measure the device transfer / output curve and select devices with excellent performance and high consistency.

[0123] 2. Modification of silicon nanowire surface with tumor-related protein antibodies

[0124] like Figure 6 As shown, SiNW surface functional modification:

[0125] (1) Connecting hydroxyl groups. Use acetone, anhydrous ethanol, and deionized water to clean the SiNW-FET chip in sequence, 10 min / time; after drying with a nitrogen gun, place the chip in oxygen plasma for 5 min to form a layer of hydroxyl groups on the chip surface;

[0126] (2) Connecting to amino groups. Soak the chip in a 2% APTES ethanol solution for 45 minutes. The oxyethyl groups of APTES will bind to the hydroxyl groups on the chip surface, thereby connecting to the amino groups contained in APTES. After taking out the chip, place it on a shaker and wash it three times with anhydrous ethanol, five minutes each time. Then place the chip on a heating plate and heat it at 120°C for 1 hour to evaporate the unbound APTES.

[0127] (3) Connecting aldehyde groups. Use alkaline deionized water to prepare a 2.5% glutaraldehyde solution (use solid sodium hydroxide to alkalize the deionized water to a pH of 8-9), place the chip in the 2.5% glutaraldehyde solution and continue on a shaker for 1 hour. During this process, the glutaraldehyde group will bind to the APTES amino group. After removing the chip, place it on a shaker and wash it three times with deionized water, 5 minutes each time, and blow dry;

[0128] (4) Connecting monoclonal antibodies. Dilute 1×PBS solution 100 times with deionized water to obtain 0.01×PBS solution, add NaOH to form a weak alkaline liquid (PH = 8-9), and use the above weak alkaline liquid to dilute the monoclonal antibody to 100ug / ml. Place the chip in a clean culture dish, use a pipette to drop 10-20ul of the diluted monoclonal antibody solution onto the SiNW detection area, and drop a drop of diluted PBS around the silicon chip to prevent the SiNW detection area from drying. Store at 4°C for 4 hours for SiNW antibody modification.

[0129] 3. Fabrication and sealing of multi-channel PDMS microfluidic system

[0130] like Figures 7 to 9 As shown, the fabrication and sealing of the multi-channel PDMS microfluidic system:

[0131] (1) Fabrication of multi-channel PDMS microfluidic system.

[0132] ①Use photolithography and deep silicon etching to make pure silicon microfluidic channel molds;

[0133] ② Place the cleaned mold neatly in a glass dish, prepare PDMS prepolymer and polymerization initiator in a mass ratio of 10:1, mix thoroughly with a glass rod, then slowly pour it onto the microfluidic channel mold and place it in a vacuum tank to remove bubbles;

[0134] ③ After no bubbles are generated, place the glass dish in a 75℃ oven and dry for 40 minutes;

[0135] ④ Separate the solidified PDMS microchannel from the mold and use a puncher to punch holes to obtain liquid inlet and outlet channels; ⑤ After the microchannel is made, place the middle channel system in a 10% BSA solution and immerse it in a closed solution.

[0136] (2) Sealing of PDMS microfluidic system.

[0137] ① Before SiNW surface modification, reversible sealing technology is used to complete the sealing of microchannels and device surfaces, and the PDMS is pressurized and sealed during high-temperature semi-molding to improve the reversible sealing firmness, so that the sealing firmness and airtightness meet the needs of modification;

[0138] ② Irreversible sealing is used to complete the assembly of the final microfluidic system during testing. Since the sensors are mainly used for clinical testing, the sensors used are all finished and the requirements for repeated use of the sensors are relatively low, and more attention is paid to the stability of the detection device and the firmness of the sealing. This firm sealing method meets our testing requirements.

[0139] like Figures 10-12As shown, the dual-gate multi-channel SiNW-FET biosensor 1 prepared above includes a back gate 20, a silicon-based substrate 21, and multiple groups of detection channels. Specifically, the multiple groups of detection channels include a first group of detection channels 2, a second group of detection channels 3, a third group of detection channels 4, and a fourth group of detection channels 5.

[0140] Among them, any one detection channel includes a first sub-detection channel 6 and a second sub-detection channel 7, and the first sub-detection channel 6 and the second sub-detection channel 7 are arranged opposite to each other; the first sub-detection channel 6 has a first detection part 16 for detecting biomarkers, and the second sub-detection channel 7 has a second detection part 17 for detecting biomarkers, and the first detection part 16 and the second detection part 17 are close to each other; the first detection part 16 has a first detection area 8 and a first silicon nanowire 18; the second detection part 17 has a second detection area 9 and a second silicon nanowire 19.

[0141] The biosensor has multiple groups of detection channels, each of which can be individually controlled and adjusted, providing greater flexibility; in addition, during actual detection, the added monoclonal antibody solution can flow to the first detection part and the second detection part at the same time, and the first detection part and the second detection part can respectively obtain current data. When there is no obvious difference between the two groups of data, it can be judged that the detection result is reliable.

[0142] The first sub-detection channel 6 has a first detection area 8, a first silicon nanowire 18, a first source 10, a first drain 11 and a first gate 12. The first source 10, the first drain 11 and the first gate 12 are all coated, and the first detection area 8 is not coated. The first source 10, the first drain 11 and the first gate 12 are covered with a coating to play an insulating role, and only the first detection area 8 where the nanowire is located is not coated, so as to avoid interference of the liquid to be detected on the circuit, which is conducive to the stability and reliability of the detection current.

[0143] The second sub-detection channel 7 has a second detection area 9, a second silicon nanowire 19, a second source 13, a second drain 14 and a second gate 15. The second source 13, the second drain 14 and the second gate 15 are all coated, and the second detection area 9 is not coated; the second source 13, the second drain 14 and the second gate 15 are covered with a coating to play an insulating role, and only the second detection area 9 where the nanowire is located is not coated, thereby avoiding interference of the liquid to be detected on the circuit, which is helpful to detect the stability and reliability of the current.

[0144] During actual detection, the liquid to be detected is dripped into the first detection area 8 of the first detection part 16 , and the liquid to be detected dripped into the first detection area 8 will flow to the second detection area 9 of the second detection part 17 at the same time.

[0145] The first detection part and the second detection part are close to each other, and when the monoclonal antibody solution is added, the first detection area and the second detection area can be covered at the same time, so that the first nanowire and the second nanowire are modified with antibodies at the same time. When the liquid to be tested is passed through the PDMS microchannel, the monoclonal antibodies modified on the surface of the first nanowire and the second nanowire can specifically bind to the antigen in the liquid to be tested. The first and second groups of electrodes can both monitor the current after being energized. Because the first and second detection channels are modified with antibodies and the liquid to be tested is passed at the same time, two sets of current data can be obtained after power is turned on. When there is no obvious difference in the analysis of the two sets of data, it can be judged that the detection result is reliable.

[0146] The biosensor was modified with biomarkers FKBP9, CEA, CA19-9, CA24-2.

[0147] Multiple groups of detection channels detect different biomarkers respectively. Exemplarily, the first group of detection channels 2 is modified with biomarker FKBP9 for detecting biomarker FKBP9; the second group of detection channels 3 is modified with biomarker CEA for detecting biomarker CEA; the third group of detection channels 4 is modified with biomarker CA19-9 for detecting biomarker CA19-9; the fourth group of detection channels 5 is modified with biomarker CA24-2 for detecting biomarker CA24-2. Tumor marker detection is often used for early diagnosis of CRC. The sensitivity of single tumor marker detection is low, and combined detection of tumor markers can improve the early detection rate of CRC. Combined detection of the newly discovered tumor marker FKBP9 with the currently commonly used CRC tumor markers CEA, CA19-9, and CA24-2 can improve the sensitivity of detection and contribute to early screening of CRC.

[0148] The voltages applied to multiple detection channels are different. During actual detection, the voltage can be adjusted as needed.

[0149] The above-mentioned dual-gate multi-channel SiNW-FET biosensor is used in the diagnosis and treatment of colorectal cancer.

[0150] In the prior art, multi-channel silicon nanowire field effect transistors with shared gate and drain electrodes are relatively simple in voltage control and can only be adjusted synchronously, but cannot control each detection channel individually. Dual-gate multi-channel SiNW-FET biosensors have higher flexibility and controllability: in multi-channel silicon nanowire field effect transistors with independent electrodes, the electrodes of each channel are independent, and each channel can be controlled and adjusted individually, providing higher flexibility.

[0151] Biosensors have better performance: Since each electrode is independent, multi-channel silicon nanowire field-effect transistors can more effectively avoid signal interference between different channels, thereby improving the overall performance of the circuit. In addition, the independent electrode design also helps to reduce circuit noise and power consumption, and improve circuit efficiency and stability.

[0152] 4. Combined detection of colorectal cancer-related proteins

[0153] like Figures 13-14 As shown, combined detection of colorectal cancer tumor-related proteins:

[0154] (1) The silicon nanobiosensor detection system was connected to an Agilent B1500A semiconductor analyzer. The probes of the semiconductor analyzer were connected to the source, drain, top gate, and back gate, respectively. The top gate voltage (V TG ), source-drain voltage (V DS ) and back gate voltage (V BG ), the voltage is adjusted according to the charge characteristics of the tumor marker and the output / transfer curve of the SiNW-FET, making the SiNW-FET biosensor have a higher detection sensitivity.

[0155] (2) About 300 μL of 0.01× PBS solution containing 0.5 mg / mL bovine serum albumin (BSA) was pumped into the detection system (80 μL / min) to block the nonspecific protein adsorption sites on the surface of the PDMS microchannel and obtain a stable baseline current (I0);

[0156] (3) Then, a 0.01× PBS solution containing tumor markers was slowly pumped into the detection channel modified with the corresponding monoclonal antibody at 80 μL / min, and the source-drain current (I DS ) and current change (ΔI), and then pump in gradient concentration tumor marker solutions for detection;

[0157] (4) Switch the probe to the electrode of other detection channels, set the applied voltage, and pump other tumor marker solutions to be detected into the detection channels modified with corresponding monoclonal antibodies according to steps (2) and (3). Each group of detection channels detects one tumor marker respectively, thereby achieving the combined detection of multiple tumor markers.

[0158] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. A colorectal cancer biomarker, characterized in that: For the diagnosis and treatment of colorectal cancer, the biomarkers include FKBP9.

2. Dual-gate multi-channel SiNW-FET biosensor, characterized in that: The biosensor is modified with an antibody against the biomarker FKBP9.

3. The dual-gate multi-channel SiNW-FET biosensor according to claim 2, characterized in that: The biosensor comprises a plurality of detection channels, wherein the detection channels comprise a first sub-detection channel (6) and a second sub-detection channel (7), wherein the first sub-detection channel (6) and the second sub-detection channel (7) are arranged opposite to each other; the first sub-detection channel (6) has a first detection portion (16) for detecting a biomarker, and the second sub-detection channel (7) has a second detection portion (17) for detecting a biomarker, and the first detection portion (16) and the second detection portion (17) are close to each other.

4. The dual-gate multi-channel SiNW-FET biosensor according to claim 3, characterized in that: The first sub-detection channel (6) comprises a first detection area (8), a first silicon nanowire (18), a first source (10), a first drain (11) and a first gate (12); the first source (10), the first drain (11) and the first gate (12) are all coated, and the first detection area (8) is not coated.

5. The dual-gate multi-channel SiNW-FET biosensor according to claim 4, characterized in that: The second sub-detection channel (7) comprises a second detection area (9), a second silicon nanowire (19), a second source electrode (13), a second drain electrode (14) and a second gate electrode (15); the second source electrode (13), the second drain electrode (14) and the second gate electrode (15) are all coated, and the second detection area (9) is not coated.

6. The dual-gate multi-channel SiNW-FET biosensor according to claim 5, characterized in that: The biosensor is modified with antibodies of biomarkers FKBP9, CEA, CA19-9, and CA24-2.

7. The dual-gate multi-channel SiNW-FET biosensor according to claim 6, characterized in that: The multiple groups of detection channels detect different biomarkers respectively.

8. The dual-gate multi-channel SiNW-FET biosensor according to claim 7, characterized in that: The voltages applied to the multiple groups of detection channels are different.

9. Use of the colorectal cancer biomarker of claim 1 and the dual-gate multi-channel SiNW-FET biosensor of claims 2 to 8 in the diagnosis and treatment of colorectal cancer.

Images