Ketoalkyd reductoisomerase variant and method for producing L-valine using same

Abstract

The present application relates to ketol reductoisomerase variants, polynucleotides encoding the variants of the present disclosure, L-valine-producing microorganisms comprising the ketol reductoisomerase variants of the present disclosure or the polynucleotides encoding the variants, and methods of producing L-valine using the microorganisms of the present disclosure.

Description

Technical Field

[0001] The present disclosure relates to ketol-acid reductoisomerase variants, polynucleotides encoding the variants of the present disclosure, microorganisms producing L-valine comprising the ketol-acid reductoisomerase variants of the present disclosure or polynucleotides encoding the variants, and methods for producing L-valine using the microorganisms of the present disclosure. Background Art

[0002] L-amino acids are the basic building blocks of proteins and are used as important materials for pharmaceutical raw materials, food additives, animal feed, nutritional supplements, pesticides, fungicides, etc. In particular, branched-chain amino acids (BCAA) are a general term that refers to L-valine, L-leucine, and L-isoleucine, which are essential amino acids. These BCAAs have antioxidant effects and promote protein synthesis in muscle cells.

[0003] It is known that the production of BCAA using microorganisms is mainly performed by microorganisms of the genus Corynebacterium and is biosynthesized from pyruvate through several steps [APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2010, p. 8053-8061]. Summary of the invention

[0004] [Technical issues]

[0005] The problem with producing BCAAs via microorganisms is that they are not easy to produce in large quantities on an industrial scale.

[0006] [Technical solution]

[0007] One object of the present disclosure is to provide a ketol-acid reductoisomerase variant, wherein the amino acid at position 87 in the amino acid sequence corresponding to SEQ ID NO: 1 is substituted with valine (V) or aspartic acid (D).

[0008] Another object of the present disclosure is to provide polynucleotides encoding the variants of the present disclosure.

[0009] Yet another object of the present disclosure is to provide a microorganism comprising a variant of the present disclosure or a polynucleotide encoding a variant of the present disclosure.

[0010] Another object of the present disclosure is to provide a method for producing L-valine, comprising culturing the microorganism of the present disclosure in a culture medium.

[0011] Still another object of the present disclosure is to provide a composition for producing L-valine, comprising: the microorganism of the present disclosure; a culture medium for culturing the microorganism; or a combination of two or more thereof.

[0012] [Beneficial Effects]

[0013] High yield production of L-valine can be achieved by using the variants of the present disclosure. DETAILED DESCRIPTION

[0014] The present disclosure will be described in detail below. Meanwhile, each description and embodiment disclosed in the present disclosure may also be applied to other descriptions and embodiments. That is to say, all combinations of the various elements disclosed in the present disclosure fall within the scope of the present disclosure. In addition, the scope of the present disclosure is not limited by the specific description described below. In addition, many papers and patent documents are referenced and cited throughout the specification. The disclosures of the cited papers and patent documents are incorporated herein by reference as a whole to further illustrate the level and scope of the subject matter to which the present disclosure belongs.

[0015] One aspect of the present disclosure provides a ketol-acid reductoisomerase variant comprising a substitution of the amino acid corresponding to position 87 of SEQ ID NO: 1 with another amino acid.

[0016] As used herein, the term "ketol-acid reductoisomerase variant" refers to any polypeptide having ketol-acid reductoisomerase activity or a variant of ketol-acid reductoisomerase comprising replacing the amino acid corresponding to position 87 from the N-terminus in SEQ ID NO: 1 with another amino acid.

[0017] The variants of the present disclosure may also be described as "ketol-acid reductoisomerase variants", "(modified) polypeptides having ketol-acid reductoisomerase activity" or "IlvC variants".

[0018] As used herein, the term "ketol-acid reductoisomerase" refers to an enzyme also known as "acetohydroxyacid isomeroreductase", "KARI" and "AHAIR", which is an enzyme involved in the biosynthesis of L-branched-chain amino acids. The ketol-acid reductoisomerase can be classified as EC 1.1.1.86.

[0019] When examining the biosynthetic pathway of L-branched-chain amino acids, it can be seen that acetohydroxyacid synthase first catalyzes the decarboxylation reaction of pyruvate and the condensation reaction with another pyruvate molecule to produce acetolactate, which is a precursor of valine, or catalyzes the decarboxylation reaction of pyruvate and the condensation reaction with 2-ketobutyrate to produce acetohydroxybutyrate, which is a precursor of isoleucine. Ketoacid reductoisomerase then uses the acetolactate or acetylhydroxybutyrate thus produced as a substrate to proceed with a reaction capable of producing L-valine, L-leucine, and L-isoleucine.

[0020] Specifically, ketol-acid reductoisomerase can convert 2-acetyl-2-hydroxybutyrate into 2,3-dihydroxy-3-methylvaleric acid, or convert 2-acetolactate into 2,3-dihydroxyisovaleric acid.

[0021] When 2,3-dihydroxy-3-methylvaleric acid undergoes a reaction catalyzed by dihydroxy acid dehydratase and transaminase B, L-isoleucine is produced. When 2,3-dihydroxyisovaleric acid undergoes a reaction mediated by dihydroxy acid dehydratase, 2-ketoisovaleric acid is produced. 2-Ketoisovaleric acid can be converted to L-valine by transaminase B, or to 2-ketoisocaproic acid, which can then be converted to L-leucine by enzymatic conversion. Therefore, keto-acid reductoisomerase is an important enzyme for the production of branched-chain amino acids including L-valine, L-leucine and L-isoleucine.

[0022] The amino acid sequence of the ketol-acid reductoisomerase disclosed herein may be an amino acid sequence encoded by the ilvC gene, also referred to as "IlvC protein". The amino acid sequence of the ketol-acid reductoisomerase disclosed herein may be obtained from GenBank of NCBI, which is a known database. The ketol-acid reductoisomerase may be a protein comprising the amino acid sequence of SEQ ID NO: 1, but is not limited thereto. In another embodiment, the ketol-acid reductoisomerase may be derived from a microorganism of the genus Corynebacterium, such as Corynebacterium glutamicum. Examples may include, but are not limited to, WP_003854117.1, 6JX2_A, HJE10081.1, WP_059289140.1, WP_060564426.1, WP_006286981.1, WP_096455581.1, WP_066565326.1, WP_015651057.1, WP_053544709.1, WP_006769331.1, BAC18177.1, WP_156227806.1, WP_191733749.1, WP_042621277.1, WP_126119396.1, NLZ56857.1, or WP_015400720.1. Sequences having the same keto-acid reductoisomerase activity as these amino acid sequences may be included without limitation.

[0023] In a specific embodiment, the ketol-acid reductoisomerase of the present disclosure may be a protein comprising the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or higher, or 99% or higher homology or identity thereto. In addition, it is obvious that a protein having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted or added is also included in the scope of the variable protein described in the present disclosure as long as the amino acid sequence has such homology or identity and exhibits the efficacy corresponding to the above-mentioned protein.

[0024] In addition, in one embodiment, the modified ketol-acid reductoisomerase of the present disclosure is defined as a protein comprising the amino acid sequence of SEQ ID NO: 1, but does not exclude the addition of nonsense sequences, naturally occurring mutations, or silent mutations thereof before or after the amino acid sequence of SEQ ID NO: 1. In addition, assuming that the protein exhibits the same or corresponding activity as the protein consisting of the amino acid sequence of SEQ ID NO: 1, it is obvious to those skilled in the art that the protein corresponds to the ketol-acid reductoisomerase of the present disclosure.

[0025] That is, even if the present disclosure discloses "a protein or polypeptide having an amino acid sequence disclosed by a specific SEQ ID NO" or "a protein or polypeptide comprising an amino acid sequence disclosed by a specific SEQ ID NO", it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added can also be used in the present disclosure, as long as the protein exhibits the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding SEQ ID NO.

[0026] As used herein, the term "homology" or "identity" refers to the degree of similarity between two given amino acid sequences or nucleotide sequences, which can be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.

[0027] The sequence homology or identity of conservative polynucleotide or polypeptide is determined by standard comparison algorithm, and the default gap penalty set up by the software used can be used together. Basically, homology or identical sequence can hybridize with complete sequence or its part under medium or high stringency condition usually.Obviously, hybridization also comprises the hybridization between the polynucleotide containing general codon or the codon considering codon degeneracy.

[0028] Whether any two polynucleotide or polypeptide sequences exhibit homology, similarity or identity can be determined using, for example, known computer algorithms, such as the "FASTA" program, using default parameters as in Pearson et al. (1988) [Proc. Natl. Acad. Sci. USA 85]:2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) can be used to determine, such as the Needleman program (version 5.0.0 or higher) in the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (examples include the GCG program package (Devereux, J., et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN and FASTA (Atschul, SF, et al., J Molec Biol 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994 and [CARILLO et al.] (1988) SIAM For example, the sequence homology, similarity or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information (NCBI).

[0029] Homology, similarity or identity of polynucleotides or polypeptides can be determined by comparing sequence information using, for example, the GAP computer program, as in Needleman et al. (1970), J Mol Biol. 48:443, for example, as described in Smith and Waterman, Advanced Applied Mathematics (1981) 2:482. In summary, the GAP program defines homology, similarity or identity of polynucleotides or polypeptides as the ratio of the number of similar aligned symbols (i.e., nucleotides or amino acids) to the total number of symbols in the shorter sequence of the two sequences. The default parameters of the GAP program may include: (1) a unary alignment matrix (containing a value of 1 for identity and a value of 0 for non-identity), and a weighted alignment matrix from Gribskov et al. (1986), Nucl. Acids Res. 14:6745 as disclosed in Schwartz and Dayhoff, ed., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353–358 (1979) (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a penalty of 10 for the start of a gap and a penalty of 0.5 for the extension of a gap); and (3) no penalty for end gaps. Thus, the terms "homology" or "identity" as used in the present disclosure indicate the relatedness between sequences.

[0030] As used herein, the term "variant" or "modified polypeptide" refers to a protein in which one or more amino acids differ from the sequence by conservative substitutions and / or modifications while retaining the function or properties of the sequence.

[0031] Such variants differ from the identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one or more amino acids in the protein amino acid sequence and evaluating the characteristics of the modified protein. That is, the ability of the variant can be increased, maintained unchanged or reduced compared to the native protein. In addition, some variants may include a modified polypeptide in which one or more parts (e.g., an N-terminal leader sequence or a transmembrane domain) are removed. Other variants may include variants of the mature protein in which a portion is removed from the N- and / or C-terminus. The term "variant" or "modified polypeptide" may be used interchangeably with terms such as modification, modified protein, mutant, mutant protein, variant and variant, but is not limited thereto, as long as the term is used to represent a mutation.

[0032] As used herein, the term "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structure and / or chemical properties. Generally, conservative substitutions have little or no effect on the activity of the resulting polypeptide.

[0033] The variant may still possess one or more biological activities while having, for example, one or more conservative substitutions. Such amino acid substitutions are generally made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the amphipathic nature of the residues.

[0034] As an example of such classification, amino acids can be classified as: positively charged amino acids (basic), including arginine, lysine, and histidine; negatively charged amino acids (acidic), including glutamic acid and aspartic acid; amino acids with non-polar side chains (non-polar amino acids), including glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; and amino acids with polar or hydrophilic side chains (polar amino acids), including serine, threonine, cysteine, tyrosine, asparagine, and glutamine. In another embodiment, amino acids can be classified as charged amino acids, including arginine, lysine, histidine, glutamic acid, and aspartic acid; or uncharged amino acids (also called neutral amino acids), including glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. In another embodiment, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. In another embodiment, valine, leucine and isoleucine can be classified as branched chain amino acids. In another embodiment, the 20 amino acids can be divided into 5 groups according to size, in the order of relatively smaller amino acid groups: glycine, alanine and serine; cysteine, proline, threonine, aspartic acid and asparagine; valine, histidine, glutamic acid and glutamine; isoleucine, leucine, methionine, lysine and arginine; and phenylalanine, tryptophan and tyrosine, but not limited thereto.

[0035] In addition, variants may include deletions or additions of amino acids that have minimal effects on the properties and secondary structure of the polypeptide. For example, the polypeptide may be co-translationally or post-translationally bound to a signal (or leader) sequence at the N-terminus of a protein involved in protein transfer. In addition, the polypeptide may be conjugated to another sequence or linker for identification, purification or synthesis of the polypeptide.

[0036] In one embodiment, the variant disclosed herein may be a ketol-acid reductoisomerase variant in which the amino acid at position 87 corresponding to the N-terminus of SEQ ID NO: 1 is substituted with a different amino acid, or a modified polypeptide having ketol-acid reductoisomerase activity in the aforementioned ketol-acid reductoisomerase.

[0037] In any of the foregoing embodiments, the variant is capable of increasing the production of L-valine compared to the protein before modification, the wild-type protein, the native polypeptide or the unmodified polypeptide.

[0038] As used herein, "replacement with another amino acid" is not limited as long as the amino acid is different from the amino acid before replacement. At the same time, it is obvious that when it is stated in the present disclosure that "a specific amino acid is replaced", the amino acid is replaced with an amino acid different from the amino acid before replacement, even if it is not specifically stated that the amino acid is replaced with a different amino acid.

[0039] In any of the foregoing embodiments, the "another amino acid" may be any amino acid except glutamine (Q). Specifically, the another amino acid may be any one selected from glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, aspartic acid, glutamic acid, lysine, arginine and histidine.

[0040] In any of the foregoing embodiments, the variant may be a keto-acid reductoisomerase variant, wherein the amino acid at position 87 of the amino acid sequence corresponding to SEQ ID NO: 1 is substituted with valine (V) or aspartic acid (D).

[0041] As used herein, the term "position N" may include position N and the amino acid position corresponding to position N. For example, it may include the amino acid position corresponding to any amino acid residue in the mature polypeptide disclosed in the specific amino acid sequence. The specific amino acid sequence may be the amino acid sequence of SEQ ID NO: 1.

[0042] As used herein, the term "corresponding to" refers to an amino acid residue at a listed position in a polypeptide, or an amino acid residue that is similar, identical, or homologous to a listed residue in a polypeptide. Identification of the corresponding position amino acid can be by reference to a specific sequence to determine the specific amino acid in the sequence. The term "corresponding region" as used in this disclosure generally refers to a similar or corresponding position in a related protein or a reference protein.

[0043] In the present disclosure, specific numbering may be used for amino acid residue positions within proteins used in the present disclosure. For example, by comparing the polypeptide sequences of the target protein to be compared with the protein of the present disclosure, the positions corresponding to the amino acid residue positions in the protein of the present disclosure may be renumbered.

[0044] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1. For example, a sequence alignment algorithm as disclosed in the present disclosure can determine the position of an amino acid or the position at which a modification such as a substitution, insertion or deletion occurs by comparison with a query sequence (also referred to as a "reference sequence").

[0045] In such an alignment, algorithms such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), etc. can be used, but are not limited to these, and other sequence alignment programs known in the art, pairwise sequence comparison algorithms, etc. can be appropriately used.

[0046] In one embodiment, the ketol-acid reductoisomerase variant of the present disclosure may be a variant comprising a sequence in which the amino acid corresponding to position 87 of SEQ ID NO: 1 is substituted with valine (V) or aspartic acid (D), and has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity with SEQ ID NO: 1. The ketol-acid reductoisomerase variant may be a variant having less than 100% homology or identity with SEQ ID NO: 1.

[0047] In any of the foregoing embodiments, the ketol-acid reductoisomerase variant of the present disclosure can be a polypeptide in which the amino acid corresponding to position 87 of SEQ ID NO: 1 is substituted with valine (V) or aspartic acid (D), which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity with SEQ ID NO: 1, and which has ketol-acid reductoisomerase activity.

[0048] In any of the foregoing embodiments, the ketol-acid reductoisomerase variant of the present disclosure can be a polypeptide wherein the amino acid corresponding to position 87 of SEQ ID NO: 1 is valine (V) or aspartic acid (D), which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity to SEQ ID NO: 1, and which has ketol-acid reductoisomerase activity.

[0049] Furthermore, it is obvious that variants having an amino acid sequence in which a part of the sequence has a deletion, modification, substitution, conservative substitution or addition are also included in the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits an effect corresponding to that of the variant of the present disclosure.

[0050] In any of the foregoing embodiments, the variant of the present disclosure may have, comprise, or consist essentially of the amino acid sequence disclosed as SEQ ID NO:3 or SEQ ID NO:25.

[0051] Even if disclosed in the present disclosure as “a protein having an amino acid sequence disclosed as a specific SEQ ID NO”, it is obvious that a protein having an amino acid sequence in which a part of the sequence has a deletion, modification, substitution, conservative substitution or addition is also included in the scope of the present disclosure, as long as the amino acid sequence exhibits the same or corresponding activity as a protein consisting of the amino acid sequence of the corresponding SEQ ID NO. For example, the addition of sequences before and after the amino acid sequence, naturally occurring mutations, silent mutations thereof or conservative substitutions thereof without changing the function of the protein is not excluded, as long as the sequence exhibits the same or corresponding activity as the modified protein, and it is obvious that the addition of such sequences or mutations is also within the scope of the present disclosure.

[0052] In one embodiment of the foregoing embodiment, the variant of the present disclosure may comprise a sequence having at least 80%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity to SEQ ID NO: 3 or SEQ ID NO: 25, or may consist of the amino acid sequence. In the variant, the amino acid corresponding to position 87 of SEQ ID NO: 3 or 25 may be valine (V) or aspartic acid (D).

[0053] In any of the foregoing embodiments, the ketol-acid reductoisomerase variants of the present disclosure may have enhanced ketol-acid reductoisomerase activity, but are not limited thereto.

[0054] In any of the aforementioned embodiments, the ketol-acid reductoisomerase variant of the present disclosure may have an activity of increasing L-valine-producing capacity compared to a wild-type, native or unmodified polypeptide having ketol-acid reductoisomerase activity, but is not limited thereto.

[0055] Another aspect of the present disclosure provides a polynucleotide encoding a variant of the present disclosure. The variant is as described in the above aspect.

[0056] As used herein, the term "polynucleotide" refers to a DNA or RNA chain of a certain length or longer, which is composed of a polymer of nucleotides, wherein the nucleotide monomers are linked together in the long chain by covalent bonds, and more specifically, a polynucleotide fragment encoding the variant.

[0057] Taking into account the codon degeneracy or preferred codons in the organism in which the variant of the present invention is to be expressed, the polynucleotides of the present invention may be subjected to various modifications in the coding region within the scope of not changing the amino acid sequence of the variant of the present invention. Therefore, it is obvious that polynucleotides that can be translated into polypeptides consisting of the amino acid sequence of the variant of the present invention by codon degeneracy or polypeptides having homology or identity therewith may also be included.

[0058] For example, the polynucleotides of the present disclosure may have or include a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% and less than 100% homology or identity with the polynucleotide sequence of SEQ ID NO: 66, or may consist of or be substantially composed of a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity with the polynucleotide sequence of SEQ ID NO: 2, but are not limited thereto. Alternatively, in the polynucleotide sequence having the above homology or identity, the codon encoding the 87th amino acid corresponding to SEQ ID NO: 1 may be one of the codons encoding valine (V) or aspartic acid (D), but are not limited thereto.

[0059] In addition, the polynucleotides of the present invention may include any probe that can be prepared from a known gene sequence, for example, a sequence that can hybridize to all or part of the complementary sequence of the polynucleotide sequence of the present invention under stringent conditions, without limitation. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; and FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, a series of conditions may include:

[0060] Polynucleotides having higher homology or identity, i.e., polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more or 99% or more homology or identity hybridize to each other, while polynucleotides having lower homology or identity than the above do not hybridize to each other; or typical washing conditions for Southern hybridization, which correspond to washing once, especially twice or three times at a salt concentration and temperature of 60°C, 1хSSC, 0.1% SDS, especially 60°C, 0.1хSSC, 0.1% SDS, more especially 68°C, 0.1хSSC, 0.1% SDS.

[0061] Hybridization requires that the two nucleic acids have complementary sequences, although mismatches between nucleotides are possible depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, in DNA, adenine and thymine are complementary, and cytosine and guanine are complementary. Therefore, the polynucleotides of the present disclosure can include not only substantially similar nucleic acid sequences, but also isolated nucleic acid fragments that are complementary to the entire sequence.

[0062] Specifically, polynucleotides having homology or identity with the polynucleotides disclosed herein can be detected using hybridization conditions, which include hybridization under the aforementioned conditions at a Tm value of 55° C. In addition, the Tm value can be 60° C., 63° C., or 65° C., but is not limited thereto, and can be appropriately adjusted by those skilled in the art according to the purpose.

[0063] The appropriate stringency for hybridization of polynucleotides depends on the length of the polynucleotides and the degree of complementation, and variables are well known in the art (eg, J. Sambrook et al., supra).

[0064] Another aspect of the present disclosure provides a vector comprising a polynucleotide encoding a variant of the present disclosure. The variant and polynucleotide are as described above in other aspects.

[0065] The vector may be an expression vector for expressing a polynucleotide in a microorganism, but is not limited thereto.

[0066] As used herein, the term "vector" may include a DNA construct comprising a nucleotide sequence of a polynucleotide encoding a target polypeptide, which is operably linked to a suitable expression regulatory region (or expression regulatory sequence) so that the target polypeptide can be expressed in a suitable host. The expression regulatory region may include a promoter that can initiate transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating transcription and translation termination. After transformation into a suitable microorganism, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.

[0067] The vector used in the present disclosure is not specifically limited, and any vector known in the art can be used. Examples of conventionally used vectors include plasmids, cosmids, viruses and phages in natural or recombinant states. For example, as phage vectors or cosmid vectors, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used, and as plasmid vectors, vectors based on pDZ, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, pET, etc. can be used. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.

[0068] In one embodiment, the polynucleotide encoding the target polypeptide can be inserted into the chromosome by a vector for intracellular chromosome insertion. The polynucleotide insertion into the chromosome can be achieved by any method known in the art, such as homologous recombination, but is not limited thereto. A selectable marker for confirming chromosome insertion may be further included. The selectable marker is used to select cells transformed with the vector, i.e., to confirm whether the target nucleic acid molecule has been inserted. For selectable markers, markers providing selectable phenotypes may be used, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface polypeptides. In an environment treated with a selection agent, only cells expressing the selectable marker survive or express other phenotypes, thereby allowing the selection of transformed cells.

[0069] In the present disclosure, the term "conversion" refers to the introduction of a vector containing a polynucleotide encoding a target polypeptide into a microorganism (microorganism or microbe) so that the polypeptide encoded by the polynucleotide can be expressed in the microorganism. The converted polynucleotides include all polynucleotides, whether they are inserted into the chromosome of the microorganism or are located outside the chromosome, as long as the polynucleotide can be expressed in the microorganism. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide can be introduced in any form, as long as it can be introduced into the microorganism and expressed therein. For example, the polynucleotide can be introduced into the microorganism in the form of an expression cassette, which is a gene construct containing all necessary elements for autonomous expression. The expression cassette can generally include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal that can be operably connected to the polynucleotide. The expression cassette can be in the form of an expression vector that can self-replicate. In addition, the polynucleotide can be introduced into the microorganism as it is, and can be operably connected to a sequence necessary for expression in the microorganism, but is not limited thereto.

[0070] Furthermore, the above-mentioned term "operably linked" refers to the functional connection between a promoter sequence and a polynucleotide sequence that initiate and mediate transcription of a polynucleotide encoding a variant of interest of the present disclosure.

[0071] As used herein, the term "introduction" refers to a method of delivering a polynucleotide encoding a variant of the present disclosure or a vector comprising the same to a host cell. This introduction can be easily performed by conventional methods in the art. Common examples include: CaCl2 precipitation; Hanahan method, which is a reducing substance called dimethyl sulfoxide (DMSL) used in the CaCl2 method to improve efficiency; electroporation; calcium phosphate precipitation; protoplast fusion; stirring with silicon carbide fibers; transformation using PEG; dextran sulfate, liposomes (Lipofectamine), drying / inhibition-mediated transformation, etc. The method for transforming the vector is not limited thereto, and the transformation or transfection methods conventionally used in the art can be used without limitation.

[0072] Yet another aspect of the present disclosure provides a microorganism comprising a variant of the present disclosure or a polynucleotide encoding a variant of the present disclosure.

[0073] In one embodiment, the microorganism can include a vector comprising a polynucleotide encoding the variant.

[0074] In one embodiment, the microorganism of the present disclosure may be a microorganism having an L-valine-producing ability.

[0075] As used herein, the term "L-valine" is an essential amino acid and refers to an L-amino acid having a chemical formula of (CH3)2CHCH(NH2)COOH, which together with L-leucine and L-isoleucine corresponds in structure to BCAA.

[0076] As used herein, the term "microorganism (or strain)" includes wild-type microorganisms and natural or artificial genetically modified microorganisms, and refers to a microorganism with a specific mechanism that is weakened or enhanced due to factors such as the insertion of exogenous genes or the enhancement or inactivation of endogenous gene activity. It can be a microorganism containing a genetic modification for producing a target polypeptide, protein or product. As used herein, the terms "microorganism", "strain" and "microorganism" have the same meaning and can be used interchangeably without restriction.

[0077] As used herein, the term "microorganism producing L-valine" refers to a prokaryotic or eukaryotic microbial strain capable of producing L-valine in vivo, and may include a microorganism in which L-valine production ability is imparted to a parent strain lacking L-valine production ability, and a microorganism inherently having L-valine production ability. L-valine production ability can be imparted or enhanced by strain improvement.

[0078] In one embodiment, the microorganism of the present disclosure may be: a microorganism naturally having the ability to produce ketol-acid reductoisomerase or L-valine; or a microorganism into which a variant of the present disclosure or a polynucleotide encoding the same (or a vector comprising the polynucleotide) is introduced, or a parent strain that does not have the ability to produce ketol-acid reductoisomerase or L-valine is endowed with the ability to produce L-valine, but is not limited thereto.

[0079] In one embodiment, the microorganism of the present disclosure includes a microorganism comprising a sequence of a ketol-acid reductoisomerase variant of the present disclosure due to a mutation in a chromosomal gene encoding a ketol-acid reductoisomerase, and / or a microorganism comprising a ketol-acid reductoisomerase variant of the present disclosure by introducing a vector comprising a polynucleotide encoding a ketol-acid reductoisomerase variant of the present disclosure, but is not limited thereto.

[0080] In any of the foregoing embodiments, the microorganism provided in the present disclosure may be a genetically modified microorganism expressing the ketol-acid reductoisomerase of the present disclosure.

[0081] As used herein, the term "unmodified microorganism" does not exclude the bacterial strain comprising a mutation, and the mutation may be naturally present in the microorganism, and may be a wild-type strain or a natural strain itself, or may be a strain before its properties are changed by genetic mutation due to natural or artificial factors. For example, an unmodified microorganism may refer to a bacterial strain that is not introduced or has not yet introduced the ketol-acid reductoisomerase variant described in this specification sheet. The term "unmodified microorganism" may be used interchangeably with "strain before modification", "microorganism before modification", "unvaried strain", "unmodified strain", "unmutated microorganism" or "reference microorganism".

[0082] The microorganism having L-valine production ability of the present disclosure can be: a microorganism comprising any one or more of the variants of the present disclosure, the polynucleotides of the present disclosure, and a vector comprising the polynucleotides of the present disclosure; a modified microorganism expressing the variants of the present disclosure or the polynucleotides of the present disclosure; a microorganism (e.g., a recombinant strain) expressing the polynucleotides of the present disclosure; or a microorganism (e.g., a recombinant strain) having the activity of the variants of the present disclosure, but is not limited thereto.

[0083] In one embodiment, the strain of the present invention refers to a cell or microorganism that can express a variant of the present invention by transforming with a vector comprising a polynucleotide of the present invention or a polynucleotide encoding a variant of the present invention, and the strain of the present invention can include all microorganisms that can produce L-valine by comprising a variant of the present invention. For example, the microorganism of the present invention can be a recombinant strain, in which a polynucleotide encoding a variant of the present invention is introduced into a natural wild-type microorganism or a microorganism with L-valine production capacity to express a ketol-acid reductoisomerase variant, thereby having an increased L-valine production capacity.

[0084] The strain having increased L-valine production ability may be a microorganism having increased L-valine production ability compared to a natural wild-type microorganism or an unmodified ketol-acid reductoisomerase microorganism (e.g., a wild-type microorganism expressing ketol-acid reductoisomerase or a microorganism not expressing the variant of the present disclosure), but is not limited thereto.

[0085] In one embodiment, the microorganism having increased L-valine-producing ability of the present disclosure may be a microorganism having increased L-valine-producing ability compared to a microorganism comprising the polypeptide of SEQ ID NO: 1 or a polynucleotide encoding the same, but is not limited thereto.

[0086] In one embodiment, the L-valine productivity of the microorganism with increased L-valine productivity can be increased by about 1% or more, about 2% or more, about 2.5% or more, or about 3% or more (the upper limit is not particularly limited, and can be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, or about 20% or less), compared to the L-valine productivity of the parental strain before modification or an unmodified microorganism, but is not limited thereto, as long as the microorganism with increased L-valine productivity has a positive added value compared to the productivity of the parental strain before modification or an unmodified microorganism. In another embodiment, the recombinant strain with increased L-valine productivity can be increased by about 1.01 times or more, about 1.02 times or more, or about 1.03 times or more (the upper limit is not particularly limited, and can be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, or about 1.5 times or less) compared to the L-valine productivity of the parent strain before modification or an unmodified microorganism, but is not limited thereto.

[0087] The example of the parent strain before modification or unmodified microorganism for comparing the increase of L-valine productivity can include the microorganism of the polypeptide comprising SEQ ID NO:1 or the polynucleotide encoding the polypeptide. Other examples can include Corynebacterium glutamicum KCCM11201P (US 8465962 B), Corynebacterium glutamicum ATCC13869 and Corynebacterium glutamicum ATCC14067, but are not limited to this.

[0088] The term "about" is meant to include ranges of values ​​such as ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all values ​​within the range equivalent to or similar to the numerical value following the term "about", but is not limited thereto.

[0089] The microorganism of the present disclosure may include all microorganisms capable of expressing the ketol-acid reductoisomerase variant of the present disclosure by various known methods in addition to the introduction of nucleic acids or vectors.

[0090] The microorganism of the present disclosure may be a microorganism of the genus Corynebacterium.

[0091] In one embodiment, the microorganism of the present disclosure can be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacteriumammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens. In one embodiment of the aforementioned embodiment, the microorganism of the present disclosure may be Corynebacterium glutamicum.

[0092] The Corynebacterium microorganisms having L-valine-producing ability disclosed herein include all naturally occurring wild-type microorganisms; Corynebacterium microorganisms having improved L-valine-producing ability by enhancing or weakening the activity of genes related to the L-valine production mechanism; and Corynebacterium microorganisms having increased L-valine-producing ability by introducing or enhancing the activity of exogenous genes.

[0093] In one embodiment, the microorganism of the present disclosure may include an acetohydroxy acid synthase that is modified to have an increased L-valine production capacity. In any one of the embodiments described above, the microorganism of the present disclosure may include a modified acetohydroxy acid synthase subunit (ilvN). The acetohydroxy acid synthase subunit may include a mutation in which the amino acid at position 42 is replaced by valine (A42V). However, the microorganism of the present disclosure is not limited thereto.

[0094] The microorganism of the present disclosure may have enhanced activity of the ketol-acid reductoisomerase variant of the present disclosure.

[0095] As used herein, the term "enhancement" of polypeptide activity refers to an increase in polypeptide activity compared to its intrinsic activity. The term enhancement can be used interchangeably with terms such as activation, upregulation, overexpression, increase, etc. In particular, activation, enhancement, upregulation, overexpression and increase can include showing an activity that was not initially present and showing an increased activity compared to the intrinsic activity or activity before modification. The term "intrinsic activity" refers to the activity of a specific polypeptide that a parent strain or an unmodified microorganism initially had before transformation when a trait was transformed by natural or artificial factors. The term can be used interchangeably with "activity before modification". When the activity of a polypeptide is "enhanced", "upregulated", "overexpressed" or "increased" compared to its intrinsic activity, this means that the activity and / or concentration (expression level) of a specific polypeptide compared to a specific polypeptide that a parent strain or an unmodified microorganism initially had is enhanced.

[0096] This enhancement can be achieved by introducing an exogenous polypeptide or enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of a polypeptide is enhanced can be confirmed by an increase in the degree of activity, the expression level of the corresponding polypeptide, or the amount of product released from the polypeptide.

[0097] The enhancement of polypeptide activity can be achieved by applying various methods well known in the art, and is not limited, as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, genetic engineering and / or protein engineering known to those skilled in the art can be used to achieve enhancement, which is a common method in molecular biology, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2.1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0098] Specifically, the enhancement of the polypeptide in the present disclosure can be:

[0099] 1) increasing the intracellular copy number of a polynucleotide encoding a polypeptide;

[0100] 2) Replace the gene expression regulatory region encoding the polypeptide on the chromosome with a sequence with strong activity;

[0101] 3) modifying the nucleotide sequence of the start codon or 5'-UTR region of the gene transcript encoding the polypeptide;

[0102] 4) Modify the amino acid sequence of a polypeptide to enhance its activity;

[0103] 5) modifying a polynucleotide sequence encoding a polypeptide to enhance the activity of the polypeptide (e.g., modifying a polynucleotide sequence of a polypeptide gene to encode a modified polypeptide to enhance the activity of the polypeptide);

[0104] 6) introducing an exogenous polypeptide expressing polypeptide activity or an exogenous polynucleotide encoding the polypeptide;

[0105] 7) codon optimization of the polynucleotide encoding the polypeptide;

[0106] 8) modification or chemical modification of exposed regions selected by analysis of the tertiary structure of the polypeptide; or

[0107] 9) A combination of two or more selected from 1) to 8), but not limited thereto.

[0108] More specifically:

[0109] 1) Increasing the intracellular copy number of a polynucleotide encoding a polypeptide can be achieved by introducing a vector operably linked to a polynucleotide encoding the corresponding polypeptide into a host cell, wherein the vector is capable of replicating and functioning independently of the host. Alternatively, this can be achieved by inserting a copy or two or more copies of the polynucleotide encoding the corresponding polypeptide into the chromosome of the host cell. Chromosomal insertion can be performed by introducing a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0110] 2) Replacing the gene expression control region (or expression control sequence) encoding the polypeptide on the chromosome with a sequence having strong activity can be, for example, mutations in the sequence, including deletions, insertions, non-conservative or conservative substitutions or combinations thereof, to further enhance the activity of the expression control region, or replacing it with a sequence having strong activity. The expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence regulating transcription and translation termination, and the like. In one embodiment, the original promoter can be replaced with a strong promoter, but is not limited thereto.

[0111] Examples of known strong promoters may include CJ1 to CJ7 promoters (U.S. Patent No. US7662943B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (U.S. Patent No. US10584338 B2), O2 promoter (U.S. Patent No. US10273491 B2), tkt promoter, yccA promoter, etc., but are not limited to these.

[0112] 3) Modification of the nucleotide sequence of the start codon or 5'-UTR region of the gene transcript encoding the polypeptide can be, for example, replaced with a nucleotide sequence encoding a different start codon having a higher polypeptide expression rate than the endogenous start codon, but is not limited thereto.

[0113] The modified amino acid sequence or polynucleotide sequence in 4) and 5) may be a mutation in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution or a combination thereof, to enhance the activity of the polypeptide; or replaced with an improved amino acid sequence or polynucleotide sequence with stronger activity, or an improved amino acid sequence or polynucleotide sequence with increased activity, but not limited thereto. Specifically, the polynucleotide may be inserted into a chromosome by homologous recombination for replacement, but not limited thereto. The vector used herein may also include a selection marker for confirming chromosomal insertion. The selection marker is as described above.

[0114] 6) Introducing an exogenous polynucleotide that expresses polypeptide activity can be introducing an exogenous polynucleotide into a host cell, wherein the exogenous polynucleotide encodes a polypeptide that exhibits the same or similar activity as the polypeptide. The source or sequence of the exogenous polynucleotide is not limited, as long as it exhibits the same or similar activity as the polypeptide. The method for introduction can be a known transformation method, and can be appropriately selected and implemented by those skilled in the art, and as the introduced polynucleotide is expressed in the host cell to produce the polypeptide, the activity of the polypeptide can be increased.

[0115] 7) Codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase its transcription or translation in a host cell, or codon optimization of an exogenous polynucleotide to achieve optimized transcription or translation of the polynucleotide in a host cell.

[0116] 8) Modification or chemical modification of the exposed region selected by analyzing the tertiary structure of the polypeptide can be, for example, modification or chemical operation of the exposed portion to be modified or chemically operated, wherein the exposed portion to be modified or chemically operated is selected by comparing the sequence information of the polypeptide to be analyzed with a database storing sequence information of known proteins, and then determining the template protein candidate based on the sequence similarity, and confirming the structure based on this.

[0117] Such enhancement of polypeptide activity may be an increase in the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type strain or microbial strain before modification, or an increase in the amount of the product produced by the corresponding polypeptide, but is not limited thereto.

[0118] In the microorganisms disclosed herein, all or part of the modification of the polynucleotides can be induced by: (a) homologous recombination using a chromosome insertion vector in a microorganism, or genome editing using an engineered nuclease (e.g., CRISPR-Cas9); and / or (b) light, such as ultraviolet light or radiation and / or chemical treatment, but the method is not limited thereto. Methods for modifying all or part of a gene may include methods based on DNA recombination technology. For example, homologous recombination induced by introducing a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene into a microorganism may result in all or part of the gene being deleted. The introduced nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.

[0119] In the microorganism disclosed herein, the variant, polynucleotide, L-valine, etc. are as described in the other aspects above.

[0120] Another aspect of the present disclosure provides a method for producing L-valine, comprising culturing the microorganism of the present disclosure in a culture medium.

[0121] Specifically, the method for producing L-valine of the present disclosure may include culturing a microorganism comprising the variant of the present disclosure, the polynucleotide of the present disclosure, or the vector of the present disclosure in a culture medium, but is not limited thereto.

[0122] As used herein, the term "culture" refers to culturing the microorganism of the present disclosure under appropriately controlled environmental conditions. The culture procedure of the present disclosure can be carried out according to suitable culture media or culture conditions known in the art. Those skilled in the art can easily adjust this culture procedure according to the selected strain. Specifically, the culture can be carried out in batch, continuous and / or fed-batch mode, but is not limited thereto.

[0123] As used herein, the term "culture medium" refers to a mixed substance containing nutrients required for culturing the microorganisms of the present disclosure as main components, and the culture medium provides nutrients, growth factors, etc., including water that is indispensable for the survival and development of the microorganisms. Specifically, as a culture medium and other culture conditions for culturing the microorganisms of the present disclosure, any culture medium can be used without particular limitation, as long as the culture medium is commonly used for culturing microorganisms, and the microorganisms described in the present disclosure can be cultured in a common culture medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids and / or vitamins, etc., while controlling temperature, pH value, etc. under aerobic conditions.

[0124] For example, culture media for Corynebacterium strains can be found in the literature [“Manual of Methods for General Bacteriology”, American Society of Bacteriology (Washington, DC, USA, 1981)].

[0125] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, cane molasses, and corn syrup may be used. Specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugars) may be used, and appropriate amounts of other carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0126] As the nitrogen source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc., and organic nitrogen sources such as amino acids such as glutamic acid, methionine and glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. can be used. These nitrogen sources can be used alone or in combination of two or more, but are not limited thereto.

[0127] The phosphorus source may include monopotassium phosphate, dipotassium phosphate or their corresponding sodium salts. As inorganic compounds, sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, etc. may be used. In addition, amino acids, vitamins and / or suitable precursors may be included. These components or precursors may be added to the culture medium in batches or continuously, but the method is not limited thereto.

[0128] In addition, in the cultivation process of the disclosed microorganism, the pH of the culture medium can be regulated by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid in a suitable manner to the culture medium. In addition, defoamers such as fatty acid polyethylene glycol esters can be used to suppress foaming during cultivation. In addition, oxygen or oxygen-containing gas can be injected into the culture medium to maintain the aerobic state of the culture medium, or gas can not be injected or nitrogen, hydrogen or carbon dioxide gas can be injected to maintain anaerobic and microaerobic state, but the method is not limited thereto.

[0129] In the culture of the present disclosure, the culture temperature may be maintained at 20° C. to 45° C., specifically, 25° C. to 40° C., and the strain may be cultured for about 10 hours to 160 hours, but the culture conditions are not limited thereto.

[0130] L-valine produced by the culture of the present disclosure may be secreted into the medium or retained in the cells.

[0131] The method for producing L-valine of the present disclosure may further include, for example, preparing the microorganism of the present disclosure before culturing, preparing a culture medium for culturing the microorganism strain, or a combination thereof in any order.

[0132] The method for producing L-valine of the present disclosure may further include recovering L-valine from the culture medium (culture medium) according to the present disclosure or from the microorganism. Recovery may also be included after the culture.

[0133] Recovery can be according to the microbial culture method of the present disclosure, such as batch, continuous or fed-batch culture method, using suitable methods known in the art to collect L-valine. For example, centrifugation, filtration, treatment with a crystalline protein precipitant (salting out), extraction, ultrasonic treatment, ultrafiltration, dialysis, various forms of chromatography such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography and affinity chromatography, HPLC or its combination can be used. L-valine can be recovered from culture medium or microorganisms using suitable methods known in the art

[0134] In addition, the method for producing L-valine of the present disclosure may further include purification. In one embodiment, when the method for producing L-valine of the present disclosure includes both recovery and purification, recovery and purification may be performed continuously or discontinuously in any order, or performed simultaneously or integrated into a single step, but the method is not limited thereto.

[0135] In the method disclosed herein, the variant, polynucleotide, vector, microorganism, L-valine, etc. are as described in the other aspects above.

[0136] Another aspect of the present disclosure provides a composition for producing L-valine, the composition comprising the microorganism of the present disclosure, a culture medium for culturing the microorganism; or a combination of two or more thereof.

[0137] The composition of the present disclosure may also include any suitable excipients commonly used in the composition for producing amino acids. Such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, isotonic agents, etc., but are not limited thereto.

[0138] In the composition of the present disclosure, the variant, polynucleotide, vector, microorganism, L-valine, etc. are as described in the other aspects above.

[0139] Another aspect of the present disclosure provides the use of the ketol-acid reductoisomerase variant of the present disclosure in producing L-valine. The variant is as described in the other aspects above.

[0140] [Mode for Carrying Out the Invention]

[0141] Hereinafter, the present disclosure will be described in more detail with reference to examples. However, these examples are only used to illustrate the present disclosure, and the scope of the present disclosure is not intended to be limited by these examples. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by those skilled in the art or related technical fields.

[0142] Example 1-1: Inducing artificial mutation by UV irradiation

[0143] In order to select mutant strains with increased valine production capacity, the valine-producing strain Corynebacterium glutamicum KCCM11201P (US 8465962 B) was plated on a nutrient medium containing agar and cultured for 36 hours at 30° C. Hundreds of colonies thus obtained were irradiated with UV at room temperature to induce random mutations in the strain genome.

[0144] Example 1-2. Evaluation and selection of fermentation potential of mutant strains

[0145] In order to select the mutant strain with increased L-valine production capacity compared with the parent strain Corynebacterium glutamicum KCCM11201P, the fermentation potential experiment was carried out on the strain induced by random mutation. Each colony was subcultured in a nutrient medium, and then each strain was inoculated into a 250mL angle baffled flask containing 25mL production medium, and cultured with shaking at 200rpm for 72 hours at 30°C. Subsequently, HPLC was used to analyze the concentration of L-valine. The L-valine concentration analyzed is shown in Table 1 below.

[0146] [Nutrient medium (pH 7.2)]

[0147] Glucose 10g, meat extract 5g, polypeptone 10g, sodium chloride 2.5g, yeast extract 5g, agar 20g and urea 2g (per 1L distilled water)

[0148] [Production medium (pH 7.0)]

[0149] Glucose 100g, ammonium sulfate 40g, soy protein 2.5g, corn syrup solids 5g, urea 3g, dipotassium phosphate 1g, magnesium sulfate heptahydrate 0.5g, biotin 100μg, thiamine hydrochloride 1mg, calcium pantothenate 2mg, nicotinamide 3mg and calcium carbonate 30g (per 1L distilled water)

[0150] [Table 1]

[0151]

[0152]

[0153] Referring to Table 1, the C12 strain with the greatest increase in valine production compared to the control group KCCM11201P strain was selected.

[0154] Example 2. Confirmation of mutations by gene sequencing

[0155] The major genes of the C12 strain were sequenced and compared with the genes of the KCCM11201P strain and the wild-type Corynebacterium glutamicum ATCC14067 strain. As a result, it was confirmed that the strain with increased valine production ability included nucleotide sequence mutations at specific positions in the open reading frame (ORF) region of the ilvC gene. Specifically, the C12 strain showing the greatest increase in valine production was confirmed to have three mutations introduced into the nucleotide sequence located 259-261 bp downstream of the start codon of the ilvC gene, resulting in the original CAG (SEQ ID NO: 66) becoming GTT (SEQ ID NO: 2), and the 87th amino acid glutamine being replaced by valine (SEQ ID NO: 3).

[0156] Analysis of the mutation region in SEQ ID NO:2 confirmed that it affects the effector binding domain of the valine biosynthetic enzyme. Therefore, it is predicted that the activity of the protein will be enhanced. In the examples herein, it was confirmed whether the Q87V mutation inserted at a specific position in the ilvC gene ORF affects the ability of Corynebacterium microorganisms to produce valine (a branched-chain amino acid). In addition, it was confirmed whether replacing the 87th amino acid glutamine with another amino acid (except valine) affects the ability of Corynebacterium microorganisms to produce the branched-chain amino acid valine.

[0157] Example 3. Production of KCCM11201P strain with ilvC mutation and confirmation of L-valine production

[0158] Example 3-1. Production of Corynebacterium glutamicum KCCM11201P strain having ilvC mutation and evaluation of L-valine production capacity

[0159] In order to insert the ilvC (Q87V) mutant represented by SEQ ID NO: 2 into glutamic acid KCCM11201P, a vector containing the target mutation was prepared. Specifically, the genomic DNA of the C12 strain was extracted using the G-spin total DNA extraction micro kit (Intron, catalog number 17045) according to the protocol provided in the kit, and PCR was performed using the genomic DNA as a template. PCR was performed under the following conditions: first denaturation at 94°C for 5 minutes; then 25 cycles, each cycle including denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 150 seconds; finally extension at 72°C for 7 minutes. A PCR product of 1,010 bp (hereinafter referred to as "Fragment 1 into which mutations were introduced") was obtained using SEQ ID NO: 4 and SEQ ID NO: 5.

[0160] The obtained mutation-introduced fragment 1 was ligated to a pDCM2 vector (Korean Patent Application Publication No. 10-2020-0136813) treated with SmaI (New England Biolabs, Beverly, MA) using an injection cloning kit (Takara Bio Inc., Otsu, Japan) and then transformed into Escherichia coli DH5α. After the gene thus prepared was transformed into Escherichia coli DH5α, the strain was selected on LB medium containing kanamycin, and DNA was extracted therefrom using a DNA-spin plasmid DNA purification kit (iNtRON) to prepare a pDCM2-ilvC (Q87V) vector containing the mutation-introduced fragment 1.

[0161] [Table 2]

[0162] Primers Nucleotide sequence SEQ ID NO:4 CCCGGGGCACTGCTTGATGGTGATGGAACCAT SEQ ID NO:5 CCCGGG GTCAACGATGAGCTTGAGCTCGT

[0163] The pDCM2-ilvC (Q87V) vector was transformed into Corynebacterium glutamicum KCCM11201P by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The resulting strain (wherein the vector is inserted into the chromosome by homologous recombination) was selected on a medium containing 25 mg / L kanamycin. Then PCR was performed on the Corynebacterium glutamicum transgenic strain that completed the secondary recombination with SEQ ID NO:4 and SEQ ID NO:5 to confirm that the strain in which the glutamine at position 87 of the amino acid of SEQ ID NO:1 in the ORF of the ilvC gene on the chromosome was replaced by valine. The recombinant strain was named Corynebacterium glutamicum KCCM11201P::ilvC (Q87V). In order to compare the valine production capacity of valine-producing strain Corynebacterium glutamicum KCCM11201P and recombinant strain Corynebacterium glutamicum KCCM11201P::ilvC (Q87V), shake flask evaluation was carried out. Each bacterial strain is subcultured in a nutrient medium, inoculated into a 250mL angled baffled flask containing 25ml production medium, and shaken at 30 ℃ with 200rpm for 72 hours. Then, HPLC is used to analyze the concentration of L-Valine. The L-Valine concentration analyzed is presented in the following table 3.

[0164] [Nutrient medium (pH 7.2)]

[0165] Glucose 10g, meat extract 5g, polypeptone 10g, sodium chloride 2.5g, yeast extract 5g, agar 20g and urea 2g (per 1L distilled water)

[0166] [Production medium (pH 7.0)]

[0167] Glucose 100g, ammonium sulfate 40g, soy protein 2.5g, corn syrup solids 5g, urea 3g, dipotassium phosphate 1g, magnesium sulfate heptahydrate 0.5g, biotin 100μg, thiamine hydrochloride 1mg, calcium pantothenate 2mg, nicotinamide 3mg and calcium carbonate 30g (per 1L distilled water)

[0168] [Table 3]

[0169] L-valine production capacity of KCCM11201P and KCCM11201P::ilvC(Q87V)

[0170]

[0171] As a result, the L-valine production ability of the KCCM11201P::ilvC(Q87V) strain was increased by 16% compared with that of KCCM11201P.

[0172] Example 3-2: Production of Corynebacterium glutamicum CJ7V strain with ilvC mutation and evaluation of L-valine production capacity

[0173] In order to confirm whether other Corynebacterium glutamicum strains also show enhanced L-valine production ability, a strain with enhanced L-valine production ability was prepared by introducing a single mutation [ilvN (A42V); Biotechnology and Bioprocess Engineering, June 2014, Vol. 19, No. 3, pp. 456-467] into the wild-type Corynebacterium glutamicum ATCC14067 strain.

[0174] Specifically, the genomic DNA of ATCC14067 strain is a wild-type strain of Corynebacterium glutamicum, and is extracted using a G-spin total DNA extraction micro kit (Intron, catalog number 17045) according to the protocol provided in the kit. PCR was performed using genomic DNA as a template. In order to prepare a vector for introducing the A42V mutation into the ilvN gene, the primer pairs of SEQ ID NO:6 and SEQ ID NO:7, and the primer pairs of SEQ ID NO:8 and SEQ ID NO:9 were used to obtain gene fragments (A, B). PCR was performed using the following conditions: first denaturation at 94°C for 5 minutes; then 25 cycles were performed, each cycle including denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 60 seconds; finally extension at 72°C for 7 minutes.

[0175] As a result, polynucleotides of 528 bp and 509 bp were obtained respectively for fragments A and B. Using these two fragments as templates, overlapping PCR was performed together with SEQ ID NO: 6 and SEQ ID NO: 9 to obtain a PCR product of 1,010 bp (hereinafter referred to as "mutation-introduced fragment 2").

[0176] The obtained fragment 2 with introduced mutation was treated with restriction enzyme SmaI (New England Biolabs, Beverly, MA) and then ligated with pDCM2 vector also treated with the same restriction enzyme using T4 ligase (New England Biolabs, Beverly, MA). The prepared gene was transformed into E. coli DH5α and then screened on LB medium containing kanamycin. DNA was obtained using DNA-spin plasmid DNA purification kit (iNtRON). The vector targeted for introduction of the ilvN gene A42V mutation was named pDCM2-ilvN (A42V).

[0177] [Table 4]

[0178]

[0179] Subsequently, by homologous recombination on the chromosome, pDCM2-ilvN (A42V) carrier is transformed into wild-type Corynebacterium glutamicum ATCC14067 bacterial strain (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). On the substratum containing 25mg / L kanamycin, the obtained bacterial strain (wherein the carrier inserts the chromosome by homologous recombination) is selected. The gene fragment of the Corynebacterium glutamicum transgenic strain recombined for the second time is completed by pcr amplification using SEQ ID NO:6 and SEQ ID NO:9, then the mutation insertion bacterial strain is confirmed by gene sequence analysis. This recombinant bacterial strain is named as Corynebacterium glutamicum CJ7V. Finally, use Corynebacterium glutamicum CJ7V, prepare the bacterial strain transformed with carrier as described in embodiment 3-1, and the obtained bacterial strain is named as Corynebacterium glutamicum CJ7V::ilvC (Q87V). In order to compare the L-valine-producing ability of the strain thus prepared, the strain was cultured as in Example 3-1 and the L-valine concentration was analyzed, and the analyzed L-valine concentration is shown in Table 5 below.

[0180] [Table 5]

[0181] l-Valine production ability of CJ7V and CJ7V::ilvC(Q87V)

[0182]

[0183] As a result, it was confirmed that the L-valine-producing ability of CJ7V::ilvC(Q87V) was increased by 18% compared with CJ7V.

[0184] Example 3-3: Production of Corynebacterium glutamicum CJ8V strain having ilvC mutation and evaluation of L-valine production capacity

[0185] In order to confirm whether other Corynebacterium glutamicum strains producing L-valine also have the effect of increasing L-valine production capacity, a strain with enhanced L-valine production capacity was prepared by introducing a single mutation [ilvN (A42V); Biotechnology and Bioprocess Engineering, June 2014, Vol. 19, No. 3, pp. 456-467] into the wild-type strain Corynebacterium glutamicum ATCC13869 (KR 10-1947945B1).

[0186] Specifically, pDCM2-ilvN (A42V) carrier prepared in embodiment 3-2 is transformed in wild-type Corynebacterium glutamicum ATCC13869 bacterial strain, thereby inducing homologous recombination (van der Rest et al., ApplMicrobiol Biotechnol 52:541-545,1999) on the chromosome.On the substratum containing 25mg / L kanamycin, select the gained bacterial strain (wherein carrier inserts in the chromosome by homologous recombination).Use the primer of SEQ ID NO:10 and SEQ ID NO:11 sequence to carry out PCR with amplified gene fragment to the Corynebacterium glutamicum transgenic strain selected, and confirm the correct introduction of sudden change by gene sequence analysis.This recombinant bacterial strain is named as Corynebacterium glutamicum CJ8V.The primer sequence used in the present embodiment is listed in the following table 6.

[0187] [Table 6]

[0188] Primers Nucleotide sequence SEQ ID NO:10 CCGCGTCACCAAAGCGGA SEQ ID NO:11 TTAGATCTTGGCCGGAGCCA

[0189] Finally, use Corynebacterium glutamicum CJ8V bacterial strain, prepare the bacterial strain transformed with carrier in the same manner as in Example 3-1, it is named as Corynebacterium glutamicum CJ8V::ilvC (Q87V).In order to compare the Valine production capacity of the bacterial strain prepared, cultivate this bacterial strain and analyze its Valine concentration in the same manner as in Example 3-1.The Valine concentration analyzed is shown in the following table 7.

[0190] [Table 7]

[0191] L-valine production capacity of CJ8V and CJ8V::ilvC(Q87V)

[0192]

[0193] As a result, the L-valine production capacity of CJ8V::ilvC(Q87V) was increased by 21% compared with that of CJ8V.

[0194] Example 4. Production of KCCM11201P strain with Q87X mutation and confirmation of L-valine production

[0195] In order to mutate glutamine (amino acid position 87 of ilvC) with another amino acid other than valine, the pDCM2-ilvC(Q87V) vector used in Example 3-1 was used as a template for site-directed mutagenesis. Site-directed mutagenesis was performed by the method described below.

[0196] [Table 8]

[0197] PCR composition for site-directed mutagenesis

[0198]

[0199] [Table 9]

[0200] PCR cycles for site-directed mutagenesis

[0201]

[0202] The amino acid at position 87 of ilvC (i.e., glutamine) is replaced with any other amino acid except valine, such as alanine (A, SEQ ID NO: 12), valine (V, SEQ ID NO: 3), isoleucine (I, SEQ ID NO: 13), glycine (G, SEQ ID NO: 14), phenylalanine (F, SEQ ID NO: 15), methionine (M, SEQ ID NO: 16), serine (S, SEQ ID NO: 17), proline (P, SEQ ID NO: 18), threonine (T, SEQ ID NO: 19), tyrosine (Y, SEQ ID NO: 20), histidine (H, SEQ ID NO: 21), glutamine (Q, SEQ ID NO: 22), asparagine (N, SEQ ID NO: 23), lysine (K, SEQ ID NO: 24), aspartic acid (D, SEQ ID NO: 25), cysteine ​​(C, SEQ ID NO: 26), tryptophan (W, SEQ ID NO: 27), arginine (R, SEQ ID NO: 28), NO: 28), and glutamic acid (E, SEQ ID NO: 29), using each mutagenic primer set described in [Table 10] to prepare the PCR mixture shown in [Table 8], and using the cycle described in [Table 9] to perform PCR. After each PCR was completed, it was confirmed by sequencing that the pDCM2_ilvC mutant plasmid obtained by ligation and transformation into Escherichia coli DH5α using an injection cloning kit (Takara BioInc., Otsu, Japan) was replaced by each mutation listed in [Table 10].

[0203] [Table 10]

[0204] Mutagenic primer set for preparing plasmid for mutation of amino acid at position 87 in ilvC amino acid sequence

[0205]

[0206]

[0207]

[0208] As prepared in [Table 10] above, pDCM2_ilvC(Q87A), pDCM2_ilvC(Q87I), pDCM2_ilvC(Q87G), pDCM2_ilvC(Q87F), pDCM2_ilvC(Q87M), pDCM2_ilvC(Q87S), pDCM2_ilvC(Q87P), (Q87T), pDCM2_ilvC(Q87Y), pDCM2_ilvC(Q87H), pDCM2_ilvC Each of the pDCM2_ilvC(Q87Q), pDCM2_ilvC(Q87N), pDCM2_ilvC(Q87K), pDCM2_ilvC(Q87D), pDCM2_ilvC(Q87C), pDCM2_ilvC(Q87W), pDCM2_ilvC(Q87R) and pDCM2_ilvC(Q87E) vectors was transformed into KCCM11201P by electroporation, and 18 strains in which the mutant ilvC gene was inserted into the chromosome were obtained by the second exchange process. The genetic manipulation was confirmed by the PCR method using primers SEQ ID NO: 4 and SEQ ID NO: 5, which can amplify each external region of the upstream and downstream regions of each homologous recombinant, and genome sequencing.

[0209] The transgenic strains thus obtained were named as follows: KCCM11201P::ilvC(Q87A), KCCM11201P::ilvC(Q87I), KCCM11201P::ilvC(Q87G), KCCM11201P::ilvC(Q87F), KCCM11201P::ilvC(Q87M), KCCM11201P::ilvC(Q87S), KCCM11201P::ilvC(Q87P), KCCM11201P::ilvC(Q87T), KCCM11201P::ilv KCCM11201P::ilvC(Q87Y), KCCM11201P::ilvC(Q87H), KCCM11201P::ilvC(Q87Q), KCCM11201P::ilvC(Q87N), KCCM11201P::ilvC(Q87K), KCCM11201P::ilvC(Q87D), KCCM11201P::ilvC(Q87C), KCCM11201P::ilvC(Q87W), KCCM11201P::ilvC(Q87R), and KCCM11201P::ilvC(Q87E).

[0210] In order to confirm KCCM11201P::ilvC(Q87A), KCCM11201P::ilvC(Q87I), KCCM11201P::ilvC(Q87G), KCCM11201P::ilvC(Q87F), KCCM11201P::ilvC(Q87M), KCCM11201P::ilvC(Q87S), KCCM11201P::ilvC(Q87P), KCCM11201P::ilvC(Q87T), KCCM11201P::ilvC(Q87Y), KCCM11201P::ilvC(Q87H), KCCM112 The valine production of KCCM11201P::ilvC(Q87Q), KCCM11201P::ilvC(Q87N), KCCM11201P::ilvC(Q87K), KCCM11201P::ilvC(Q87D), KCCM11201P::ilvC(Q87C), KCCM11201P::ilvC(Q87W), KCCM11201P::ilvC(Q87R) and KCCM11201P::ilvC(Q87E) strains and KCCM11201P::ilvC(Q87V) strain were cultured in the same manner as in Example 3-1 and analyzed for L-valine concentration. The analyzed L-valine concentrations are shown in Table 11 below.

[0211] [Table 11]

[0212] Ability of strains with amino acid mutation substitution at position 87 of ilvC amino acid sequence to produce L-valine

[0213]

[0214]

[0215] As a result, the L-valine production capacity of the KCCM11201P::ilvC(Q87V) strain increased by 16% compared with that of KCCM11201P, and the L-valine production capacity of the KCCM11201P::ilvC(Q87D) strain also increased compared with that of KCCM11201P. The strains introduced with other mutations showed L-valine production capacities comparable to that of KCCM11201P, or the effects were not significant.

[0216] From the above, it can be confirmed that the variants disclosed herein can increase the L-valine production of microorganisms.

[0217] Based on the above description, it will be appreciated by those skilled in the art that the present disclosure can be implemented in different specific forms without changing its technical spirit or basic features. In this regard, it should be understood that the above embodiments are not restrictive, but illustrative in all respects. The scope of the present disclosure is limited by the appended claims rather than by the description before them, so all changes and modifications falling within the boundaries and scope of the claims, or the equivalents of these boundaries and scopes, are included by the claims.

Claims

1. A keto-acid reductoisomerase variant, wherein the amino acid at position 87 in the amino acid sequence corresponding to SEQ ID NO: 1 is substituted by valine (V) or aspartic acid (D).

2. The variant according to claim 1, wherein the variant comprises SEQ ID NO: 3, SEQ ID NO: 25, or an amino acid sequence having 80% or higher sequence identity thereto.

3. A polynucleotide encoding the variant according to claim 1 or 2.

4. A microorganism comprising a ketol-acid reductoisomerase variant or a polynucleotide encoding the variant, wherein the amino acid at position 87 in the amino acid sequence corresponding to SEQ ID NO: 1 is substituted by valine (V) or aspartic acid (D). The microorganism according to claim 4 , wherein the microorganism is a microorganism of the genus Corynebacterium. The microorganism according to claim 5, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

7. A method for producing L-valine, comprising culturing in a culture medium a ketol-acid reductoisomerase variant or a polynucleotide encoding the variant, wherein the amino acid at position 87 in the amino acid sequence corresponding to SEQ ID NO: 1 is substituted with valine (V) or aspartic acid (D).

8. The method for producing L-valine according to claim 7, wherein the method further comprises recovering L-valine.

9. A composition for producing L-valine, comprising a microorganism containing a ketol-acid reductoisomerase variant or a polynucleotide encoding the variant; a culture medium for culturing the microorganism; or a combination of two or more thereof, wherein the amino acid at position 87 in the amino acid sequence corresponding to SEQ ID NO: 1 in the variant is replaced by valine (V) or aspartic acid (D).

Images