Porcine epidemic diarrhea virus antigen fusion protein, encoding gene and porcine epidemic diarrhea vaccine prepared therefrom

Abstract

The application discloses a porcine epidemic diarrhea virus antigen fusion protein, a coding gene and a porcine epidemic diarrhea vaccine prepared from the porcine epidemic diarrhea virus antigen fusion protein. A homologous sequence of a porcine epidemic diarrhea virus spike protein is screened and fused with a monomer porcine ferritin heavy chain subunit to obtain an antigen fusion protein; in order to improve the expression amount or titer of the antigen fusion protein, the obtained antigen fusion protein is subjected to sequence optimization and then unit point or multi-point mutation, and the expression amount and titer of the obtained mutant are both significantly improved. The application uses a silkworm or an AcMNPV-insect cell eukaryotic expression system to express a recombinant protein to obtain a self-assembled ferritin nanoparticle antigen with S protein antigen protein displayed on the surface of a porcine ferritin cage structure, and the vaccine prepared by using the prepared nanoparticle antigen can cause a broad neutralization of anti-porcine epidemic diarrhea virus antibodies and has the potential to become a universal porcine epidemic diarrhea virus vaccine with cross-immunity efficacy.

Description

TECHNICAL FIELD

[0001] The present application relates to a porcine epidemic diarrhea virus antigen fusion protein and its application, in particular to a porcine epidemic diarrhea virus antigen fusion protein fused together by a porcine epidemic diarrhea virus spike protein and a monomer porcine ferritin heavy chain subunit and a porcine epidemic diarrhea vaccine prepared from the porcine epidemic diarrhea virus antigen fusion protein, belonging to the preparation and application field of porcine epidemic diarrhea vaccine. BACKGROUND

[0002] In recent years, the breeding scale of live pigs is getting larger and larger, which brings great pressure to disease prevention work. Porcine epidemic diarrhea (PED) is a severe enteric disease of piglets caused by porcine epidemic diarrhea virus (PEDV), which can cause severe vomiting, diarrhea, dehydration in piglets, and has a very high mortality rate. PEDV belongs to single-stranded RNA virus of alpha coronavirus, which is enveloped, and its genome is about 28kb long, containing four structural proteins-spike protein (Spike, S), nucleocapsid protein (Nucleocapsid, N), membrane protein (Membrane, M), envelope glycoprotein (Envelope glycoprotein, E) and three development reading frame coding non-structural proteins nsp1-nsp16. The best tool to prevent and control PEDV is mainly vaccine, and the spike protein is the key protein that interacts with specific host cell glycoprotein and mediates virus entry into host cells, so the spike protein part is the key part when developing vaccine.

[0003] Natural ferritin is composed of two parts of inner core and protein shell, and ferritin is found in bacteria, plants and animals, which is composed of 24 subunits, each of which forms a trimer subunit, and 8 trimers can form a spherical cage structure with an outer diameter of 12 nm and an inner cavity diameter of 8 nm. Ferritin is very stable and can withstand high temperature and various denaturants without affecting its natural protein structure. Ferritin becomes an ideal multifunctional nanocarrier due to its modification characteristics by chemical methods and gene fusion, and its highly ordered repeated antigens are easy to induce strong T cell-dependent antibody response when distributed on the surface of microorganisms at intervals of 5-10 nm. Ferritin nanoparticles self-assembled from 24 subunits become an ideal antigen presentation and vaccine development platform.

[0004] Porcine ferritin can reduce the immune response caused by non-antigen parts in vaccines for pigs and reduce the inflammatory response of the body. The spike protein S of PEDV has a natural trimer structure, and the trimer subunit of ferritin can well simulate the structure of the natural virus, so the vaccine prepared by connecting PEDV S protein and ferritin has good application prospect. SUMMARY

[0005] One of the purposes of the present application is to provide a consensus sequence of PEDV S protein.

[0006] The second purpose of the present application is to provide an antigen fusion protein comprising PEDV S protein.

[0007] The third purpose of the present application is to provide a mutant of the antigen fusion protein, which has improved expression or titer.

[0008] The fourth purpose of the present application is to provide a coding gene of the fusion protein and the mutant of the fusion protein.

[0009] The fifth purpose of the present application is to apply the coding gene to the preparation of PEDV self-assembled ferritin nano-antigen particles or the preparation of PEDV vaccine and the like.

[0010] In order to achieve the above purposes, the main technical solutions adopted by the present application include:

[0011] One aspect of the present application is to provide a consensus sequence of PEDV S protein, the amino acid sequence of which is shown in SEQ ID NO. 1.

[0012] The present application analyzes and compares the S protein amino acid sequences of 20 PEDV strains prevalent in different regions in recent years, finds a most common consensus sequence, the amino acid sequence of which is shown in SEQ ID NO. 1, and uses it as an antigen gene of the corresponding strain to achieve the best immunoprotective effect.

[0013] Another aspect of the present application is to provide an antigen fusion protein comprising PEDV S protein.

[0014] In a specific embodiment of the present application, the antigen fusion protein is obtained by connecting PEDV S protein and ferritin monomer through a connecting peptide.

[0015] After analyzing the amino acid sequence of PEDV S protein, it is found that the transmembrane region of PEDV S protein is 1328-1350, consisting of 23 amino acids, and the extracellular domain is 1327 amino acids; the signal peptide region is 1-18. The amino acid sequence of PEDV S protein is removed from the transmembrane region and intracellular region, the first 18 amino acids of ferritin are removed, and the N-terminus of the processed PEDV S protein and monomer ferritin subunit is connected by SGG; wherein the amino acid sequence of the monomer pig ferritin is shown in SEQ ID NO. 2.

[0016] On this basis, the present application further utilizes OptimumGene TMThe technology optimizes the amino acid sequence of the fusion protein, and the optimized S protein amino acid sequence and ferritin monomer subunit amino acid sequence are modified according to the codon bias of the silkworm to obtain an antigen fusion protein, and the amino acid sequence of the antigen fusion protein is shown as SEQ ID NO. 3, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 4.

[0017] Further, in the process of sequence analysis of the antigen fusion protein shown as SEQ ID NO. 3, it is found that the signal peptide of the sequence has multiple cutting peaks. In view of the previous finding that the cutting site of the signal peptide affects the expression efficiency of the exogenous protein, the antigen fusion protein sequence signal peptide region shown as SEQ ID NO. 3 is determined to be mutated. A large number of amino acid sequences of mammalian and insect proteins are collected from NCBI, and the signal peptide of these sequences is predicted by SignalP4.1 online. The results show that the signal peptide of the melissin protein has the best effect, so the signal peptide amino acid sequence of the melissin protein is used as a benchmark to modify the signal peptide region of the sequence. Specifically, the 19th-20th amino acids leucine and proline (L, P) of the original sequence are deleted and replaced with tyrosine, isoleucine, tyrosine and alanine (Y, I, Y, A), and the amino acid sequence of the optimized sequence of the antigen fusion protein is shown as SEQ ID NO. 7, and the nucleotide of the encoding gene is shown as SEQ ID NO. 8.

[0018] The present inventors also predict the antigen epitopes on the PEDV S protein, connect a predicted epitope peptide segment, six B cell linear epitope peptide segments and two universal T cell epitope peptide segments by using GGSSGG as a linker, and then connect the peptides SGG to the N terminus of the monomer ferritin subunit to form an antigen fusion protein only for epitope parts, and the amino acid sequence is shown as SEQ ID NO. 5, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 6.

[0019] Another aspect of the present application is to provide a mutant of the antigen fusion protein, which has improved expression amount or titer.

[0020] In a preferred embodiment of the present application, the mutant of the antigen fusion protein is that the 19th-20th amino acids leucine and proline (L, P) of the amino acid sequence shown as SEQ ID NO. 3 are deleted and replaced with tyrosine, isoleucine, tyrosine and alanine (Y, I, Y, A); wherein the amino acid sequence of the mutant is shown as SEQ ID NO. 7.

[0021] In order to further improve the expression amount or titer of the antigen fusion protein with the amino acid sequence shown in SEQ ID NO. 7, the amino acid sequence shown in SEQ ID NO. 7 is subjected to any one of the amino acid unit point mutation manners of L55F, P131Q, A158E, S179H, M206A, D225N, G255T, V283I, Y293L, T304D, L332V, P365L, R398K or N411D to obtain a unit point mutant; the expression amount or titer of the obtained unit point mutant is obviously improved compared with that of the mutant with the amino acid sequence shown in SEQ ID NO. 7.

[0022] The unit point mutant "L55F" of the present application means that the 55th amino acid of the antigen fusion protein with the amino acid sequence shown in SEQ ID NO. 7 is mutated from leucine (L) to phenylalanine (F); the rest of the unit point mutation of the present application is described in the same way.

[0023] In order to further improve the expression amount or titer of the antigen fusion protein with the amino acid sequence shown in SEQ ID NO. 7, the amino acid sequence shown in SEQ ID NO. 7 is subjected to any one of the amino acid multi-site mutation manners of A158E-D225N-G255T, A158E-T304D-L332V, D225N-G255T-L332V, D225N-G255T-P365L or A158E-L332V-P365L to obtain a multi-site mutant; the expression amount or titer of the obtained multi-site mutant is obviously improved compared with that of the mutant with the amino acid sequence shown in SEQ ID NO. 7.

[0024] The multi-site mutant "A158E-D225N-G255T" of the present application means that the 158th amino acid of the antigen fusion protein with the amino acid sequence shown in SEQ ID NO. 7 is mutated from alanine (A) to glutamic acid (E), the 225th amino acid is mutated from aspartic acid (D) to asparagine (N), and the 255th amino acid is mutated from glycine (G) to threonine (T); the rest of the multi-site mutation of the present application is described in the same way.

[0025] Another aspect of the present application is to provide the antigen fusion protein and the coding gene of the mutant of the antigen fusion protein.

[0026] The coding gene of the antigen fusion protein or the coding gene of the mutant of the antigen fusion protein is expressed in the silkworm expression system, and the expression product is observed by electron microscope after preliminary purification; the observation result shows that the product size is consistent with the expected nanometer particles, the diameter of the cage-shaped body is about 12 nanometers, and careful observation shows that there is an antenna-like protrusion.

[0027] Another aspect of the present application is to apply the coding gene to prepare PEDV self-assembled ferritin nanogenetic particles or to prepare a PEDV vaccine.

[0028] For reference, the present application provides a method for obtaining PEDV self-assembled ferritin nanogenetic particles by expressing the coding gene of the antigen fusion protein in eukaryotic cells using a eukaryotic expression system: cloning the coding gene of the antigen fusion protein or mutant into a baculovirus recombinant vector to construct a recombinant baculovirus recombinant vector; co-transfecting the recombinant baculovirus recombinant vector with baculovirus DNA into insect cells to obtain a recombinant baculovirus; infecting the insect host or insect cells with the recombinant baculovirus; and culturing the infected insect cells or insect host to express the corresponding antigen, which is then purified.

[0029] The present application further provides a vaccine for preventing and treating PEDV, comprising: a prophylactically or therapeutically effective amount of the homologous sequence of the PEDV S protein, the PEDV antigen fusion protein, the mutant of the PEDV antigen fusion protein, or the unit point mutant or multi-site mutant of the mutant of the PEDV antigen fusion protein, and a pharmaceutically acceptable immunoadjuvant and carrier.

[0030] The PEDV vaccine of the present application can be used by various routes, such as intramuscular, subcutaneous, intranasal, topical, sublingual, or oral.

[0031] The present application can display the PEDV S protein antigen protein structure on the surface of the pig ferritin cage structure, and the mouse immune results show that the neutralizing anti-PEDV antibody titer caused by the PEDV S protein antigen is not lower than the control. The epitope peptide antigen determinant provided by the present application can cause neutralizing anti-PEDV antibody, and the sequence conservation of the epitope peptide antigen determinant in different strains can increase the immune range of the vaccine, and can immunize different genetic strains of PEDV in different years.

[0032] The present application screens for the homologous sequence of PEDV S protein and fuses the homologous sequence with monomeric pig ferritin heavy chain subunit to obtain a fusion protein. In order to improve the expression amount or titer of the fusion protein, the obtained fusion protein is subjected to sequence optimization and then single-site or multi-site mutation, and the expression amount or titer of the obtained mutant is significantly improved. The present application expresses the recombinant protein by using a prokaryotic expression system, a silkworm and an AcMNPV-insect cell eukaryotic expression system. The vaccine provided by the present application causes a broad neutralizing anti-PEDV antibody by displaying the PEDV S protein on the surface of the pig ferritin cage structure. The present application does not involve a live harmful virus in the process of preparing the vaccine, and compared with the traditional attenuated live vaccine method, the operation is safer and simpler, and is suitable for rapid large-scale production; the present application can induce a PEDV antibody with broad spectrum, and lays a foundation for preparing a PEDV vaccine; the level of the anti-PEDV antibody induced by inoculating animals is obviously higher than that of the traditional vaccine.

[0033] Definitions of terms involved in the present invention

[0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this application belongs.

[0035] The terms "antigen" and "immunogen" are used interchangeably and refer to a molecule, substance, protein, glycoprotein, or live virus capable of inducing a specific humoral (antibody) and cellular immune response.

[0036] The term "immune response" refers to a humoral or antibody-mediated and cell-mediated immune response to an antigen, vaccine, or infectious agent; the term "vaccine" refers to a composition comprising an antigen for therapeutic treatment or prophylactic immunization against an infectious or non-infectious disease; the term "immunization" refers to an immune response produced by vaccination or infection that provides protection against an infectious or foreign agent. The term "potency" refers to the amount of antigen in an antigen preparation or vaccine as measured by a specified potency assay.

[0037] The terms "mutation" and "mutant" have their common meaning herein and refer to a genetic, naturally occurring or introduced change in a nucleic acid or polypeptide sequence, and have the same meaning as is commonly understood by one of skill in the art.

[0038] The term "host cell" or "recombinant host cell" means a cell which contains a polynucleotide of the present application, regardless of the manner in which the polynucleotide was inserted into the host cell, e.g., by direct uptake, transduction, f-pairing, or other means known in the art. The exogenous polynucleotide can be maintained as an episome, e.g., a plasmid, or can be integrated into the host genome.

[0039] The term "transfection" refers to the process by which eukaryotic cells acquire new genetic markers as a result of the incorporation of foreign DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Figure 1 is a Western blotting detection image of the expression product of PEDV S-BW-FE in the silkworm expression system; among them, 1 is the PEDV S-BW-FE silkworm expression product, and 2 is the Luc silkworm expression product as a negative control group.

[0041] Figure 2 The following are Western blotting detection images of various expression products in the silkworm expression system; among them, 1 is the PEDV S-FE-C-D225N-G255T-P365L silkworm expression product, 2 is the PEDV S silkworm expression product, and 3 is the Luc silkworm expression product as a negative control group.

[0042] Figure 3 This is an electron micrograph of the expression product of PEDV S-FE-C-D225N-G255T-P365L in the silkworm expression system. DETAILED DESCRIPTION

[0043] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0044] 1 Experimental materials and reagents

[0045] 1.1 Main instruments and equipment

[0046] The main instruments and equipment used in the experiment are shown in Table 1.

[0047] Table 1 Instruments and equipment

[0048]

[0049] 1.2 Materials and Reagents

[0050] The materials and reagents used in the experiment are shown in Table 2.

[0051] Table 2 Materials and reagents

[0052]

[0053] 1.3 Vectors, viral strains, cells and experimental animals

[0054] Recombinant vector pBR, E. coli Strain TOP10, BmN cells, Vero cells, VSV-GFP virus, were preserved and provided by the Institute of Biotechnology, Chinese Academy of Agricultural Sciences; the test silkworm variety JY1 was provided by Jiangsu University of Science and Technology Sericultural Institute, and the parent virus BmBac DNA was constructed according to the method disclosed in the literature (Patent Announcement No. CN 102286534 B).

[0055] The animal experiment of the nano vaccine constructed by fusing PEDV with ferritin was carried out in an isolated laboratory.

[0056] 2 Preparation of solutions and media

[0057] The preparation method of the solutions and media refers to the relevant tool books (Joseph et al., Molecular Cloning Laboratory Guide, Third Edition, 2002; Ausubel, et al., Guide to Molecular Biology, 1998).

[0058] Test Example 1 Preparation of PEDV S antigen epitope polyclonal antibody and nano particle vaccine

[0059] 1 Synthesis of PEDV S protein antigen epitope gene sequence

[0060] 1.1 Composition of the original sequence of PEDV S protein antigen epitope and ferritin fusion protein

[0061] The antigen epitopes on the PEDV S protein were predicted by the BepiPred-3.0 antigen epitope prediction tool, and were compared with the screened epitopes, and finally the B cell linear epitopes (KRSFIEDLLFNKV (SEQ ID NO. 9), GPRLQPY (SEQ ID NO. 10), TSLLASACTIDLFGYP (SEQ ID NO. 11), SSTFNSTREL (SEQ ID NO. 12), MQYVYEPTYYML (SEQ ID NO. 13), YSNIGVCK (SEQ ID NO. 14)), predicted epitopes (PSIKTLGPTANNDVTTGRN (SEQ ID NO. 15)) and universal T cell epitopes (AKFVAAWTLKAAA (SEQ ID NO. 16) and TAKSKKFPSYTATYQF (SEQ ID NO. 17)) were selected, and GGSSGG (SEQ ID NO. 18) was used as a linker for connection. The first 18 amino acids of ferritin were removed, and the multi-epitope peptide segment after the linker and the N terminus of the monomer ferritin subunit were connected by SGG.

[0062] 1.2 PEDV S protein antigen epitope and ferritin fusion protein gene sequence optimization

[0063] On this basis, the present application further optimizes the amino acid sequence of the fusion protein by OptimumGene TM technology, and the optimized S protein amino acid sequence and ferritin monomer subunit amino acid sequence are modified according to the codon preference of the silkworm. In order to improve the translation initiation efficiency of the target gene in the silkworm baculovirus eukaryotic expression system, the Kozak sequence ATCAAC is added in front of the gene, and in order to improve the translation termination efficiency, the termination codon is changed to TAA. In addition, the restriction enzyme cutting sites such as Bam HI, Eco RI and the like are removed, and Bam HI is added upstream of the gene, and Eco RI restriction enzyme cutting sites are added downstream of the gene, so as to be subsequently cloned into the eukaryotic recombinant vector pBR.

[0064] The optimized amino acid sequence is shown as SEQ ID NO. 5, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 6. The determined gene sequence is synthesized by a company, and is inserted into a pUC57 vector to form a plasmid pUC57-PEDV S-BW-FE.

[0065] 2. Expression of PEDV S antigen epitope peptide segment and preparation of polyclonal antibody by using a prokaryotic expression system

[0066] In order to obtain the nucleotide sequence of PEDV S-BW, PCR amplification is performed on the pUC57-PEDV S-BW-FE plasmid as a template and recombined with the prokaryotic expression vector pET28a (+). The primer information is as follows:

[0067] F: AAGCTTGTCGACGGAGCTCGAATTCCGAAATTGGTAGGTAGCGGTAT (SEQ ID NO. 19);

[0068] R: GTGGACAGCAAATGGGTCGCGGATCCAAAAGGTCATTCATAGAAGATCTATTATT (SEQ ID NO. 20).

[0069] The specific PCR reaction process is performed according to the conventional molecular cloning manual (literature).

[0070] The positive band of the PCR electrophoresis is recovered by gel recovery, and the gel recovery product and Bam HI and EcoThe double enzyme digestion of Rl and the homologous recombination with the prokaryotic expression vector pET28a (+) were performed.

[0071] The recombinant product was transformed into E. coli competent cells TOP10, and the colonies were selected and cultured. The plasmid was extracted, and the Bam HI and Eco The positive clones were identified by double enzyme digestion of Rl, and the correctly identified recombinant plasmid was sent to the company for sequencing. The correctly sequenced plasmid was named pET28a-PEDV S-BW.

[0072] According to the general method in the prokaryotic expression system of E. coli, the expression of His-S-BW protein was performed, and further protein purification was performed. After determination by BCA method, the expression amount was 584 μg / mL. After immunizing mice, polyclonal antibodies were obtained, which were used for subsequent protein qualitative and quantitative test.

[0073] 3 Construction of eukaryotic recombinant vector plasmid pBR-PEDV S-BW-FE

[0074] The synthesized plasmid pUC57-PEDV S-BW-FE was treated by double enzyme digestion of HI and RI. Bam HI and Eco The positive clones were identified by double enzyme digestion of Rl, and the correctly identified recombinant plasmid was sent to the company for sequencing. The correctly sequenced plasmid was named pET28a-PEDV S-BW. Bam HI and Eco The positive clones were identified by double enzyme digestion of Rl, and the correctly identified recombinant plasmid was sent to the company for sequencing. The correctly sequenced plasmid was named pET28a-PEDV S-BW.

[0075] 4 Expression and purification of recombinant protein in silkworm eukaryotic expression system

[0076] 4.1 Construction and acquisition of recombinant silkworm baculovirus rBmBacmid (P PH -pBR-PEDV S-BW-FE)

[0077] About 1×10 6 cells were inoculated in a 15 cm 2 culture bottle. After the cells adhered, the culture medium containing fetal bovine serum (FBS) was removed, and the cells were washed three times with FBS-free medium, and 1.5 mL of FBS-free medium was added. 1 μg of silkworm baculovirus parent strain BmBacmid DNA (Patent Announcement No. CN 102286534 B) and 2 μg of recombinant transfer plasmid (PPH -pBR-PEDV S-BW-FE)and 5 μL liposome, the volume was made up to 60 μL with sterile double distilled water, mixed gently, and after 15 min, added dropwise to the culture bottle for co-transfection. After 4 h incubation at 27℃, 1.5 mL serum-free medium and 300 μL FBS were added. Incubate at 27℃ for 4-5 days, collect the supernatant for screening of recombinant virus rBmBacmid (P PH -pBR-PEDV S-BW-FE). A suitable amount of cells (about 70-80%) were inoculated in a 35 mm dish, after the cells adhered, the medium was removed, and the co-transfection supernatant was diluted to different concentrations, 1 mL of the co-transfection liquid was added to the adherent cells, and distributed evenly. After 1 h of infection at 27℃, the infection liquid was removed, 2% low-melting-point agarose gel was melted in a 60℃ water bath, cooled to 40℃, mixed with 2×TC-100 medium (containing 20% FBS) preheated at 40℃, and evenly distributed in each dish. After solidification, the dish was sealed with Parafilm, and incubated at 27℃ for 3-5 d, and the plaques without polyhedra were selected under a microscope. The above steps were repeated, and after 2-3 rounds of purification, pure recombinant silkworm baculovirus rBmBacmid (P PH -pBR-PEDV S-BW-FE)was obtained.

[0078] 4.2 Amplification of recombinant virus rBmBacmid (P PH -pBR-PEDV S-BW-FE)in silkworm cells

[0079] The recombinant silkworm baculovirus rBmBacmid (P PH -pBR-PEDV S-BW-FE)was infected with normal growing BmN cells, and after 3-5 days of culture, the supernatant was collected, which contained a large amount of recombinant virus rBmBacmid (P PH -pBR-PEDV S-BW-FE).

[0080] 4.3 Identification of recombinant virus

[0081] 200 μL of the recombinant virus supernatant was taken, and the recombinant virus DNA was extracted according to the steps of the Genomic DNA Extraction Kit for Viruses. The extracted viral genomic DNA was subjected to PCR amplification. 15 μL of the reaction product was subjected to electrophoresis analysis, and the results proved that the recombinant virus had been obtained.

[0082] 4.4 Expression of PEDV S-BW-FE in silkworms and pupae

[0083] The used silkworm pupae are high expression varieties JY1 (stored in the inventor's laboratory). The rearing method of JY1 variety silkworm is carried out according to the conventional method in "Chinese Sericulture" (Shanghai Scientific and Technical Publishers, 1991) edited by Lv Hongsheng. After feeding for 48 h, silkworms with the same average weight and 15 silkworm pupae with the same average weight after cocooning for 7 days are selected, and about 1.0 x 10 5 pfu rBmBacmid (P PH -pBR-PEDV S-BW-FE), and the diseased silkworm pupae and silkworm blood are collected after 4-5 d, and the samples are stored at -20℃ for subsequent experiments. The expression amount is 713 μg / mL detected by ELISA method, and the animal experiment evaluation results are shown in Test Example 5.

[0084] 5 Western blotting detection

[0085] The corresponding eukaryotic recombinant expression product is subjected to SDS-PAGE gel electrophoresis, the concentration of the concentrated gel is 5%, and the concentration of the separation gel is 15%. Then, the semi-dry transfer method is used to transfer the protein to a polyvinylidene fluoride (PVDF) membrane, 3% BSA is prepared with PBST for blocking, the serum of the mouse immunized with the prokaryotic expressed His-PEDV S-BW protein is used as the primary antibody (1:1000 dilution), the HRP-labeled goat anti-mouse IgG is used as the secondary antibody (1:5000 dilution), and finally DAB (diaminobenzidine) is used for color development, and deionized water is used for termination to detect the results. The results of Western blotting are shown in Figure 1 The recombinant expression product can detect a specific band of 36.7 kDa in size, indicating that the PEDV S-BW-FE protein is successfully expressed.

[0086] Test Example 2 Preparation and efficacy detection of the nanoparticle vaccine of PEDV S and PEDV S-FE with sequence optimization and signal peptide mutation

[0087] 1 Synthesis of PEDV S protein gene sequence and ferritin gene sequence

[0088] 1.1 Original sequence composition of PEDV S protein and ferritin fusion protein

[0089] By analyzing and comparing the S protein amino acid sequences of 20 PEDV strains prevalent in different regions in recent years, a most common homologous sequence is found, which is shown in SEQ ID NO. 1, and is used as the antigen gene of the corresponding strain, so as to obtain the best protection effect. The monomeric ferritin subunit selected in the test is a porcine ferritin monomer, and the amino acid sequence is shown in SEQ ID NO. 2.

[0090] In order to better express the fusion of PEDV S protein and ferritin, the amino acid sequence of PEDV (QD1803-2) S protein is analyzed by transmembrane domain analysis software (TMHMM), and the transmembrane region of PEDV S protein is obtained as 1328-1350, which has 23 amino acids, and the extracellular domain is 1327 amino acids; the signal peptide region is 1-18. The amino acid sequence of PEDV S protein is removed from the transmembrane region and intracellular region, the ferritin is removed from the first 18 amino acids, and the N terminal of the processed PEDV S protein and monomer ferritin subunit is connected by SGG.

[0091] 1.2 Gene sequence optimization of PEDV S protein and ferritin fusion protein

[0092] The specific experimental method is the same as that of Test Example 1.

[0093] The amino acid sequence of this fusion protein is shown in SEQ ID NO. 3, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO. 4. The determined gene sequence is synthesized by a company and inserted into a pUC57 vector to form a plasmid pUC57-PEDVS-FE.

[0094] In the sequence analysis process, it is found that the signal peptide of the sequence has multiple cutting peaks. In view of the previous finding that the cutting site of the signal peptide affects the expression efficiency of the exogenous protein, the application decides to mutate the signal peptide region of the sequence. A large number of amino acid sequences of mammalian and insect proteins are collected from NCBI, and SignalP4.1 online is used for signal peptide prediction of these sequences. The results show that the signal peptide of the melissaein protein has the best effect, so the signal peptide region of the sequence is modified based on the amino acid sequence of the signal peptide of the melissaein protein. That is, the 19-20 amino acids of leucine and proline (L, P) in the original sequence are deleted and replaced with tyrosine, isoleucine, tyrosine and alanine (Y, I, Y, A), which is named pUC57-PEDV S-FE-C. The optimized amino acid sequence is shown in SEQ ID NO. 7, and the nucleotide of the encoding gene is shown in SEQ ID NO. 8.

[0095] 2 Construction and detection of eukaryotic recombinant vector plasmid

[0096] 2.1 Construction of pBR-PEDV S-FE eukaryotic recombinant vector plasmid

[0097] The specific experimental method is the same as that of Test Example 1, and the plasmid with correct sequencing is named pBR-PEDV S-FE.

[0098] 2.2 Construction of pBR-PEDV S eukaryotic recombinant vector plasmid

[0099] In order to obtain the nucleotide sequence of PEDV S, the pBR-PEDV S-FE plasmid is used as a template for PCR amplification and recombination with the baculovirus recombinant vector pBR. The nucleotide sequence of the primer is as follows:

[0100] F: GGC GCG GAT CCA TCA ACA TGA AGT TTC T (SEQ ID NO. 21);

[0101] R: GCC GCT CCG GAA TTC TTA CGG CCA TTG ATG TAG GTT TCC ACA CG (SEQ ID NO. 22).

[0102] The specific experimental method is the same as that of Test Example 1.

[0103] The recombinant product is transformed into E. coli competent cells TOP10, and the colonies are selected and cultured, and the plasmid is extracted, and the Bam HI and Eco RІ double enzyme digestion is used to identify positive clones, and the correct recombinant plasmid is sent to the company for sequencing. The correct plasmid is named pBR-PEDV S.

[0104] 2.3 pBR-PEDV S-FE-C eukaryotic recombinant vector plasmid construction

[0105] In order to obtain the nucleotide sequence of the signal peptide mutation, the pBR-PEDV S-FE plasmid is used as a template for mutation PCR amplification and recombination with the baculovirus recombinant vector pBR. The nucleotide sequence of the primer is as follows:

[0106] (1) The upper and lower upstream primers are as follows:

[0107] F: AAC AGC AAG ATC AAT ATG CCT CCG T (SEQ ID NO. 23);

[0108] R: AAT TCT TAG GAC TCG CTG CTG CC (SEQ ID NO. 24).

[0109] (2) The upper and lower intermediate primers are as follows:

[0110] F: CCG GTG CTG AGC ACT TTA TCG TAC ATT TAC GCA (SEQ ID NO. 25);

[0111] R: TGC GTA AAT GTA CGA TAA AGT GCT CAG CAC CGG (SEQ ID NO. 26).

[0112] The specific experimental method is the same as that of Test Example 1.

[0113] The recombinant product was transformed into E. coli competent cells TOP10, the colonies were selected and cultured, the plasmid was extracted, and the Bam HI and Eco R1 double enzyme digestion identified positive clones, and the correctly identified recombinant plasmid was sent to a company for sequencing. The correctly sequenced plasmid was named pBR-PEDV S-FE-C.

[0114] 3 Expression and purification of recombinant proteins in silkworm eukaryotic expression system

[0115] The specific experimental method was the same as in Test Example 1.

[0116] 4 Western blotting detection

[0117] The specific experimental method was the same as in Test Example 1, except that the primary antibody was a rabbit-derived S protein monoclonal antibody, and the secondary antibody was an HRP-labeled goat anti-rabbit IgG.

[0118] The Western blotting results showed that specific bands of 164 kDa (PEDV S-FE / PEDV S-FE-C) and 146 kDa (PEDV S) sizes could be detected in the supernatant of the silkworm hemolymph sample after infection with the recombinant virus.

[0119] 5 ELISA detection

[0120] The silkworm hemolymph sample to be tested was diluted with coating solution, and a silkworm blood sample infected with the parent virus was set as a negative control, and only coating solution was added as a blank control. A suitable amount of commercial standard PEDV-S protein was used as a quantitative positive control. 100 μL was added to each well of the enzyme-labeled plate and incubated at 4°C overnight. The liquid in the wells was quickly discarded and washed with PBST for 3 times. 300 μL of 3% BSA blocking solution was added to each well, and incubated at 37°C for 3 h, and washed with PBST for 3 times. The laboratory-prepared His-FE polyclonal antibody was diluted 1:1000, and 100 μL was added to each well, and incubated at 37°C for 1.5 h, and washed with PBST for 4 times. 100 μL of HRP-labeled goat anti-rabbit (1:5000) was added to each well, and incubated at 37°C for 45-60 min, and washed with PBST for 4 times. 100 μL of freshly prepared OPD (o-phenylenediamine) developing solution was added, and developed at room temperature in the dark for 10-30 min. 50 μL of 2 M sulfuric acid was added to each reaction well to stop the reaction. The OD value was measured at a wavelength of 492 nm on an enzyme-labeled instrument. The OD value of each well was measured after the blank control well was adjusted to zero. The P / N value (the OD value of the positive well minus the OD value of the blank control well / the OD value of the negative well) was greater than or equal to 2.1.

[0121] ELISA result determination: P / N value (OD value of positive well minus OD value of blank control well / OD value of negative well) greater than or equal to 2.1 is positive. The results are shown in Table 3, the ELISA titer of commercial PEDV S is 3200; the ELISA titer of PEDV S-FE-C gene expression product is 1000; the relative expression amount is 165 μg / mL according to the value of the positive control.

[0122] Table 3 ELISA titer and expression amount of expression product of PEDV S-FE original sequence after sequence optimization and signal peptide mutation in Bombyx mori

[0123]

[0124] Test Example 3 Preparation and efficacy detection of nanoparticle vaccine of PEDV S-FE-C mutant after amino acid unit point mutation

[0125] 1 Construction of PEDV S-FE-C amino acid sequence unit point mutant gene

[0126] Based on the results of Test Example 2, PEDV S-FE-C mutants were further obtained, and a plurality of primers were designed for site-directed mutation of the conserved sequence based on the codon-optimized gene sequence of PEDV S-FE-C mutant as a template. The site-directed mutation was performed by fusion PCR, and the method of fusion PCR was performed according to the method described by Qiang Fiting et al. (A new method for vector construction: recombinant fusion PCR, Genomics and Applied Biology, 2012, Vol. 31, No. 6, pp. 634-639).

[0127] The mutation sites were PEDV: L55F, P131Q, A158E, S179H, M206A, D225N, G255T, V283I, Y293L, T304D, L332V, P365L, R398K, N411D. The obtained mutant was named PEDV S-FE-C-X (L55F, P131Q, A158E, S179H, M206A, D225N, G255T, V283I, Y293L, T304D, L332V, P365L, R398K, N411D).

[0128] PEDV-S-FE-C-X was expressed in the Bombyx mori eukaryotic expression system and the AcMNPV-insect cell expression system.

[0129] The nucleotide sequences of the primers required for amino acid unit point mutation of PEDV S-FE-C are shown in Table 4:

[0130] Table 4 Nucleotide sequences of primers required for amino acid unit point mutation of PEDV S-FE-C

[0131]

[0132] The specific experimental method is the same as that in Test Example 1.

[0133] The recombinant product was transformed into E. coli competent cells TOP10, the colonies were selected and cultured, plasmids were extracted, and the positive clones were identified by double enzyme digestion of HI and RI. Bam HI and Eco RI double enzyme digestion, the correct recombinant plasmid was sent to the company for sequencing, and the correct plasmid was named pBR-PEDV S-FE-C-X (L55F, P131Q, A158E, S179H, M206A, D225N, G255T, V283I, Y293L, T304D, L332V, P365L, R398K, N411D).

[0134] 2 Plasmid construction and identification of PEDV-S-FE-C-X amino acid sequence unit point mutant

[0135] The specific experimental method is the same as that in Test Example 1.

[0136] 3 Expression and purification of recombinant protein in silkworm eukaryotic expression system

[0137] The specific experimental method is the same as that in Test Example 1.

[0138] 4 Western blotting detection

[0139] The specific experimental method is the same as that in Test Example 1.

[0140] The Western blotting results show that a specific band of 164 kDa size can be detected in the supernatant of the blood lymph sample of silkworm after infection with the recombinant virus.

[0141] 5 ELISA detection

[0142] The specific experimental method is the same as that in Test Example 2.

[0143] ELISA result determination standard: P / N value (OD value of positive well minus OD value of blank control well / OD value of negative well) greater than or equal to 2.1 is positive, and the highest single mutant ELISA value is about 2200.

[0144] From the data of Table 5, it can be seen that on the basis of the optimized homologous sequence with the transmembrane region removed, the expression amount of the expression product of the six single mutants (A158E, D225N, G255T, T304D, L332V, P365L) was obviously improved compared with the expression amount of the homologous sequence with the transmembrane region removed, and the expression amount of mutant D225N was the highest, reaching 364 μg / mL.

[0145] Table 5 ELISA titer and expression amount of PEDV S-FE-C-X mutant expression product in Bombyx mori

[0146]

[0147] Note: Only the mutants with obvious effects are listed in the table.

[0148] 6 Electron microscope observation

[0149] A certain amount of 1% uranyl acetate was taken with a 1 mL syringe and another syringe was used to take a certain amount of distilled water. After the nanoparticles of silkworm hemolymph were preliminarily purified, the suspension was diluted, the suspension sample was dropped on the parafilm to form a small droplet, the net was clamped with the tip of the forceps with the membrane side facing down, the sample was taken, and then the excess suspension was absorbed with filter paper, and the cleaning was repeated 5 times. After being absorbed, the net was placed in the droplet of 1% uranyl acetate staining solution, and the staining was performed for 3 minutes. The excess staining solution was absorbed from the edge of the copper net with filter paper, and the operation was repeated 2-3 times. After drying, the sample was observed under a microscope.

[0150] Test Example 4 Preparation and efficacy detection of nanoparticle vaccine of PEDV S-FE-C mutant after amino acid multi-site mutation

[0151] 1 Construction of PEDV S-FE-C-X amino acid sequence multi-site mutant gene

[0152] In view of the results of Test Example 3, it was determined that the mutation of some sites was effective mutation. Considering that the arrangement order of amino acids is the primary structure of a protein and determines the higher structure of the protein, and the position of some mutant sites in the amino acid unit point mutation in Test Example 3 may be correlated, amino acid multi-site mutation was attempted. On the basis of the unit point mutation sequence obtained in Test Example 2, the codon-optimized gene sequence of PEDV S-FE-C mutant was used as a template, and the corresponding primers (see Test Example 3) were used to perform the second and third site-directed mutation by fusion PCR. The site-directed mutation was performed by fusion PCR, and the method of fusion PCR was the same as that in Test Example 3.

[0153] The mutation sites are PEDV: A158E-D225N-G255T, A158E-T304D-L332V, D225N-G255T-L332V, D225N-G255T-P365L, and A158E-L332V-P365L. The obtained mutants are named PEDV S-FE-C-X-Y-Z (A158E-D225N-G255T, A158E-T304D-L332V, D225N-G255T-L332V, D225N-G255T-P365L, and A158E-L332V-P365L).

[0154] PEDV-S-FE-C-X-Y-Z is expressed in the silkworm eukaryotic expression system and the AcMNPV-insect cell expression system.

[0155] The recombinant product is transformed into E. coli competent cells TOP10, the colonies are selected and cultured, the plasmid is extracted, and the Bam HI and Eco The positive clones are identified by double enzyme digestion of RІ, and the correct recombinant plasmid is sent to a company for sequencing. The plasmid with correct sequencing is named pBR-PEDV S-FE-C-X-Y-Z (A158E-D225N-G255T, A158E-T304D-L332V, D225N-G255T-L332V, D225N-G255T-P365L, and A158E-L332V-P365L).

[0156] 2 Plasmid construction and identification of PEDV-S-FE-C-X amino acid sequence multi-site mutant

[0157] The specific experimental method is the same as that in Test Example 1.

[0158] 3 Expression and purification of recombinant protein in silkworm eukaryotic expression system

[0159] The specific experimental method is the same as that in Test Example 1.

[0160] 4 Western blotting detection

[0161] The specific experimental method is the same as that in Test Example 1.

[0162] The Western blotting results are shown in Figure 2 A specific band of 164 kDa can be detected in the supernatant of the silkworm hemolymph sample after infection with the recombinant virus PEDV S-FE-C-D225N-G255T-P365L.

[0163] 5 ELISA detection

[0164] The specific experimental method is the same as that of Test Example 2.

[0165] ELISA result determination criteria: P / N value (OD value of positive well minus OD value of blank control well / OD value of negative well) greater than or equal to 2.1 is positive, and the highest multi-mutant ELISA value is about 4096.

[0166] On the basis of single mutation, multi-site mutation was carried out to obtain 5 multi-mutants (A158E-D225N-G255T, A158E-T304D-L332V, D225N-G255T-L332V, D225N-G255T-P365L, A158E-L332V-P365L). As can be seen from the data in Table 6, one of the multi-mutants (D225N-G255T-P365L) has the highest expression amount, reaching 563 μg / mL.

[0167] Table 6 ELISA titer and expression amount of PEDV S-FE-C-X-Y-Z mutant expression product in Bombyx mori

[0168]

[0169] Note: Only mutations with obvious effects are listed in the table.

[0170] 6 Electron microscope observation

[0171] The specific experimental method is the same as that of Test Example 2. The electron microscope results of PEDV S-FE-C-D225N-G255T-P365L expression product in the Bombyx mori expression system are shown in Figure 3 It can be seen that the product size is consistent with the expected nanometer particles, and the diameter of the cage body is about 12 nanometers. Careful observation shows that there are antenna-like protrusions.

[0172] Test Example 5 Animal experiment and virus neutralization experiment

[0173] 1 Inoculation of PEDV S-BW-FE, PEDV S-FE-C, PEDV S-FE-C-D225N, PEDV S-FE-C-D225N-G255T-P365L expression product into animals

[0174] The PEDV S-BW-FE, PEDV S-FE-C, PEDV S-FE-C-D225N, PEDV S-FE-C-D225N-G255T-P365L expression products obtained in the Bombyx mori eukaryotic expression system were quantified, and each type of vaccine was prepared for immunizing animals in an equal molar ratio of the amount of the target protein. The preparation method is as follows:

[0175] Respectively, take the antigen or nanoparticle antigen containing the corresponding expression amount of crude product, add 90 mL PBS buffer, stir with a stirrer for 5-10 min to make it fully mixed, prepare the mother liquor into a sterile bottle. 206 adjuvant is sterilized in advance and placed in a 30°C incubator. The appropriate amount of mother liquor is placed on ice and adjusted. When mixed with the adjuvant, first add 3 mL of adjuvant to a 15 mL centrifuge tube, slowly add 3 mL of mother liquor, and homogenize for 3 min with a homogenizer. Add ciprofloxacin hydrochloride. The vaccine is milky white, and a small amount can be taken out for quality detection. 3000 rpm centrifugation for 15 min, the vaccine does not separate, and it is qualified. The same method is used to process healthy silkworm pupae crude product to prepare vaccine as a control.

[0176] 2 ELISA detection

[0177] The specific experimental method is the same as that of Test Example 1.

[0178] The antibody titer of the experimental animal was determined using the prokaryotic protein pET-28a-PEDV S-BW-FE as the antigen, and the specific results are shown in Table 7.

[0179] Table 7 Antibody titer detection of immunized mouse serum (21 days)

[0180]

[0181] 3 Virus neutralization experiment

[0182] Table 8 Neutralizing antibody titer detection of immunized mouse serum (21 days)

[0183]

[0184] The prepared Vero E6 was inoculated in a 96-well plate at 100 μL / well and cultured at 37°C overnight. The test serum was diluted 2 times with serum-free DMEM medium. Then, the same amount of 100 TCID50 of virus solution was added to each dilution of the test serum, and then the mixed sample was placed in a 37°C incubator for 1 h. 200 μL of mixed sample was taken from each tube and added to the cells. The virus infection was observed daily, and the cells showed obvious lysis, aggregation and other phenomena after virus infection. When the antibody can completely inhibit the virus amplification, the cells do not occur pathological changes, and the number of virus infected cell wells is recorded. The neutralization value of the test serum is calculated according to the Reed-Muench method, and the results are shown in Table 8. The results of mouse immunization show that the neutralizing anti-PEDV antibody titer caused by the S protein mutant antigen is not lower than that of the control S, and the epitope peptide antigen determinant can cause high neutralizing anti-PEDV antibody.

Claims

1. A mutant of porcine epidemic diarrhea virus antigen fusion protein, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

7.

2. The single-site mutant or multi-site mutant of the mutant of the porcine epidemic diarrhea virus antigen fusion protein according to claim 1, characterized in that: The single-site mutant is a single-site mutant obtained by mutating the amino acid sequence shown in SEQ ID NO. 7 by any one of A158E, D225N or G255T. The multi-site mutant is a multi-site mutant obtained by subjecting the amino acid sequence shown in SEQ ID NO. 7 to multi-site mutations of D225N-G255T-P365L.

3. A porcine epidemic diarrhea virus antigen fusion protein, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

5.

4. The gene encoding the mutant according to claim 1, or the gene encoding the single-site mutant or multi-site mutant according to claim 2.

5. Use of the coding gene according to claim 4 in preparing porcine epidemic diarrhea virus antigen.

6. The use according to claim 5, characterized in that include: expressing the coding gene according to claim 4 in a prokaryotic expression system, and collecting and purifying the expressed antigen; Alternatively, the coding gene according to claim 4 is expressed in eukaryotic cells using a eukaryotic expression system, comprising: constructing the coding gene into a Bombyx mori baculovirus expression vector to prepare a recombinant Bombyx mori baculovirus; amplifying the recombinant Bombyx mori baculovirus in Bombyx mori cells and then expressing it in Bombyx mori or silkworm pupae; or cloning the coding gene into a baculovirus recombinant vector to construct a recombinant baculovirus recombinant vector; co-transfecting the recombinant baculovirus recombinant vector and baculovirus DNA into insect cells to obtain a recombinant baculovirus; infecting an insect host or insect cells with the recombinant baculovirus, culturing the infected insect cells or insect host to express the corresponding antigen, and purifying the antigen.

7. A porcine epidemic diarrhea vaccine, characterized in that: Comprising an effective amount of a mutant of the porcine epidemic diarrhea virus antigen fusion protein of claim 1, a single-site mutant or a multi-site mutant of the mutant of the porcine epidemic diarrhea virus antigen fusion protein of claim 2, or the porcine epidemic diarrhea virus antigen fusion protein of claim 3, and a pharmaceutically acceptable immune adjuvant or carrier.

Images