Application of the apple C2H2 zinc finger protein transcription factor MdZAT1 gene in anthocyanin synthesis

By applying the MdZAT1 gene, a transcription factor for the C2H2 zinc finger protein in apples, the synthesis of anthocyanins in apple fruits was regulated, which solved the problem of poor appearance quality of apple fruits, realized the regulation of fruit color and variety improvement, and provided a theoretical basis for molecular breeding.

CN120005902BActive Publication Date: 2025-10-31QINGDAO AGRI UNIV +1
0 Cites 0 Cited by

Patent Information

Application Number
CN202510169130.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-17
Publication Date
2025-10-31
Estimated Expiration
2045-02-17

Smart Images

  • Figure CN120005902B_ABST
    Figure CN120005902B_ABST
Patent Text Reader

Abstract

This invention discloses the application of the apple C2H2 zinc finger protein transcription factor MdZAT1 gene in anthocyanin synthesis, belonging to the field of plant genetic engineering technology. This invention isolates a C2H2 zinc finger protein transcription factor MdZAT1 gene from apples and experimentally reveals a negative correlation between MdZAT1 gene expression and anthocyanin content in apple fruit during development. Overexpression of MdZAT1 in apple callus tissue inhibits anthocyanin synthesis; transient overexpression and silencing experiments in apple peel show that MdZAT1 is a negative regulator of anthocyanin accumulation in apple peel. Yeast one-hybrid assays, EMSA, and dual-luciferase assays verify that MdZAT1 protein binds to and negatively regulates MdMYB114, MdCHI, and MdANS. The MdZAT1 gene has practical application value in regulating anthocyanins in apple fruit, providing a basis for improving the appearance and quality of apple fruit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of the apple C2H2 zinc finger protein transcription factor MdZAT1 gene in anthocyanin synthesis. Background Technology

[0002] Apples are one of my country's most important economic fruit trees, ranking first in both planting area and yield. While China's apple industry has developed significantly, its overall competitiveness remains weak, and the overall quality of the fruit is subpar. Fruit coloring affects the appearance of the fruit, primarily depending on anthocyanins. Anthocyanins give plants different colors, helping to attract insects and birds for pollination and attracting animals to disperse seeds. Anthocyanins also protect plants from low temperatures, high light, fungi, and other microorganisms. In addition to these effects, anthocyanins also act as natural antioxidants, scavenging free radicals and reactive oxygen species in cells, which is highly beneficial to human health. Therefore, research on apple anthocyanins is of great significance.

[0003] The direct precursor of anthocyanin synthesis is phenylalanine. The pathway from phenylalanine to anthocyanin involves a series of enzymes. Genes encoding these enzymes are called structural genes, which can be further divided into early and late structural genes. Early structural genes include chalcone synthase (CHS), chalcone isomerase (CHI), and flavanone 3-hydroxylase (F3H), while late structural genes include dihydroflavonoid 4-reductase (DFR), anthocyanin synthase (ANS), and flavonoid glucoside transferase (UFGT). Anthocyanin synthesis is regulated by transcription factors, which primarily regulate anthocyanin biosynthesis by modulating the expression of structural genes. Currently, the MYB / bHLH / WD40 (MBW) complex is the most studied. For example, in Arabidopsis thaliana, GbMYBF2 can negatively regulate anthocyanin biosynthesis by downregulating the expression of structural genes CHS, F3H, ANS and FLS; in apple, the homologous MYB1, MYB10 and MYBA participate in anthocyanin biosynthesis and positively regulate anthocyanin accumulation.

[0004] Limited understanding exists regarding the molecular mechanisms of C2H2 zinc finger transcription factors and anthocyanins. C2H2 zinc finger transcription factors constitute the largest zinc finger family in plants. Increasing research indicates that C2H2 zinc finger transcription factors also participate in anthocyanin biosynthesis. For example, in Arabidopsis thaliana, AtZAT6 positively regulates anthocyanin biosynthesis by activating the transcription of AtDFR, AtMYB12, and AtMYB111, thereby promoting their expression. In pear, the C2H2 zinc finger protein PpZAT5, acting as a transcriptional repressor, inhibits anthocyanin accumulation by regulating the expression of PpBBX18. Furthermore, PbZAT12 can upregulate the expression of PbDFR, PbANS, and PbUFGT genes, promoting anthocyanin accumulation in pear. In apple callus, MdZAT5 can activate the expression of genes related to anthocyanin biosynthesis, promoting anthocyanin biosynthesis. Previous studies have found that the MYB transcription factor MdMYB114 can promote the accumulation of anthocyanins in callus tissue. Research indicates that MdMYB114 can activate the expression of anthocyanin-related genes MdANS, MdUFGT, and MdGST, positively regulating not only anthocyanin biosynthesis but also anthocyanin transport. MdMYB114 is considered another important regulator of apple anthocyanins besides MdMYB1. To investigate the upstream regulatory mechanism of MdMYB114, the inventors conducted a yeast single-hybrid screening library experiment, screening a C2H2 type zinc finger protein named MdZAT1. Whether this protein regulates anthocyanin biosynthesis through MdMYB114 requires further investigation.

[0005] In view of the above-mentioned shortcomings, this invention was obtained through the creator's long-term research and practice. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the apple C2H2 zinc finger protein transcription factor MdZAT1 gene in anthocyanin synthesis, so as to solve the problems existing in the prior art. The MdZAT1 gene is negatively correlated with the synthesis of anthocyanins in apple fruit, which provides a theoretical basis for improving and enhancing the appearance quality of apple fruit.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides the application of the apple C2H2 zinc finger protein transcription factor MdZAT1 gene in any of the following:

[0009] (1) Application in regulating anthocyanin synthesis in apple fruit;

[0010] (2) Application in regulating the appearance quality of apple fruits;

[0011] (3) Application in apple variety improvement;

[0012] The nucleotide sequence of the MdZAT1 gene is the sequence shown in SEQ ID NO.1 or a fragment thereof.

[0013] This invention also provides the use of the protein encoding the MdZAT1 gene in any of the following:

[0014] (1) Application in regulating anthocyanin synthesis in apple fruit;

[0015] (2) Application in regulating the appearance quality of apple fruits;

[0016] (3) Application in apple variety improvement.

[0017] The present invention also provides the use of a vector containing the MdZAT1 gene in any of the following:

[0018] (1) Application in regulating anthocyanin synthesis in apple fruit;

[0019] (2) Application in regulating the appearance quality of apple fruits;

[0020] (3) Application in apple variety improvement.

[0021] The present invention also provides the use of the recombinant bacteria comprising the said vector in any of the following:

[0022] (1) Application in regulating anthocyanin synthesis in apple fruit;

[0023] (2) Application in regulating the appearance quality of apple fruits;

[0024] (3) Application in apple variety improvement.

[0025] Optionally, the MdZAT1 gene negatively regulates anthocyanin synthesis in apple fruit. Preferably, the negative regulation includes: overexpressing the MdZAT1 gene to reduce the amount of anthocyanin synthesized in apple fruit; and silencing the MdZAT1 gene to increase the amount of anthocyanin synthesized in apple fruit.

[0026] The present invention also provides a method for inhibiting anthocyanin synthesis in apple fruit, comprising the steps of constructing the recombinant bacteria and transferring the recombinant bacteria into apples to overexpress the MdZAT1 gene, wherein the nucleotide sequence of the MdZAT1 gene is the sequence shown in SEQ ID NO.1 or a fragment thereof.

[0027] Optionally, the fragment includes a nucleotide sequence as shown in SEQ ID NO.2.

[0028] The present invention also provides a method for improving anthocyanin synthesis in apple fruit, comprising the steps of constructing the recombinant bacteria and transferring the recombinant bacteria into apples to inhibit the expression of the MdZAT1 gene, wherein the nucleotide sequence of the MdZAT1 gene is the sequence shown in SEQ ID NO.1 or a fragment thereof.

[0029] Optionally, the fragment includes a nucleotide sequence as shown in SEQ ID NO.2.

[0030] The present invention discloses the following technical effects:

[0031] (1) This invention helps to elucidate the role of the MdZAT1 gene in regulating the synthesis of anthocyanins in apple peel from a molecular perspective, providing a theoretical basis and gene resources for molecular breeding of anthocyanin accumulation in apple peel, and providing new genetic resources for the implementation of green agriculture. The development and utilization of this genetic resource is conducive to reducing agricultural costs and achieving environmental friendliness.

[0032] (2) Through apple instantaneous injection experiment, physiological data measurement and gene expression analysis, it was shown that overexpression of MdZAT1 can significantly inhibit fruit coloring, and the content of anthocyanins and the relative expression of genes related to anthocyanin biosynthesis are significantly downregulated. Silencing MdZAT1 can promote the accumulation of anthocyanins in the fruit, and the content of anthocyanins is significantly higher than that of the control. The relative expression of genes related to anthocyanin biosynthesis is significantly upregulated, indicating that MdZAT1 has a significant effect in inhibiting anthocyanin synthesis.

[0033] (3) In this invention, MdZAT1 was overexpressed in apple callus tissue to verify its function of inhibiting anthocyanin biosynthesis. Compared with wild type, transgenic callus tissue was lighter in color and had a lower anthocyanin content. Biological function verification showed that the MdZAT1 cloned in this invention interacts with MdCHI, MdANS and MdMYB114 genes to inhibit the function of anthocyanin biosynthesis in pear peel.

[0034] (4) The MdZAT1 gene of the present invention can be introduced into apple varieties with low anthocyanin content using genetic engineering methods to improve apple varieties. Attached Figure Description

[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0036] Figure 1The results of the cloning sequence analysis of MdZAT1 include: (A) electrophoresis diagram of the MdZAT1 gene clone, (B) phylogenetic tree of C2H2 zinc finger protein sequences from different species, (C) schematic diagram of the C2H2 zinc finger domain contained in MdZAT1 between amino acids 183 and 205, and (D) multiple alignment results of amino acid sequences of homologous C2H2 zinc finger proteins.

[0037] Figure 2 Subcellular localization of the MdZAT1 fusion protein in tobacco leaves;

[0038] Figure 3 To verify the interaction between MdZAT1 and the MdMYB114 promoter; (A) yeast single-hybrid assay to verify the interaction between MdZAT1 and the MdMYB114 promoter, (B) EMSA assay to verify the binding of MdZAT1 to the MdMYB114 promoter, and (C) dual-luciferase reporter assay in tobacco to verify the regulation of MdMYB114 promoter activity by MdZAT1.

[0039] Figure 4 The study analyzed anthocyanin content and related gene expression levels, including: (A) phenotypic diagrams of fruit at 0 days (0DFBR), 6 days (6DFBR), 12 days (12DFBR), and 18 days (18DFBR) after bagging; (B) anthocyanin content in the peel; (C) relative expression level of MdZAT1; (D) relative expression level of MdMYB114; (E)-(F) expression patterns of structural genes MdCHS, MdCHI, MdF3H, MdDFR, MdANS, MdUFGT, MdMYB1, MdbHLH3, MdbHLH33, and MdGST during anthocyanin accumulation in apples; different letters represent significant differences between different stages; and (G) correlation analysis between MdZAT1 expression level and anthocyanin content.

[0040] Figure 5 The study aimed to investigate the effects of MdZAT1 on anthocyanin accumulation in apple callus. The results included: (A) phenotypes of wild-type and MdZAT1-overexpressing transgenic apple callus (MdZAT1-OE); (B) DNA-level verification of gene expression in MdZAT1-OE transgenic apple callus; (C) RNA-level verification of relative gene expression in MdZAT1-OE transgenic apple callus; (D) anthocyanin content in apple callus; and (E) relative expression levels of anthocyanin-related genes in MdZAT1-OE and wild-type callus.

[0041] Figure 6The purpose of MdZAT1 overexpression was to inhibit the biosynthesis of anthocyanins in apple peel; among which: (A) the phenotype of apple fruit overexpressing MdZAT1, (B) the anthocyanin content in apple peel with transient MdZAT1 overexpression, and (C) the expression of anthocyanin biosynthesis-related genes in apple peels overexpressing MdZAT1 and control apple peels.

[0042] Figure 7 To investigate how MdZAT1 silencing promotes the biosynthesis of anthocyanins in apple peel; where: (A) phenotype after MdZAT1 silencing in apple peel, (B) anthocyanin content after MdZAT1 silencing in apple peel, and (C) expression of anthocyanin-related genes in MdZAT1-silenced and control apples.

[0043] Figure 8 The study aimed to inhibit the expression of MdZAT1 by binding to the promoters of MdCHI and MdANS. Specifically: (A) yeast single-hybrid assay to verify the interaction between MdZAT1 and the promoters of MdCHI and MdANS; (B) EMSA assay to verify the analysis of MdZAT1 binding to the promoters of MdANS and MdCHI; and (C) dual-luciferase reporter assay in tobacco leaves to verify the regulation of MdZAT1 on the promoter activity of MdCHI and MdANS. Detailed Implementation

[0044] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0045] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0046] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0047] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0048] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0049] MdMYB114 is considered another important anthocyanin regulator in apples besides MdMYB1. In order to study the upstream regulatory mechanism of MdMYB114, this invention screened a C2H2 type zinc finger protein, named MdZAT1 (nucleotide sequence as shown in SEQ ID NO: 1), through a yeast single-hybrid screening library experiment. Experiments showed that MdZAT1 gene expression was negatively correlated with anthocyanin synthesis.

[0050] Example 1: Cloning of MdZAT1

[0051] (I) RNA extraction and reverse transcription from 'Fulli' apple fruits

[0052] 1. Extraction of total RNA from plants

[0053] The polysaccharide and polyphenol plant total RNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd. was used. The procedure was followed according to the instructions:

[0054] 1) Add approximately 100 mg of tissue sample to a mortar containing liquid nitrogen and grind thoroughly.

[0055] 2) Add 500 μL of SL lysis buffer to a centrifuge tube, quickly add the tissue sample powder, and immediately vortex to mix.

[0056] 3) Centrifuge at 12000 rpm for 2 min.

[0057] 4) Add the supernatant to the filter column CS placed in the collection tube and centrifuge at 12000 rpm for 2 min.

[0058] 5) Slowly add the supernatant from the collection tube to a centrifuge tube containing 0.4 times the volume of the supernatant in anhydrous ethanol, and mix by inverting the tube.

[0059] 6) Add all the contents of the centrifuge tube from the previous step to the adsorption column CR3, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid.

[0060] 7) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for half a minute, and discard the waste liquid.

[0061] 8) Add 80 μL of DNase I working solution (10 μL DNase I + 70 μL RDD buffer) and let stand at room temperature for 15 min.

[0062] 9) Add 350 μL of protein removal solution RW1, centrifuge at 12000 rpm for 15 seconds, and discard the waste liquid.

[0063] 10) Add 500 μL of washing buffer RW to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, and discard the waste liquid.

[0064] 11) Repeat 10).

[0065] 12) Centrifuge at 12000 rpm for 2 min.

[0066] 13) Place the adsorption column into a new centrifuge tube, add 35 μL of RNase-Free ddH2O to the middle of the adsorption column, let stand for 2 min, centrifuge at 12000 rpm for 1 min, discard the adsorption column, and obtain the RNA solution.

[0067] 2. RNA is reverse transcribed into cDNA

[0068] Using PrimeScript from Baori Biotechnology (Beijing) Co., Ltd. TM RT reagent kit (Perfect Real Time) reverse transcription kit. Specific steps are as follows:

[0069] 1) Prepare the RT reaction solution and carry out the entire process on ice.

[0070] The reverse transcription reaction system is shown in Table 1.

[0071] Table 1 Reverse transcription reaction system

[0072]

[0073] 2) After mixing the reaction solution, the reaction was carried out in a PCR instrument. First, the reaction was carried out at 37℃ for 15 min, which is the reverse transcription reaction; then the reverse transcriptase inactivation reaction was carried out at 85℃ for 5 s; finally, the cDNA solution was obtained at 4℃ and stored at -20℃.

[0074] (II) Cloning of the full-length MdZAT1 gene

[0075] Using the cDNA prepared above as a template, the procedure was performed on ice using 2×PhantaMax Master Mix (Dye Plus) from Nanjing Novizan Biotechnology Co., Ltd. The upstream and downstream primers for MdZAT1 are as follows:

[0076] MdZAT1-F: 5'-ATGCCTAAGGATAGGAGGGG-3';

[0077] MdZAT1-R: 5'-TCACGGCTGGTTGTTGTC-3'.

[0078] The gene cloning reaction system is shown in Table 2.

[0079] Table 2 Gene Cloning Reaction System

[0080]

[0081] Add the system to a sterile centrifuge tube, gently tap to mix, centrifuge briefly, and then place in a PCR instrument.

[0082] PCR reaction program: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 15 s, 72℃ for 2 min, 35 cycles; 72℃ for 5 min; store at 4℃.

[0083] After the PCR reaction, the PCR product was recovered, ligated into the intermediate vector pLB, transformed into Escherichia coli DH5α, plated onto LB solid medium containing 50 mg / L ampicillin, and incubated overnight at 37°C until single colonies grew. The bacterial culture was validated by PCR using 2×Accurate Taq premix from Hunan Aikerui Biotechnology Co., Ltd., and the sequence was determined by Sangon Biotech (Shanghai) Co., Ltd.

[0084] (III) Cloning of a MdZAT1 gene-specific fragment

[0085] Using the cDNA prepared above as a template, amplification was performed using 2×PhantaMax Master Mix (Dye Plus) from Nanjing Novizan Biotechnology Co., Ltd. The upstream and downstream primers for the MdZAT1 specific fragment are as follows:

[0086] MdZAT1-pTRV2-F: 5'-CTGATCCGAAGCTAGTGTGC-3';

[0087] MdZAT1-pTRV2-R: 5'-TACCAGACCAGCTGCTGCT-3';

[0088] The amplification steps and PCR reaction procedure are the same as those in Example 1 (II).

[0089] After the PCR reaction, the PCR product was recovered, ligated into the cloning vector pLB, transformed into Escherichia coli DH5α, plated onto LB solid medium containing 50 mg / L ampicillin, and incubated overnight at 37°C until single colonies grew. The bacterial culture was verified by PCR using 2×Accurate Taq premix from Hunan Aikerui Biotechnology Co., Ltd., and the sequence was determined by Sangon Biotech (Shanghai) Co., Ltd.

[0090] The results are as follows Figure 1 As shown, this invention successfully cloned the MdZAT1 gene (see...). Figure 1 (See A). The sequences of C2H2-type zinc finger proteins from different species were analyzed, and a phylogenetic tree was constructed (see...). Figure 1 (See Figure B). Analysis of the MdZAT1 amino acid sequence revealed a predicted C2H2-type zinc finger domain between amino acids 183 and 205. Multiple alignment of the amino acid sequences of homologous C2H2-type zinc finger proteins shows the conserved C2H2 domain. Figure 1 D (highlighted with a box);

[0091] Example 2 Construction of MdZAT1 gene-related vector

[0092] The full-length cDNA sequence of the MdZAT1 gene obtained in Example 1 was amplified using primer sequences MdZAT1-pCAMBIA2300-F (5'-AGAACACGGGGGACTCTAGAATGCCTAAGGATAGGAGGGG-3') and MdZAT1-pCAMBIA2300-R (5'CCCTTGCTCACCATCCCGGGTCACGGCTGGTTGTTGTCCG-3') containing XbaⅠ and SmaⅠ restriction sites, respectively. Following the gene cloning method described in Example 1, the amplified cDNA was ligated into the cloning vector pCAMBIA2300-EGFP to obtain the fusion plasmid MdZAT1-pCAMBIA2300(XbaⅠ, SmaⅠ), thus generating the MdZAT1 green fluorescent protein (GFP) fusion protein construct. This was transformed into *E. coli* DH5α, and the recombinant plasmid MdZAT1-pCAMBIA2300 was extracted from single colonies with correct sequencing.

[0093] Example 3: Subcellular localization of the MdZAT1 gene

[0094] The recombinant plasmid MdZAT1-pCAMBIA2300 prepared in Example 2 was transformed into Agrobacterium GV3101 using a freeze-thaw method, and fresh tobacco leaves were infected. The results were observed using a fully automated intelligent live-cell fluorescence microscopy system. The specific steps are as follows:

[0095] 1) Activation of MdZAT1-pCAMBIA2300 and pCAMBIA2300 Agrobacterium strains. Take about 20 μL of bacterial culture into 10 mL centrifuge tubes, add 2 mL of LB liquid medium containing kanamycin and rifampin, and incubate at 28 °C for 12 h to activate the strains.

[0096] 2) Take 1 mL of the activated bacterial culture and place it in a 100 mL Erlenmeyer flask. Add 30 mL of LB liquid medium containing kanamycin and rifampin. Continue incubation at 28°C with a shaker until the OD value reaches 0.5. 600nm =0.6-0.8.

[0097] 3) Transfer all bacterial cultures to 50mL centrifuge tubes, centrifuge at 28℃ and 5000rpm for 10min, and discard the supernatant.

[0098] 4) Add 30 mL of ultrapure water to each centrifuge tube and mix well. Centrifuge at 28℃ and 5000 rpm for 10 min, then discard the supernatant.

[0099] 5) Add 8 mL of tobacco resuspension to each centrifuge tube and mix well. The formula for tobacco resuspension (100 mL) is shown in Table 3 below.

[0100] Table 3 Tobacco Resuspension Formulation

[0101]

[0102] 6) Inject the suspension into the reverse side of the tobacco leaves, specifically the third, fourth, and fifth leaves of three tobacco plants.

[0103] 7) Place the tobacco in the dark for 12 hours, then incubate under normal light for 2-3 days.

[0104] 8) Remove the injected leaves and observe them using a fully automated intelligent live-cell fluorescence microscopy system.

[0105] The results showed that MdZAT1-GFP was localized in the cell nucleus. (See [link]) Figure 2 The scale bar is 50 μm.

[0106] Example 4: Interaction verification of the MdZAT1 and MdMYB114 promoters.

[0107] To verify the interaction between MdZAT1 and MdMYB114, amplification was performed using primer sequences MdZAT1-pGADT7-F: 5'-GGATCCATGCCTAAGGATAGGAGGGG-3' and MdZAT1-pGADT7-R: 5'-GAGCTCTCACGGCTGGTTGTTGTC-3', respectively, containing NdeI and BamHI restriction sites. Following the gene cloning method in Example 1, the plasmid was ligated into the cloning vector pGADT7 to obtain the fusion plasmid MdZAT1-pGADT7(NdeI, BamHI). Amplification was performed using primer sequences MdMYB114-pHIS2-F: 5'-ACTCACTATAGGGCGAATTCCCGATATTATCGATATTTTGGTCCATGG3' and MdMYB114-pHIS2-R: 5'-ATTCGCGAACGCGTGAGCTCTCTCTTATCTGCCTGCTAGCCAC-3', respectively, containing EcoRI and SacI restriction sites. The amplified primers were then ligated into the cloning vector pHIS2 according to the gene cloning method described in Example 1. The MdZAT1-pGADT7 and MdMYB114-p-pHIS2 vector plasmids were co-transformed into yeast strain Y187, with the control being the co-transformation of yeast strain Y187 with the pGADT7 and MdMYB114-p-pHIS2 vector plasmids. The bacterial culture was plated onto solid medium (yeast auxotrophic medium: SD / -Trp / -His / -Leu). Observation showed that yeast plaques containing MdZAT1-pGADT7 and MdMYB114-pHIS2 grew on SD / -Trp / -His / -Leu medium with a concentration of 100 mM 3-amino-1,2,4-triazole (3-AT). The results indicate an interaction between the promoters of MdZAT1 and MdMYB114. (See [link to relevant documentation]). Figure 3 A in the middle.

[0108] The interaction between MdZAT1 and the MdMYB114 promoter was verified using EMSA assays. MdZAT1 was cloned into the His-tagged pET32a protein expression vector to construct MdZAT1-pET32a. The recombinant vector plasmid was transformed into *E. coli* BL21(DE3) using a heat shock method for induction of prokaryotic protein expression. EMSA results showed that MdZAT1 can bind to the MdMYB114 promoter. The results indicate that MdZAT1 specifically binds to the TTGGGT sequence of the MdMYB114 promoter (see [link to EMSA assay]). Figure 3 B in the middle.

[0109] To further investigate the regulatory activity of MdZAT1 on the MdMYB114 promoter, the promoter sequence of MdMYB114 was cloned. Amplification was performed using primer sequences MdZAT1-pGreenII62-SK-F: 5'-GCTCTAGAACTAGTGGATCCATGCCTAAGGATAGGAGGGG3' and MdZAT1-pGreenII62-SK-R: 5'-TCGACGGTATCGATAAGCTTTCACGGCTGGTTGTTGTCCG-3', respectively, containing BamHI and HanIII restriction sites. Following the gene cloning method described in Example 1, the fusion plasmid MdZAT1-pGreenII62-SK (BamHI, HanIII) ​​was obtained. The plasmids pMdMYB114-LUC (BamHI, SalI) were obtained using MdMYB114-pGreenⅡ0800-F: 5'-TCGACGGTATCGATAAGCTTCCGATATTATCGATATTTTG-3' and MdMYB114-pGreenⅡ0800-R: 5'-GCTCTAGAACTAGTGGATCCTCTCTTATCTGCCTGCTAGC-3', respectively, and were transformed into GV3101 containing pSoup+P19. These plasmids were then co-injected into tobacco leaves for observation, with pMdMYB114-LUC and pGreen62-SK serving as controls. The results showed that when pMdMYB114-LUC and pGreen62-SK-MdZAT1 were co-expressed in tobacco leaves, the luminescent signal was weaker compared to the control, indicating that the activity of the MdMYB114 promoter was inhibited. The results showed that MdZAT1 downregulated the expression of the MdMYB114 promoter. These results indicate that MdZAT1 can inhibit the expression of MdMYB114 by directly binding to the MdMYB114 promoter. (See [link to relevant documentation]). Figure 3 B in the middle.

[0110] Example 5: Analysis of anthocyanin content and related gene expression levels

[0111] To further explore the relationship between MdZAT1 and anthocyanin biosynthesis, this invention selected the 'Foli' apple variety and determined the anthocyanin content and relative expression levels of related genes during the apple coloring period after bagging removal, thus investigating the relationship between MdZAT1 and anthocyanin biosynthesis. Samples of the peel were taken at 0, 6, 12, and 18 days after bagging removal to determine the anthocyanin content. The determination method is as follows:

[0112] 1) Grind the sample tissue into powder thoroughly in a mortar containing liquid nitrogen.

[0113] 2) Weigh 0.5g and add it to a centrifuge tube containing 10mL of hydrochloric acid methanol (10%). Wrap the tube with aluminum foil and extract at 4℃ in the dark for 24h.

[0114] 3) Remove the aluminum foil and centrifuge at 8000 rpm for 10 min at 4℃.

[0115] 4) Add 4 mL of 0.4 M sodium acetate (NaAC) buffer (pH = 4.5) and 4 mL of 0.025 M KCl buffer (pH = 1.0) to centrifuge tubes respectively, and add 1 mL of the supernatant obtained in the previous step to each tube. Let stand at room temperature for 15 min.

[0116] 5) Measure the absorbance at 510 nm and 700 nm for each tube.

[0117] The formula is: ΔA=(A 510 -A 700 ) (pH=1.0) -(A 510 -A 700 ) (pH=4.5)

[0118] Anthocyanin content = ΔA * 5 * 0.005 * 1000 * 449.2 / (26900 * 0.5)

[0119] In the formula for calculating anthocyanin content, 5 represents the dilution factor; 0.005 represents the dilution volume; 1000 represents the unit conversion; 449.2 is the molecular weight of anthocyanin; 0.5 represents the sample mass; and 26900 represents the extinction coefficient.

[0120] RNA was extracted from the pericarp and reverse transcribed into cDNA, following the same procedure as in Example 1 (step one). The expression levels of anthocyanin-related genes and MdZAT1 were determined using quantitative real-time PCR. Specific primers for the MdZAT1 gene were MdZAT1-F and MdZAT1-R. Specific primers were designed for the non-conserved regions of the MdMYB114, MdCHS, MdCHI, MdF3H, MdDFR, MdANS, MdUFGT, MdMYB1, MdbHLH3, MdbHLH33, and MdGST genes, as well as internal reference primers for apple, MdActin-F and MdActin-R. The sequences are as follows:

[0121] MdCHS-F: 5'-GGAGACAACTGGAGAAGGACTGGAA-3';

[0122] MdCHS-R: 5'-CGACATTGATACTGGTGTCTTC-3';

[0123] MdCHI-F:5’-GGGATAACCTCGCGGCCAAA-3’;

[0124] MdCHI-R:5’-GCATCCATGCCGGAAGCTACAA-3’;

[0125] MdF3H-F:5’-TGGAAGCTTGTGAGGACTGGGGT-3’;

[0126] MdF3H-R:5’-CTCCTCCGATGGCAAATCAAAGA-3’;

[0127] MdDFR-F:5’-GATAGGGTTTGAGTTCAAGTA-3’;

[0128] MdDFR-R:5’-TCTCCTCAGCAGCCTCAGTTTTCT-3’;

[0129] MdANS-F:5’-CCAAGTGAAGCGGGTTGTGCT-3’;

[0130] MdANS-R:5’-CAAAGCAGGCGGACAGGAGTAGC-3’;

[0131] MdUFGT-F:5’-CCACCGCCCTTCCAAACACTCT-3’;

[0132] MdUFGT-R:5’-CACCCTTATGTTACGCGGCATGT-3’;

[0133] MdGST-F:5’-AGTTGTAGAAGATGGTGACT-3’;

[0134] MdGST-R:5’-CAGGTCGTTGAAGTTGTG-3’;

[0135] MdMYB1-F:5’-TGCCTGGACTCGAGAGGAAGACA-3’;

[0136] MdMYB1-R:5’-CCTGTTTCCCAAAAGCCTGTGAA-3’;

[0137] MdMYB114-F:5’-ATTAAGATGGTTGAACTATC-3’;

[0138] MdMYB114-R:5’-GAAGCCTAATCGTAAGAT-3’;

[0139] MdbHLH3-F: 5'-ACCACCTCAGCCAGAACCT-3';

[0140] MdbHLH3-R: 5'-CCTTCACCTTGGCTCTTAGTT-3';

[0141] MdbHLH33-F: 5'-TCCGACAGAAGACTCCATGATG-3';

[0142] MdbHLH33-R: 5'-CGTGTTTAGCAAAAGAGTGAGCC-3';

[0143] MdActin-F: 5'-TGACCGAATGAGCAAGGAAATTACT-3';

[0144] MdActin-R: 5'-TACTCAGCTTTTGGCAATCCACATC-3'.

[0145] The results showed that anthocyanin content gradually increased with fruit development. The expression levels of MdMYB1, MdbHLH3, MdCHI, MdCHS, MdDFR, and MdANS were highest 6 days after bagging removal, while the relative expression levels of MdbHLH33, MdGST, MdF3H, and MdUFGT were highest 12 days after bagging removal. The relative expression level of MdMYB114 increased with the number of days after bagging removal, while the relative expression level of MdZAT1 showed the opposite trend. Figure 4 The results showed that MdZAT1 was highly negatively correlated with anthocyanin biosynthesis. (See AF). Figure 4 G.

[0146] Example 6: MdZAT1 inhibits the accumulation of anthocyanins in apple callus.

[0147] To further investigate the function of MdZAT1 in anthocyanin biosynthesis, the cDNA-specific fragment of the MdZAT1 gene obtained in step (iii) of Example 1 was amplified using primer sequences MdZAT1-pRI101-F: 5'-GTCGACATGCCTAAGGATAGGAGGGG-3' and MdZAT1-pRI101-R: 5'-GGATCCCGGCTGGTTGTTGTCC-3', respectively, containing SalⅠ and BamHI restriction sites. Following the gene cloning method in step (ii) of Example 1, the fragment was ligated into the cloning vector pLB to obtain the fusion plasmid MdZAT1-pLB(SalⅠ, BamHI). Then, the empty vector pRI101 and MdZAT1-pLB (SalⅠ, BamHI) were digested with restriction endonucleases SalⅠ and BamHI, respectively. After agarose gel electrophoresis, gel recovery, and T4-DNA ligase, the linear pRI101 vector and the target gene MdZAT1 specific fragment were ligated and transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid MdZAT1-p-pRI101 was extracted.

[0148] The recombinant plasmids were transformed into Agrobacterium LBA4404 using a freeze-thaw method. MdZAT1 overexpressing transgenic callus was obtained by infecting 'Wang Lin' callus. DNA and RNA levels of the MdZAT1-OE transgenic callus were then identified.

[0149] PCR amplification was performed using the upstream and downstream primers of the MdZAT1-pRI101 clone, and the results are shown below. Figure 5 In step B, the PCR products using ddH2O and 'Wang Lin' callus DNA as templates did not show the target band; however, the PCR products using MdZAT1-OE callus DNA and the MdZAT1-pRI101 recombinant vector plasmid as templates did show the target band, indicating that the present invention yielded MdZAT1-OE transgenic callus. RNA was extracted from the transgenic and 'Wang Lin' callus tissues, respectively, see [link to details]. Figure 5 The relative expression level of MdZAT1 in the C-type transgenic callus was significantly higher than that in the 'Wang Lin' callus, further validating the MdZAT1-OE transgenic callus. Figure 5 As shown in Figure A, the staining of 'Wang Lin' callus was significantly stronger than that of MdZAT1-OE transgenic callus. Anthocyanin extraction and content determination were performed on both, using the same methods as in Example 5. The results were consistent with the phenotype; the anthocyanin content of MdZAT1-OE transgenic callus was significantly lower than that of the control. (See Figure A for details.) Figure 5 The relative expression levels of anthocyanin-related genes in MdZAT1-OE callus were significantly lower than those in wild-type callus, see [reference needed]. Figure 5The results showed that overexpression of MdZAT1 could inhibit the accumulation of anthocyanins in callus tissue.

[0150] Example 7: MdZAT1 overexpression inhibits the biosynthesis of anthocyanins in apple peel.

[0151] To further verify the function of MdZAT1 in anthocyanin synthesis, the MdZAT1-pRI101 vector plasmid from Example 6 was transformed into Agrobacterium GV3101, and then transiently transformed into the pericarp. (See attached image.) Figure 6 Transient overexpression of A;MdZAT1 in the pericarp resulted in a significantly lower anthocyanin content than the control. (See [reference needed]) Figure 6 In B. Transient overexpression of MdZAT1 in pericarp samples suppressed the expression of anthocyanin-related genes, with MdANS, MdUFGT, MdGST, and MdbHLH3 showing highly significant downregulation. Figure 6 C.

[0152] Example 8: MdZAT1 silencing promotes the biosynthesis of anthocyanins in apple peel.

[0153] The expression of MdZAT1 was suppressed in the pericarp using a virus-induced gene silencing (VIGS) system. A specific nucleotide sequence (SEQ ID NO. 2) of the MdZAT1 gene fragment was amplified using primer sequences MdZAT1-pTRV2-F and MdZAT1-pTRV2-R, respectively, containing BamHI and XhoI restriction sites, following the same procedure as in Example 1 (III). The MdZAT1-pTRV2 vector was constructed and transformed into Agrobacterium GV3101. The vector plasmid, along with pTRV1 as an auxiliary vector, was transiently transferred into the pericarp. (See [link to documentation]). Figure 7 Transient silencing of A;MdZAT1 in the pericarp resulted in a significantly higher anthocyanin content than the control, see [reference needed]. Figure 7 B. Transient silencing of MdZAT1 significantly upregulated the expression of anthocyanin-related genes in the pericarp samples, see Figure 7 The above results indicate that MdZAT1 is a negative regulator of anthocyanin accumulation in fruit.

[0154] Example 9: MdZAT1 expression is inhibited by binding to the promoters of MdCHI and MdANS.

[0155] To investigate how MdZAT1 affects anthocyanin biosynthesis, based on the differences in the expression levels of anthocyanin synthesis-related genes in transgenic materials, we tested whether MdZAT1 binds to the promoters of MdCHI, MdCHS, MdF3H, MdDFR, MdANS, MdUFGT, MdMYB1, MdbHLH3, MdbHLH33, and MdGST. Yeast single-hybrid assays were performed to investigate the potential interactions between MdZAT1 and each promoter. Promoter-pHIS2 vectors were constructed using primers containing EcoRI and SacI restriction sites, respectively. The primer sequences are as follows:

[0156] MdCHI-pHIS2-F: 5'-GAATTCTTCCGCTGCGGTGG-3';

[0157] MdCHI-pHIS2-R: 5'-GAGCTCTATAGCATTAATTAATGGGTGGGA-3';

[0158] MdCHS-pHIS2-F: 5'-GAATTCGAACCCAGAACGCATGAGT-3';

[0159] MdCHS-pHIS2-R: 5'-GAGCTCGAGATACAACTGCGAGCGAC-3';

[0160] MdDFR-pHIS2-F: 5'-GAATTCCTGTTCGTTTGTAATGGCAT-3';

[0161] MdDFR-pHIS2-R: 5'-GAGCTCATCTTGTGTGTATGTGCTTACC-3';

[0162] MdANS-pHIS2-F: 5'-GAATTCGGCTAGTTCTGTATTATGGTTGATAT-3';

[0163] MdANS-pHIS2-R: 5'-GAGCTCTAGTTGGTTCCAATTGGGTT-3';

[0164] MdUFGT-pHIS2-F: 5'-GAATTCGAATTCCTGAGTCCCCTGTAC-3';

[0165] MdUFGT-pHIS2-R: 5'-GAGCTCGAGCTCACTGGAGTGGACA-3';

[0166] MdMYB1-pHIS2-F: 5'-GAATTCTATAAAATATCGATGATATCGGAAATATC-3';

[0167] MdMYB1-pHIS2-R: 5'-GAGCTCGCTCCCCTTCCACGC-3';

[0168] MdGST-pHIS2-F: 5'-GAATTCGAAACTGTCGTTCGTTGAAATTTAGCT-3';

[0169] MdGST-pHIS2-R: 5'-ATTCGCGAACGCGTGAGCTCCTTCTTGTACAACAAAGTGC-3'.

[0170] The promoter-pHIS2 vector plasmid was transformed into Y187 yeast competent cells, and the bacterial culture was plated on solid medium (SD / -Trp-His) to confirm that it could inhibit the background expression of promoter-pHIS2. The results showed that solid medium with 120 mM 3-AT lacking tryptophan and histidine (SD / -Trp-His) could inhibit the background expression of MdDFR-p-pHIS2, MdANS-p-pHIS2, MdUFGT-p-pHIS2, and MdMYB1-p-pHIS2, and solid medium with 180 mM 3-AT could inhibit the background expression of MdF3H-p-pHIS2, MdbHLH3-p-pHIS2, MdbHLH33-p-pHIS2, MdCHI-p-pHIS2, MdCHS-p-pHIS2, and MdGST-p-pHIS2. Y187 cells were co-transformed with the MdZAT1-pGADT7 and promoter-pHIS2 vector plasmids, respectively, with pGADT7 and promoter-pHIS2 vector plasmids serving as controls. The bacterial cultures were plated onto solid culture medium (SD / -Trp-His-Leu). After 2 days, yeast plaques containing MdZAT1-pGADT7, MdANS-p-pHIS2, and MdCHI-p-pHIS2 grew on SD / -Trp / -His / -Leu medium with a 3-AT concentration. However, yeast cells co-transformed with other promoter-pHIS2 and MdZAT1-pGADT7 did not show plaque growth. Figure 8 The results showed that MdZAT1 interacts with the promoters of MdCHI and MdANS, but not with the promoters of MdCHS, MdDFR, MdUFGT, MdMYB1, MdbHLH3, MdbHLH33, and MdGST.

[0171] Further EMSA experiments were used to verify the interaction between MdZAT1 and the MdANS and MdCHI promoters. Two predicted binding sites were detected in the MdANS promoter and one predicted binding site was detected in the MdCHI promoter. Biotin-labeled probes were designed. The probe sequences used are as follows:

[0172] MdANS-probe1-BJ-F: ​​5'-GGATTATTGCTCCAATTGGGTTAAAGTTGTGGGACC-3'; MdANS-probe1-BJ-R: 5'-GGTCCCACAACTTTAACCCAATTGGAGCAATAATCC-3 ';MdANS-probe1-JZ-F: 5'-GGATTATTGCTCCAATTGGGTTAAAGTTGTGGGACC-3'; MdANS-probe2-BJ-F: ​​5'-CTAAATTTTGTAAACCCAATTGGAACCAACTA-3';

[0173] MdANS-probe2-BJ-R:5'-TAGTTGGTTCCAATTGGGTTTACAAAATTTAG-3';

[0174] MdANS-probe2-JZ-F: 5'-CTAAATTTTGTAAACCCAATTGGAACCAACTA-3';

[0175] MdCHI-probe-BJ-F: ​​5'-TATTAAAGATAGGATTTGGGTAATTAATCATCATCT-3';

[0176] MdCHI-probe-BJ-R: 5'-AGATAATGATTAATTACCCAAATCCTATCTTTAATA-3';

[0177] MdCHI-probe-JZ-F: 5'-TATTAAAGATAGGATTTGGGTAATTAATCATCATCT-3'.

[0178] EMSA experimental results show that MdZAT1 can bind to the promoter of MdANS; MdZAT1 can bind to the promoter of MdCHI via the TTGGGT motif, see [link to EMSA experiment]. Figure 8 The results showed that MdZAT1 can specifically bind to the TTGGGT sequence of the MdANS and MdCHI promoters.

[0179] To further investigate the regulatory activity of MdZAT1 on the MdANS and MdCHI promoters, primer sequences containing BamHI and SalI restriction sites were used:

[0180] MdCHI-pGreenⅡ0800-F: 5'-TCGACGGTATCGATAAGCTTTTCCGCTGCGGTGGG-3';

[0181] MdCHI-pGreenⅡ0800-R: 5'-GCTCTAGAACTAGTGGATCCGGGTGGGACCGTGGG-3';

[0182] MdANS-pGreenⅡ0800-F: 5'-TCGACGGTATCGATAAGCTTGGCTAGTTCTGTATTATGGT-3';

[0183] MdANS-pGreenⅡ0800-R: 5'-GCTCTAGAACTAGTGGATCCTAGTTGGTTCCAATTGGGTT-3'.

[0184] The promoter sequences of MdCHI and MdANS were cloned to construct the MdANS-pGreenII 0800-LUC and MdCHI-pGreenII 0800-LUC vectors; the CDS sequence of MdZAT1 was cloned to construct the MdZAT1-pGreenII 62-SK vector, which was transformed into GV3101 cells carrying pSoup+p19 (GV3101(pSoup-p19) chemically transformed competent cells). These were co-injected into tobacco leaves for observation, with pMdANS-LUC and pGreen62-SK, and pMdCHI-LUC and pGreen62-SK serving as controls, respectively. The results showed that when pMdANS-LUC and pMdCHI-LUC and pGreen62-SK-MdZAT1 were co-expressed in tobacco leaves, the luminescence signal was weaker compared to the control, and the activity of the MdANS and MdCHI promoters was inhibited. See [link to relevant documentation]. Figure 8 The results showed that MdZAT1 downregulated the expression of the MdANS and MdCHI promoters. These results indicate that MdZAT1 can inhibit the expression of MdANS and MdCHI by directly binding to the MdANS and MdCHI promoters, thereby affecting the biosynthesis of anthocyanins.

[0185] Based on the above results, this invention reveals that MdZAT1 can bind to the promoters of MdCHI and MdANS and downregulate the expression of MdCHI and MdANS, thereby negatively regulating anthocyanin biosynthesis. The discovery of the MdZAT1 gene provides a basis for improving the appearance quality of apple fruits, and has significant economic and social benefits for improving apple quality.

[0186] The sequence shown in SEQ ID NO.1 (nucleotide sequence):

[0187] ATGCCTAAGGATAGGAGGGGACGTTCTGTTTCTCGTGATAGGTATAGAGCATCTCCTTATCCATGCAGCTCCAGTCCTACAAGGCGGTTGTTGCCCAAAATTCCTTCAGAAACTGAGGACAATGTGAAAGAATGGGAAGAAGCCAGATGCCCCGTTTGCCTGGAGCATCCACACAATGCGGTTCTCCTAATATGTTCATCGTATGAACAAGGGTGCCGCCCTTACATGTGTGACACGAGCTACCGCCATTCAAATTGTCTAGACCTGTACTGCAAGTCATTTTCAGCAGAAACCTCACCAACTATCCCACCAGAAGGAGCAGCGCAGATATCAGATACTCAGTCGTCTCCATCTGCAACTCTTGAATCAACAATTACTCAAGTGCAAAACGATAGTACAATTGAGGAGGTGCTCTCCTCCATGAATGCCGTATCTTGTGAGCATCAGGCTGATCCGAAGCTAGTGTGCCCCCTCTGCCGTGGGGAGATAACAGATTGGATTATTGTTGAGTCTGCTCGTTGTTTCATGAATGCGAAATCAAGAAATTGTTCTTGTGAGACATGTAATTATAGCGGAACATATGCAGATCTCAGGAAGCATGCGAGGCTGGAGCATCCACTAGTGTGCCCATCAGAGGCAGATCCAGAGCGACAGCGTACCTGGAGGAGTTTGGAGCGACAGAGGGATATTGGCGACTTGTTCAGCTCAATCCAATCTTCAGTTGGAGAGGATAGGGGTGATGATAGCAGTAGTTTGCCTGCTGATGACGGTGCAGGCTGGCTAACCATATTCTTTCTAGTTAGAGTAGTTCGACCCGGGTCCAGTTCAAGGAGCAGCAGCTGGTCTGGTACCACAAGAACCAGAGCACAAGTTAGTATGAGAAGGAGAGCAACCAGGCTTTGGGGGGAGAGCTACGAGGGCGAAGCAGCATCTTCTACTC TAGAAGAGGATAACGAGTCTTCAGACGGCGACTCGGGTGTTAGGAGGAGACGCAGTGCGCGCCTCCGGCGATGGACAACACCGGACAACAACCAGCCGTGA.

[0188] The sequence shown in SEQ ID NO.2 (specific fragment nucleotide sequence):

[0189] CTGATCCGAAGCTAGTGTGCCCCCTCTGCCGTGGGGAGATAACAGATTGGATTATTGTTGAGTCTGCTCGTTGTTTCATGAATGCGAAATCAAGAAATTGTTCTTGTGAGACATGTAATTATAGCGGAACATATGCAGATCTCAGGAAGCATGCGAGGCTGGAGCATCCACTAGTGTGCCCATCAGAGGCAGATCCAGAGC GACAGCGTACCTGGAGGAGTTTGGAGCGACAGAGGGATATTGGCGACTTGTTCAGCTCAATCCAATCTTCAGTTGGAGAGGATAGGGGTGATGATAGCAGTAGTTTGCCTGCTGATGACGGTGCAGGCTGGCTAACCATATTCTTTCTAGTTAGAGTAGTTCGACCCGGGTCCAGTTCAAGGAGCAGCAGCTGGTCTGGTA.

[0190] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the apple C2H2 zinc finger protein transcription factor MdZAT1 gene in any of the following: (1) Application in regulating the synthesis of anthocyanins in apple peel; (2) Application in regulating apple peel coloring; (3) Application in the improvement of apple peel anthocyanin accumulation and / or apple peel coloring; in, The nucleotide sequence of the MdZAT1 gene is as shown in SEQ ID NO.

1.

2. The use of the protein encoding the MdZAT1 gene as described in claim 1 in any of the following: (1) Application in regulating the synthesis of anthocyanins in apple peel; (2) Application in regulating apple peel coloring; (3) Application in the improvement of apple peel anthocyanin accumulation and / or apple peel coloring.

3. The application as described in any one of claims 1-2, characterized in that, The MdZAT1 gene regulates the synthesis of anthocyanins in apple peel by: overexpressing the MdZAT1 gene to reduce the amount of anthocyanins synthesized in apple peel; and silencing the MdZAT1 gene to increase the amount of anthocyanins synthesized in apple peel.

4. The use of a silencing vector containing a fragment of the apple C2H2 zinc finger protein transcription factor MdZAT1 gene in any of the following: (1) Application in promoting the synthesis of anthocyanins in apple peel; (2) Application in variety improvement to increase anthocyanin content in apple peel; The nucleotide sequence of the MdZAT1 gene fragment is as shown in SEQ ID NO.

2.

5. The use of the recombinant bacteria comprising the silencing vector of claim 4 in any of the following: (1) Application in promoting the synthesis of anthocyanins in apple peel; (2) Application in variety improvement to increase anthocyanin content in apple peel.

6. A method for improving anthocyanin synthesis in apple peel, characterized in that, The method includes the step of constructing the recombinant bacteria as described in claim 5, and transferring the recombinant bacteria into apples to inhibit the expression of the MdZAT1 gene, wherein the nucleotide sequence of the MdZAT1 gene is as shown in SEQ ID NO.1.