SiRNA (small interfering Ribonucleic Acid) for targeting AGT gene expression as well as conjugate and application of siRNA

Abstract

The invention provides a siRNA (small interfering Ribonucleic Acid) for inhibiting the expression of an angiotensinogen (AGT) gene and a conjugate of the siRNA. The siRNA provided by the invention has good stability, excellent AGT gene inhibitory activity, satisfactory cytotoxicity and immune irritation, and can significantly reduce the AGT protein concentration at the animal level.

Description

Technical Field

[0001] The present invention relates to an siRNA for inhibiting the expression of angiotensinogen (AGT) gene, its conjugate, a pharmaceutical composition, and its use in the prevention and / or treatment of diseases related to abnormal blood pressure. Background Art

[0002] Angiotensinogen (AGT) is an important component of the renin-angiotensin system (RAS) in the human body, and the entire RAS plays a key role in the regulation of animal blood pressure. AGT is synthesized and secreted in the liver, and then angiotensin I is produced under the action of the enzyme renin (REN), and then converted into angiotensin II under the action of angiotensin-converting enzyme (ACE). Most angiotensin II can bind to the type I angiotensin II receptor, resulting in vasoconstriction and causing blood pressure to rise. This molecule also stimulates the production of the hormone aldosterone, which triggers the renal absorption of Na + ions and water, thus leading to an increase in blood volume and further causing blood pressure to rise.

[0003] Hypertension is a serious disease that significantly increases the risk of suffering from heart, brain, kidney diseases and other diseases. According to data released by the World Health Organization, it is estimated that 1.28 billion adults aged 30-79 worldwide suffer from hypertension, and only 42% of hypertensive patients are diagnosed and treated, and the blood pressure of 21% of hypertensive patients is effectively controlled. Hypertension is a major cause of premature death around the world. At the same time, according to a report in The Lancet (Lancet 2019; 394: 1145–58), the number of deaths due to hypertension in China reached 2.54 million in 2017, ranking first among all risk factors for death.

[0004] Currently, the first-line drugs used in clinical treatment of hypertension are divided into five categories: angiotensin enzyme inhibitors, angiotensin II receptor blockers, β-adrenergic receptor blockers, dihydropyridine calcium channel blockers, and diuretics. The antihypertensive mechanisms of these five types of antihypertensive drugs are completely different. According to the age of the patient, the degree of hypertension, and the risk degree of related clinical complications, ordinary patients will be treated with one of them. If one method has poor efficacy, two or even three methods will be used in combination. For high-risk patients, two or even three methods will be directly used in combination. If blood pressure cannot be effectively controlled by triple combination therapy, it is called refractory hypertension. Refractory hypertension is a common and difficult problem in the treatment of hypertension. Developing effective, safe, stable and long-acting antihypertensive drugs has great clinical value.

[0005] The present application provides a small interfering RNA (siRNA) preparation targeting AGT, which can specifically bind to the mRNA of AGT, disrupt the normal translation template function of AGT mRNA, thereby preventing the translation of AGT protein, inhibiting the RAS pathway from the source, and being used for treating / preventing related diseases caused by the RAS pathway, such as hypertension, including refractory hypertension and uncontrolled hypertension.

[0006] Compared with traditional drugs, siRNA has poor stability, and there is a disadvantage that it is easily degraded by nucleases during systemic administration; in addition, while further improving the activity, it is also necessary to avoid side effects such as off-target effects, immune stimulation, and cytotoxicity. Therefore, it has become an urgent problem to develop more candidate siRNAs that are stable in the blood, have good biological activity, low cytotoxicity, and can inhibit AGT gene expression for a long time; at the same time, it is necessary for clinical research and commercially viable to develop drugs that can effectively prevent and / or treat hypertension-related diseases using the above-mentioned candidate siRNAs that inhibit AGT gene expression. Summary of the Invention

[0007] The present invention provides an siRNA for inhibiting AGT gene expression, and the siRNA comprises a sense strand and an antisense strand; wherein, the antisense strand comprises a sequence that differs from the nucleotide sequence (3'→5') AGCAGUAGGUGUUACUCUCAUGU (SEQ ID NO: 2) by no more than 3 nucleotides; the sense strand is at least partially complementary to the antisense strand.

[0008] In some embodiments of the present invention, the antisense strand comprises a sequence that differs from the nucleotide sequence (3'→5') AGCAGUAGGUGUUACUCUCAUGU (SEQ ID NO: 2) by no more than 2 nucleotides; in some embodiments of the present invention, the antisense strand comprises a sequence that differs from the nucleotide sequence (3'→5') AGCAGUAGGUGUUACUCUCAUGU (SEQ ID NO: 2) by no more than 1 nucleotide; in some embodiments of the present invention, the antisense strand comprises the nucleotide sequence (3'→5') AGCAGUAGGUGUUACUCUCAUGU (SEQ ID NO: 2).

[0009] The at least partial complementarity means that the two sequences can be completely complementary, or there are generally no more than 5, 4, 3, or 2 mismatched base pairs, while retaining the ability to hybridize under relevant conditions.

[0010] Preferably, the sense strand and the antisense strand are complementary with at least 15, 16, 17, 18, 19, 20 or 21 nucleotides.

[0011] In some embodiments of the present invention, the antisense strand comprises the nucleotide sequence (3'→5') AGCAGUAGGUGUUACUCUCAUGU (SEQ ID NO:2); the sense strand comprises the nucleotide sequence (5'→3') GUCAUCCACAAUGAGAGUACA (SEQ ID NO:1).

[0012] In some embodiments of the present invention, the length of the antisense strand is 19 to 23 nucleotides; the length of the sense strand is 19 to 21 nucleotides.

[0013] In some specific embodiments, the length of the antisense strand is 19 nucleotides and the length of the sense strand is 19 nucleotides. In some specific embodiments, the length of the antisense strand is 21 nucleotides and the length of the sense strand is 19 nucleotides. In some specific embodiments, the length of the antisense strand is 21 nucleotides and the length of the sense strand is 21 nucleotides. In some specific embodiments, the length of the antisense strand is 23 nucleotides and the length of the sense strand is 21 nucleotides.

[0014] In some embodiments of the present invention, the siRNA comprises one or more single-stranded nucleotide overhangs. For example, overhangs of 1, 2, 3 or 4 nucleotides. In some embodiments of the present invention, the overhangs can be on the sense strand, the antisense strand or any combination thereof. In some embodiments of the present invention, the overhangs are present at the 5'-end, 3'-end or both ends of the siRNA antisense strand or sense strand.

[0015] In some embodiments of the present invention, the 3'-end of the antisense strand of the siRNA has an overhang of 2 nucleotides.

[0016] In some embodiments of the present invention, the siRNA has blunt ends. In some embodiments of the present invention, the siRNA has at least one blunt end, located at the 5'-end of the antisense strand (or the 3'-end of the sense strand).

[0017] In some embodiments of the present invention, the siRNA has two blunt ends.

[0018] In some embodiments of the present invention, the 3'-end of the antisense strand of the siRNA has an overhang of 2 nucleotides.

[0019] In some embodiments of the present invention, the nucleotide sequence of the siRNA is:

[0020] Sense strand: (5'→3') GUCAUCCACAAUGAGAGUACA (SEQ ID NO:1);

[0021] Antisense strand: (3'→5') AGCAGUAGGUGUUACUCUCAUGU (SEQ ID NO:2).

[0022] In some embodiments of the present invention, the siRNA contains at least one modified nucleotide.

[0023] In some embodiments of the present invention, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

[0024] In some embodiments of the present invention, the modified nucleotides are selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-acyclic nucleotide analogs, 2'-fluoroarabinonucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing phosphorothioate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, nucleotides containing 5'-phosphate mimics, diol modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleic acids (LNA), unlocked nucleic acids (UNA), or glycerol nucleotides (GNA), but the present invention is not limited thereto.

[0025] In some embodiments of the present invention, the modified nucleotide sequences of the siRNA are selected from:

[0026] 1) The nucleotides at positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and there is at least 1 more 2'-fluoro nucleotide at the remaining positions; and / or

[0027] 2) The nucleotides at positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least 1 more 2'-fluoro nucleotide at the remaining positions; and / or

[0028] 3) The nucleotides at positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least 1 glycerol nucleotide at the remaining positions; and / or

[0029] 4) The nucleotides at positions 2, 6, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least 1 base-modified nucleotide at the remaining positions.

[0030] In some embodiments of the present invention, the modified nucleotide sequences of the siRNA are selected from:

[0031] 1) The nucleotides at positions 9, 10, and 11 at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and / or

[0032] 2) The nucleotides at positions 2, 6, 14, and 16 at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and / or

[0033] 3) The nucleotides at positions 2, 6, 14, and 16 at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and at least one base of the remaining positions is a modified nucleotide; and / or

[0034] 4) The nucleotides at positions 2, 6, 8, 9, 14, and 16 at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and / or

[0035] 5) The nucleotides at positions 2, 6, 8, 9, 14, and 16 at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and at least one base of the remaining positions is a modified nucleotide;

[0036] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the nucleotides at positions 2, 6, 14, and 16 at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the nucleotides at positions 7, 9, 10, and 11 at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0037] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the nucleotides at positions 2, 6, 10, 14, and 16 at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the nucleotides at positions 7, 9, 10, and 11 at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0038] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the nucleotides at positions 2, 6, 14, and 16 at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the nucleotides at positions 9, 10, and 11 at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0039] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 6th, 8th, 9th, 10th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, and 11th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0040] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 6th, 8th, 9th, 10th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, 11th, and 15th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0041] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 6th, 10th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 3rd, 7th, 9th, 10th, and 11th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0042] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 6th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, and 11th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0043] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 3rd, 4th, 6th, 8th, 10th, 14th, 16th, 18th, 20th, and 22nd positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 2nd position at the 5'-end of the sense strand is 2'-fluoro nucleotide, and the remaining positions are 2'-methoxy nucleotides.

[0044] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 4th, 5th, 6th, 8th, 10th, 14th, 16th, 18th, 20th, and 22nd positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 2nd position at the 5'-end of the sense strand is a 2'-fluoro nucleotide, and the remaining positions are 2'-methoxy nucleotides.

[0045] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 4th, 6th, 7th, 8th, 10th, 14th, 16th, 18th, 20th, and 22nd positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 2nd position at the 5'-end of the sense strand is a 2'-fluoro nucleotide, and the remaining positions are 2'-methoxy nucleotides.

[0046] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 4th, 6th, 8th, 10th, 14th, 16th, 18th, and 20th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 1st, 3rd, 5th, 7th, 9th, 10th, 11th, 13th, 15th, 17th, 19th, and 21st positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0047] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 4th, 6th, 8th, 10th, 14th, 16th, 18th, 20th, and 22nd positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 1st, 3rd, 5th, 7th, 9th, 10th, 11th, 13th, 15th, 17th, 19th, and 21st positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0048] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 6th, 8th, 9th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, the 7th position is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, and 11th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0049] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 8th, 9th, 10th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, the 6th position is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, 11th, and 15th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0050] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 8th, 9th, 10th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, the 4th position is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, 11th, and 15th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0051] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 8th, 9th, 10th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, the 5th position is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, 11th, and 15th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0052] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 8th, 9th, 10th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, the 7th position is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, 11th, and 15th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0053] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 8th, 9th, 10th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, the 6th position is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 9th, 10th, and 11th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0054] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 5th, 7th, and 12th positions at the 5'-end of the antisense strand are 2'-deoxynucleotides, the 14th position is a 2'-fluoronucleotide, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA has a length of 21 nucleotides, wherein the 9th, 10th, and 11th positions at the 5'-end of the sense strand are 2'-fluoronucleotides, and the other positions are 2'-methoxynucleotides.

[0055] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 23 nucleotides, wherein the 2nd, 5th, 7th, and 12th positions at the 5'-end of the antisense strand are 2'-deoxynucleotides, the 6th, 8th, 9th, 10th, 14th, and 16th positions are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, and 11th positions at the 5'-end of the sense strand are 2'-fluoronucleotides, and the other positions are 2'-methoxynucleotides.

[0056] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 21 nucleotides, wherein the 2nd, 6th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 5th, 7th, and 9th positions at the 5'-end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0057] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 21 nucleotides, wherein the 2nd, 6th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 7th, 9th, 10th, and 11th positions at the 5'-end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0058] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 21 nucleotides, wherein the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, 16th, 18th, and 20th positions at the 5'-end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 9th, 10th, and 11th positions at the 5'-end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0059] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 21 nucleotides, wherein the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, 16th, 18th, and 20th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 21 nucleotides, wherein the 1st, 3rd, 5th, 7th, 9th, 11th, 13th, 15th, 17th, 19th, and 21st positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0060] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 21 nucleotides, wherein the 2nd, 6th, 14th, and 16th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 19 nucleotides, wherein the 7th, 8th, and 9th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0061] In some embodiments of the present invention, the antisense strand of the siRNA has a length of 19 nucleotides, wherein the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, 16th, and 18th positions at the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA has a length of 19 nucleotides, wherein the 7th, 8th, and 9th positions at the 5'-end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0062] In some embodiments of the present invention, the modified nucleotide is a nucleotide in which the phosphate group is modified with a phosphorothioate group. That is, a sulfur atom replaces the non-bridging oxygen atom in the phosphodiester bond, thereby replacing the phosphodiester bond with a phosphorothioate bond.

[0063] In some embodiments of the present invention, the 5'-end and 3'-end of the sense strand independently comprise 1 or 2 phosphorothioate linkages; and / or the 5'-end and 3'-end of the antisense strand independently comprise 1 or 2 phosphorothioate linkages.

[0064] In some embodiments of the present invention, between the 1st and 2nd nucleotides at the 5'-end of the sense strand, between the 2nd and 3rd nucleotides at the 5'-end of the sense strand, between the 1st and 2nd nucleotides at the 3'-end of the sense strand, between the 2nd and 3rd nucleotides at the 3'-end of the sense strand, between the 1st and 2nd nucleotides at the 3'-end of the antisense strand, between the 2nd and 3rd nucleotides at the 3'-end of the antisense strand, between the 1st and 2nd nucleotides at the 5'-end of the antisense strand, and between the 2nd and 3rd nucleotides at the 5'-end of the antisense strand, at least one is a phosphorothioate linkage; preferably at least four are phosphorothioate linkages; in some embodiments of the present invention, at least six are phosphorothioate linkages; in some embodiments of the present invention, all eight are phosphorothioate linkages.

[0065] In some embodiments of the present invention, between the 1st and 2nd nucleotides at the 5'-end of the sense strand and between the 2nd and 3rd nucleotides are phosphorothioate linkages.

[0066] In some embodiments of the present invention, between the 1st and 2nd nucleotides at the 5'-end of the sense strand and between the 2nd and 3rd nucleotides are phosphorothioate linkages, and between the 1st and 2nd nucleotides at the 3'-end and between the 2nd and 3rd nucleotides are phosphorothioate linkages.

[0067] In some embodiments of the present invention, between the 1st and 2nd nucleotides at the 3'-end of the antisense strand and between the 2nd and 3rd nucleotides are phosphorothioate linkages, and between the 1st and 2nd nucleotides at the 5'-end and between the 2nd and 3rd nucleotides are phosphorothioate linkages.

[0068] In some embodiments of the present invention, between the 1st and 2nd nucleotides at the 5'-end of the sense strand, between the 2nd and 3rd nucleotides at the 5'-end of the sense strand, between the 1st and 2nd nucleotides at the 3'-end of the sense strand, between the 2nd and 3rd nucleotides at the 3'-end of the sense strand, between the 1st and 2nd nucleotides at the 3'-end of the antisense strand, between the 2nd and 3rd nucleotides at the 3'-end of the antisense strand, between the 1st and 2nd nucleotides at the 5'-end of the antisense strand, and between the 2nd and 3rd nucleotides at the 5'-end of the antisense strand are all phosphorothioate linkages.

[0069] In some embodiments of the present invention, the sense strand may include one or more capping residues or moieties, referred to as "capping residues". A "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or both ends of the nucleotide sequence of the siRNA. In some embodiments of the present invention, the capping residue is present at the 5'-end, 3'-end or both the 5'-end and 3'-end of the sense strand.

[0070] In some embodiments of the present invention, an inverted abasic residue (invAb) is added as a capping residue. See F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16. In some embodiments of the present invention, the 5'-end and / or 3'-end of the sense strand may contain more than one inverted abasic deoxyribose moiety as a capping residue.

[0071] In some embodiments of the present invention, one or more inverted abasic residues (invAb) are added to the 3'-end of the sense strand. In some embodiments of the present invention, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments of the present invention, one or more inverted abasic residues may be inserted between the delivery vector portion and the nucleotide sequence of the siRNA sense strand. In some embodiments of the present invention, one or more inverted abasic residues are included at or near one or more ends of the siRNA sense strand. The inverted abasic residue (invAb) is selected from the following structures:

[0072]

[0073] wherein R = O or S.

[0074] In some embodiments of the present invention, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments of the present invention, one or more inverted abasic residues may be inserted between the delivery vector portion and the nucleotide sequence of the siRNA sense strand.

[0075] The inverted abasic residue may be linked via a phosphodiester, phosphorothioate or other internucleoside linkage.

[0076] In some embodiments of the present invention, the first nucleotide at the 5'-end of the antisense strand is selected from the following structures:

[0077]

[0078] wherein Base is a base A, U, G, C, T or other nucleobase.

[0079] In some embodiments of the present invention, the first nucleotide at the 5'-end of the antisense strand is selected from the following structures:

[0080]

[0081] wherein Base is a base A, U, G, C, T or other nucleobase.

[0082] In some embodiments of the present invention, the first nucleotide at the 5'-end of the antisense strand is a nucleotide modified with (E)-vinyl phosphate.

[0083] In some embodiments of the present invention, the base of the base-modified nucleotide is selected from the following structures:

[0084]

[0085] In some embodiments of the present invention, the base-modified nucleotides are located at the 5th, 6th, 7th, and 8th positions of the antisense strand of the siRNA.

[0086] In some embodiments of the present invention, the base-modified nucleotides are located at the single-stranded nucleotide overhang of the siRNA.

[0087] Preferably, the antisense strand of the siRNA has an overhang of 2 nucleotides, and the base-modified nucleotide is the first nucleotide at the overhang of the antisense strand of the siRNA.

[0088] Preferably, the antisense strand of the siRNA has an overhang of 2 nucleotides, and the base-modified nucleotide is the second nucleotide at the overhang of the antisense strand of the siRNA.

[0089] The present invention also provides an siRNA conjugate obtained by conjugating the above siRNA with a delivery vector.

[0090] In the present invention, unless otherwise specified, "conjugation" means that two or more chemical moieties are connected to each other by covalent bonding; "conjugate" means a compound formed by covalent bonding between individual chemical moieties; "siRNA conjugate" means a compound formed by covalently linking one or more chemical moieties to an siRNA. It should be noted here that the individual chemical moieties can be directly linked to the siRNA or can be linked to the siRNA through a linker.

[0091] In some embodiments of the present invention, the delivery vector is connected to the siRNA by a covalent bond to form a conjugate molecule.

[0092] In some embodiments of the present invention, the siRNA of the present invention can be conjugated with a pharmaceutically acceptable conjugate molecule to obtain an siRNA conjugate. In some embodiments of the present invention, the siRNA is covalently conjugated to the conjugate molecule. To reduce the possible impact of conjugation on the activity of the siRNA, the conjugation site of the siRNA and the conjugate molecule can be at the 3'-end or 5'-end of the sense strand of the siRNA, or at the 5'-end of the antisense strand. In some embodiments, the conjugation site of the siRNA and the conjugate molecule can also be in the internal sequence of the siRNA.

[0093] The pharmaceutically acceptable delivery carrier may be a delivery carrier conventionally used in the field of siRNA administration, such as, but not limited to, one or more of the following delivery carriers or their derivatives: lipophilic molecules, such as cholesterol, bile acids, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as transmembrane peptides; aptamers; antibodies; quantum dots; saccharides, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folate; or receptor ligands expressed by hepatocytes, such as asialoglycoprotein, asialoglycoprotein residues, lipoproteins (such as high-density lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin, etc.

[0094] In some embodiments of the present invention, the delivery carrier comprises N-acetylgalactosamine.

[0095] In some embodiments of the present invention, the delivery carrier is directly linked to the 3'-end of the sense strand of siRNA.

[0096] In some embodiments of the present invention, the delivery carrier is directly linked to the 5'-end of the sense strand of siRNA.

[0097] In some embodiments of the present invention, the delivery carrier comprises N-acetylgalactosamine, which is covalently linked to the 3'-end of the sense strand of siRNA.

[0098] In some embodiments of the present invention, the delivery carrier has the following structure:

[0099]

[0100]

[0101] In some embodiments of the present invention, the above structure is linked to the 3'-end of the sense strand of siRNA. In some embodiments of the present invention, the delivery carrier has the following structure:

[0102]

[0103]

[0104]

[0105] In some embodiments of the present invention, the above structure is linked to the 5'-end of the sense strand of siRNA.

[0106] In some embodiments of the present invention, the delivery carrier is linked to the inverted abasic residue (invAb) at the 3'-end of the sense strand of siRNA.

[0107] In some embodiments of the present invention, the delivery vector is linked to an inverted abasic residue (invAb) at the 5'-end of the sense strand of the siRNA.

[0108] In some embodiments of the present invention, GalNAc(Ser1) and GalNAc(Ser2) are simultaneously linked to the 3'-end and 5'-end of the sense strand of the siRNA.

[0109] In some embodiments of the present invention, the siRNA conjugate is selected from siRNA conjugates 1 to 502.

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138] The present invention also provides a pharmaceutical composition comprising any one of the above-mentioned siRNAs and / or any one of the above-mentioned siRNA conjugates and a pharmaceutically acceptable carrier.

[0139] In some embodiments of the present invention, the pharmaceutical composition contains one siRNA as described in the first aspect. In some other embodiments of the present disclosure, the pharmaceutical composition contains at least two siRNAs as described in the first aspect (such as but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) as active ingredients. Preferably, the at least two siRNAs as described in the first aspect each target different target sequences in the AGT gene, whereby it is expected to exert simultaneous effects on different target sequences to bring about a synergistic effect. Herein, the so-called "different target sequences" means that there is no overlap between the target sequences, or the number of consecutive nucleotides overlapping between the target sequences is less than 5 (such as 4, 3, 2, 1, 0 consecutive nucleotides overlapping). In this case, the at least two siRNAs as described in the first aspect may be present in any different ratio. Preferably, the at least two siRNAs as described in the first aspect may be present in a molar ratio of 1:100 to 100:1 to each other; more preferably, the at least two siRNAs as described in the first aspect may be present in a molar ratio of 1:10 to 10:1, 1:5 to 5:1 or 1:2 to 2:1 to each other. In some embodiments of the present invention, the at least two siRNAs as described in the first aspect are present in the same molar ratio.

[0140] The present invention also provides the use of any one of the above-mentioned siRNAs and / or any one of the above-mentioned siRNA conjugates and / or the above-mentioned pharmaceutical composition in the preparation of a drug for treating and / or preventing a pathological condition or disease associated with overexpression of the AGT gene.

[0141] Furthermore, the pathological condition or disease is a disease related to abnormal blood pressure.

[0142] The siRNA, siRNA conjugate, and pharmaceutical composition provided by the present invention have good stability, excellent AGT gene inhibitory activity, satisfactory cytotoxicity and immunostimulatory properties, and can significantly reduce blood pressure levels.

[0143] In the present invention, unless otherwise specified, the capital letters C, G, U, A, and T represent the base composition of nucleotides, including modified and unmodified nucleotides; the lowercase letter m indicates that the nucleotide adjacent to the right of the identifier m is a 2'-methoxy nucleotide; the lowercase letter f indicates that the nucleotide adjacent to the right of the identifier f is a 2'-fluoro nucleotide; the lowercase letter d indicates that the nucleotide adjacent to the right of the identifier d is a 2'-deoxy nucleotide; gn indicates that the nucleotide adjacent to the right of the identifier gn is a glycerol nucleotide (GNA); tn indicates that the nucleotide adjacent to the right of the identifier tn is a threose nucleotide (TNA); the identifier * indicates that there is a phosphorothioate linkage between the two nucleotides adjacent to the left and right of the identifier * (or between the nucleotide and the delivery vector); eVP indicates that the nucleotide adjacent to the right of it is a (E)-vinyl phosphate-modified nucleotide; invAb indicates a reverse abasic residue; GalNAc(L96) means that the delivery vector GalNAc(L96) is conjugated thereto. Ser(GN) means that the delivery vector Ser(GN) is conjugated thereto.

[0144] In the present invention, unless otherwise specified, the letters I, m6A, X, B, B1, and B2 respectively represent the bases of modified nucleotides, and are

[0145] In the present invention, unless otherwise specified, the term "complementary" refers to the ability of an oligonucleotide of a first sequence to hybridize with an oligonucleotide of a second sequence under certain conditions and form a double-stranded structure. "At least partially complementary" means that the two sequences can be completely complementary, or there are generally no more than 5, 4, 3, or 2 mismatched base pairs in total, while still retaining the ability to hybridize under relevant conditions. Additionally, in the case where two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be regarded as mismatches when determining complementarity. In the present invention, when meeting the above requirements for hybridization ability, "complementary" sequences can also include or be completely formed from non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing. Correspondingly, in the present invention, unless otherwise specified, "mismatch" means that in an siRNA duplex molecule, the bases at corresponding positions do not pair in a complementary form.

[0146] In the present invention, unless otherwise specified, "difference in nucleotide sequence" means that compared with the original nucleotide sequence, the type of nucleotide base at the same or corresponding position has changed. For example, when a nucleotide base in the original nucleotide sequence is A, and the nucleotide base at the same or corresponding position changes to U, C, G, or dT, dC, dG, etc., it is considered that there is a difference in nucleotide sequence at this position. It should be noted here that when compared with the original nucleotide sequence, if the nucleotides at the same or corresponding position only differ in the presence or type of modification, it is not considered that there is a difference in nucleotide sequence at this position.

[0147] In the present invention, unless otherwise specified, the term "pharmaceutically acceptable" means that a carrier, vehicle, diluent, excipient, and / or the salts / esters / hydrates formed thereby are generally chemically or physically compatible with other components constituting a pharmaceutical dosage form and are physiologically compatible with the receptor.

[0148] In the present invention, unless otherwise specified, the term "inhibit" refers to the situation where the expression of a target gene is down-regulated due to the degradation of the mRNA of the target gene mediated by siRNA. The "down-regulation" means that compared with the situation without siRNA treatment, the expression level of the target gene decreases by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 99% or even 100%. Among them, a 100% decrease in the expression level of the target gene means that there is no detectable level of target gene expression.

[0149] In the present invention, the siRNA may further contain modified nucleotides as needed, and the modified nucleotides will not cause a significant weakening or loss of the function of the siRNA to inhibit AGT gene expression. Currently, there are various ways to modify siRNA in the art, including, for example, backbone modification (such as phosphate group modification), ribose group modification, and base modification, etc. (Watts, J.K., G.F. Deleavey, and M.J. Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55).

[0150] Obviously, based on the above content of the present invention, according to the common general knowledge and conventional means in the art, without departing from the above basic technical idea of the present invention, various other forms of modification, substitution or variation can also be made.

[0151] The following is a further detailed description of the above content of the present invention through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0152] Figure 1 Schematic diagram of the solid-phase synthesis route for synthesizing the sense strand or antisense strand of the siRNA sequence of the present invention using a solid-phase carrier;

[0153] Figure 2 Process route diagram for synthesizing the sense strand or antisense strand of the siRNA sequence of the present invention using a solid-phase carrier. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0154] Those skilled in the art know that the siRNA of the present invention can be obtained by conventional siRNA preparation methods in the art (such as solid-phase synthesis and liquid-phase synthesis), wherein both solid-phase synthesis and liquid-phase synthesis have commercial custom services. Those skilled in the art also clearly know that modified nucleotide groups can be introduced into the siRNA of the present invention by using nucleotide monomers with corresponding modifications. The methods for preparing nucleotide monomers with corresponding modifications are well-known to those skilled in the art, and commercial monomers are also available in the market.

[0155] Example 1: Synthesis of siRNA and Its Conjugates

[0156] For the sense strand and antisense strand of the siRNA sequence of the present invention, as well as the sense strand and antisense strand of the modified duplex, solid-phase carrier is used to initiate strand synthesis; GalNAc(L96)-modified solid-phase carrier is used as the starting cycle for sense strand synthesis, and a general solid-phase carrier (Primer support 5G unylinker 350) is used as the starting cycle for antisense strand synthesis( Figure 1 ). The structure of the GalNAc(L96)-modified solid-phase carrier (L96-PS) is as follows:

[0157]

[0158] The structure of the Primer support 5G unylinker 350 carrier is as follows:

[0159]

[0160] ● represents the PS polystyrene solid-phase carrier

[0161] Using the YB-192S synthesizer and the phosphoramidite solid-phase synthesis method, starting from the solid-phase carrier, nucleoside monomers are sequentially connected in the 3'-5' direction to perform sequence synthesis on a scale of 0.2 umol.

[0162] The process flow is shown in Figure 2 .

[0163] Process description: Oligo synthesis starts from the PS solid-phase carrier and uses the method of protecting with 3'-O-(2-cyanoethyl) phosphoramidite / 4,4'-dimethoxytrityl (dimethoxytrityl, DMT) groups to assemble the oligonucleotide chain on the PS solid-phase carrier. Each synthesis cycle includes 5'-hydroxyl deprotection, coupling, capping, and oxidation (thiolation). Each coupling reaction is carried out by activating the appropriate phosphoramidite monomer and reacting it with the free 5'-hydroxyl group of the protected nucleotide or oligonucleotide fixed on the carrier. The corresponding crude oligonucleotide single strand PS-Oligo is synthesized by cycling according to the sequence information, and the crude oligonucleotide single strand is cleaved from the solid-phase carrier and the relevant protecting groups are removed. Then, it undergoes preparative chromatography purification, ultrafiltration desalting, annealing, and freeze-drying steps to obtain the final product.

[0164] (1) Synthesis procedure

[0165] It includes the following units:

[0166] 1) De-blocking: For ribonucleotides with a DMT group (dimethoxytrityl) protecting the 5'-OH end, in the first step of synthesis, trichloroacetic acid (TCA) is used to remove the DMT protecting group from the solid-phase support and the ribonucleotide, so as to expose the 5'-OH of the ribonucleotide for coupling with a new base.

[0167] 2) Coupling: The nucleotide monomer is mixed with an activating reagent and reacts with PS-Oligo in the synthesis column. The activating reagent provides a proton to the N atom of the diisopropylamide on the 3'-phosphate to form a phosphoramidite tetrazole active intermediate. When the phosphoramidite tetrazole contacts PS-Oligo, it undergoes a nucleophilic reaction with its 5'-hydroxyl group, undergoes coupling and removes the tetrazole, extending one nucleotide.

[0168] 3) Capping: Since the coupling efficiency cannot reach 100%, in order to prevent uncoupled PS-Oligo from continuing to enter the next coupling step, a Cap reagent is used to cap the 5'-hydroxyl group of PS-Oligo.

[0169] 4) Oxidation or thiolation: After the coupling reaction, the nucleotide is connected to the oligonucleotide on the PS support through a phosphite bond (trivalent phosphorus). This phosphite bond is unstable and is easily hydrolyzed by acids and bases. An oxidizing reagent is used to oxidize the trivalent phosphorus here to pentavalent phosphorus. Thiolation means that under weak alkaline conditions, a thiolating reagent is used to react with the trivalent phosphorus of the phosphite bond to form a phosphorothioate bond.

[0170] 5) Removal of the VP protecting group and ammonolysis

[0171] Transfer the synthesized PS-oligo from the synthesis column to a centrifuge tube. Prepare a deprotection reagent according to the volume ratio of 3:2:100 = TMS-I:pyridine:DCM, add the deprotection reagent to the centrifuge tube and react for 30 min. Prepare a TEA / acetonitrile = 1:1 solution, add 2-mercaptoethanol (final concentration 2 M), mix well, and add it to the reaction to terminate the reaction. Remove the supernatant and wash the PS-oligo 5 min × 2 times. After washing, add an ammonolysis solution (2-mercaptoethanol (2 M) / 28% ammonia water) for ammonolysis for 10 h. After ammonolysis, remove the ammonia water by vacuum centrifugation and carry out purification.

[0172] For the sense strand and antisense strand of other siRNA sequences of the present invention and the sense strand and antisense strand of the modified duplex, they are prepared by a similar method.

[0173] (2) Purification

[0174] The ammonolysis-diluted sample is purified by anion exchange column chromatography, and the liquid phase system uses high performance liquid chromatography. The chromatographic conditions are as follows.

[0175] Chromatographic column: PS-15Q 10*250mm

[0176] Flow rate: 4 ml / min

[0177] Detection wavelength: 260 nm

[0178] Ion column preparation and purification gradient program:

[0179] Mobile phase: Phase A: 10 mM NaOH solution (pH = 10); Phase B: 10 mM NaOH solution (pH = 10) + 2 M NaCl

[0180]

[0181] The prepared samples are subjected to mass spectrometry confirmation and purity confirmation.

[0182] (3) Ultrafiltration

[0183] The purified sample is dissolved in 4 ml of PBS, transferred to a 1K ultrafiltration tube, centrifuged at 5000 r / min for 45 min, and then the liquid in the centrifuge tube is detected using Nanodrop to check for the presence of the sample. If the sample is detected at a wavelength of 260 nm, it indicates that the ultrafiltration membrane is damaged and the ultrafiltration tube needs to be replaced for re-ultrafiltration; if no sample is detected at a wavelength of 260 nm, 4 ml of RNase water is added and ultrafiltration is performed again. Ultrafiltration is carried out 3 times, 45 min each time.

[0184] (4) Annealing

[0185] After the ultrafiltration of the sense strand and the antisense strand is completed, the samples are diluted to a concentration of 3 mg / ml respectively, and the sense strand and the antisense strand are mixed in a molar ratio of 1:1. The water bath is heated to 90 °C, and the mixed sense strand and antisense strand are placed in the water bath for annealing for 30 min. The water bath is turned off and allowed to cool naturally to room temperature for 16 h. 10 μL of the sample is taken for HPLC detection.

[0186] LC-MS representative test method

[0187] In this experiment, the parent ions were fragmented at an energy of 15 - 25 eV to obtain a result with a coverage rate of 100%, that is, the sequence of the test sample is consistent with the theoretical sequence. The confirmation results are shown in the following table.

[0188]

[0189] Example 2: In vitro activity detection

[0190] Cell culture and transfection

[0191] Cell culture: Hep3B cells (ATCC) were cultured in MEM complete medium (Gibco, supplemented with 10% FBS) at 37 °C in a 5% CO2 environment until near confluence. Then, the cells were digested with trypsin and plated. A 12-well plate was used, and 2.0×105 Hep3B cells and 1.0 mL of MEM complete medium (Gibco, supplemented with 10% FBS) were added to each well. After culturing for 16 - 24 h at 37 °C in a 5% CO2 environment, transfection was performed.

[0192] Cell transfection: 1.5 μL of lipofectamine RNAiMax (Invitrogen) was added to 48.5 μL of opti-MEM per well, and then 50 μL of the siRNA duplex, siRNA modified duplex, or siRNA conjugate prepared in Example 1 was added for mixing. The mixture was added to a PCR tube and incubated at room temperature for 5 minutes. Finally, the mixture was added to the above cells, and after continuing to culture for 24 h, RNA extraction was performed. Single-dose experiments were carried out at siRNA duplex concentrations of 10 nM and 0.1 nM or 0.1 nM and 0.01 nM. IC50 test experiments were carried out at siRNA duplex concentrations of 10 nM, 1.0 nM, 0.1 nM, 0.01 nM, 0.001 nM, 0.0001 nM, and 0.00001 nM. The IC50 was calculated based on the inhibitory effect of different concentrations of duplexes on the target mRNA, and the IC50 calculation method was carried out using the 'log(inhibitor) vs. response--Variable slope (four parameters)' mode in Prism 8.0 software.

[0193] RNA extraction

[0194] Using a total RNA isolation kit (Omega, cat: R6834-02): The cells were collected, washed with 1% PBS, and then 400 μL of lysis buffer (containing 2% β-mercaptoethanol) was added to lyse the cells. The subsequent steps were carried out according to the instructions of this RNA isolation kit. Finally, 30 μL of RNase-free water was added, and after standing for 2 minutes, the RNA was collected by centrifugation at 14000 g for 2 minutes.

[0195] cDNA synthesis

[0196] cDNA synthesis was performed using the gDNA removal cDNA synthesis kit from TransGen Biotech (TransGen Biotech Co., Ltd., Beijing, China Cat# AE311-03). 1 μg of total RNA was added to each sample, and cDNA synthesis was carried out using a gradient thermal cycler (LongGene, A600) according to the instructions.

[0197] Real-time fluorescence quantitative PCR

[0198] Add the synthesized cDNA and the master mix (containing primers, qPCR premix, and ultrapure water) to a 384-well plate (BioCore Cat# PC-0040-9U) so that the final real-time fluorescence quantitative PCR system contains 0.25 μM each of the upstream and downstream primers for the target gene (AGT) or the internal reference gene (GADPH), and 1× SYBR Green premix (Applied Biosystem Cat# A25742).

[0199] AGT forward primer: 5’-ACTATCTCCCCGGACCATCC-3’; AGT reverse primer: 5’-ACTATCTCCCCGGACCATCC-3’; GADPH forward primer: 5’-ATGGGGAAGGTGAAGGTCG-3’; GADPH reverse primer: 5’-GGGGTCATTGATGGCAACAATA-3’.

[0200] Perform real-time fluorescence PCR in an ABI QuantStudio TM 6 real-time fluorescence PCR system. Each duplex is subjected to 3 - 4 independent transfection tests, and each transfection is performed in triplicate or quadruplicate.

[0201] The in vitro activity test results of some conjugates are shown in the following table. Among them, PC c, which is known to have an inhibitory effect on the AGT gene, is used as a positive control.

[0202] Table 2. Single-dose Hep3B activity

[0203]

[0204]

[0205] *: This value is the relative expression level of AGT mRNA compared to the blank control

[0206] Among them, PC c is the positive control, which is known to have an inhibitory effect on the AGT gene, and its structure is as follows:

[0207] Sense strand:

[0208] mG*mU*mCmAmUmCfCmAfCfAfAmUmGmAmGmAmGmUmAmCmA GalNAc (L96)

[0209] Antisense strand:

[0210] mU*fG*mUmAmCgnTmCmUmCmAmUmUmGfUmGfGmAmUmGmAmC*mG*mA

[0211] Experimental data show that the siRNA conjugate of the present invention has a good effect of inhibiting AGT gene expression in vitro.

[0212] Example 3: siRNA Stability

[0213] The siRNA to be tested was placed in 50% mouse serum and mixed well, and incubated at 37 °C for 4 h, 24 h, and 48 h respectively. After incubation, phenol-chloroform (Beyotime, Cat:#p1011) with a volume of 1 / 3 of the sample volume was added, vortexed well, allowed to stand for 5 min, and then centrifuged at 12,000 rpm for 30 min. The top aqueous phase was taken into a new centrifuge tube, 1 / 10 volume of 3M NaAC (Solarbio, Cat:#A1070) was added and mixed well, then 2.5 times volume of pre-cooled absolute ethanol and 1 μL glycogen (Beyotime, CAT:#0812) were added and mixed well, and placed at -20 °C for 2 min. Centrifuged at 12,000 rpm for 30 min, the supernatant was discarded, and after drying, it was dissolved in RNAse-free water. The dissolved sample was mixed with formamide loading buffer, and nucleic acid electrophoresis was detected using a 10% PAGE gel. After electrophoresis, the PAGE gel was stained with GelRed (Beyotime, Cat:#D0140) for 30 min, and finally the PAGE gel was imaged using a gel imager (Bio-Rad).

[0214] The siRNA to be tested was incubated with nuclease PDEI (Sigma-Aldrich, Cat:#P3243-1VL) at 40 mU - 80 mU / μg siRNA in a buffer of 50 mM Tris (pH 8.9) and 10 mM MgCl2. The reaction mixture was incubated at 25 °C for 24 hours. The reaction was terminated by adding 5 μL of 50 mM EDTA. The reaction solution was mixed with formamide loading buffer, and nucleic acid electrophoresis was detected using a 10% PAGE gel. After electrophoresis, the PAGE gel was stained with GelRed (Beyotime, Cat:#D0140) for 30 min, and finally the PAGE gel was imaged using a gel imager (Bio-Rad).

[0215] The siRNA to be tested was incubated with 0.5U - 50U / μg nuclease PI (NEB, Cat: #M0660S) in a buffer of 1X Nuclease P1 buffer. The reaction mixture was incubated at 37°C for 24 hours. The reaction was terminated by adding 5 μL of 50 mM EDTA. The reaction solution was mixed with formamide loading buffer, and nucleic acid electrophoresis was performed using a 10% PAGE gel for detection. After electrophoresis, the PAGE gel was stained with GelRed (Beyotime, Cat: #D0140) for 30 min, and finally, the PAGE gel was imaged using a gel imager (Bio-Rad).

[0216] Example 4: Detection of siRNA off-target (psiCHECK detection of off-target caused by the seed region)

[0217] The completely matched target (cm) is completely matched with the siRNA, while the seed-matched target (sm) consists of two parts: the 8 nt at the 3'-end of the target is complementary in sequence to the corresponding 5'-end (nucleotide position 1) and the seed (position 2 - 8) of the siRNA, while the remaining 15 nt is completely non-homologous to the siRNA. The chemically synthesized cm or sm target was inserted into the corresponding restriction enzyme site of psiCHECK-1 to generate psiCHECK-cm and psiCHECK-sm, which were expressed as fusion mRNAs of Renilla-luc / cm or sm target in transfected cells.

[0218] 293T cells (Nanjing Kebai) were seeded into 96-well plates at 20,000 cells / well; using lipofectamine2000, the siRNA to be tested was co-transfected with 25 ng of psiCHECK–cm or psiCHECK-sm respectively. After culturing for 24 h in an environment of 37°C and 5% CO2, the Dual-Glo luciferase assay system (Promega, E2920) was used to perform a dual-luciferase reporter assay to determine the target knockout activity. Each duplex was subjected to 3 - 4 independent transfection tests. Target knockout was determined by measuring the Renilla luciferase normalized to the constitutively expressed firefly luciferase level.

[0219] Table 3. Single-dose Hep3B activity

[0220] On target IC50 Off target IC50 Ratio PC c(-GNA) 0.0183 nM 0.1309 nM 7.15 PC c 0.0063 nM 2.73 nM 433 Conjugate 1 0.0080 nM >50 nM >6250 Conjugate 2 0.0124 nM >50 nM >4032

[0221] Among them,

[0222] PC c is the positive control, and its structure is as follows:

[0223] Sense strand:

[0224] mG*mU*mCmAmUmCfCmAfCfAfAmUmGmAmGmAmGmUmAmCmA GalNAc(L96)

[0225] Antisense strand:

[0226] mU*fG*mUmAmCgnTmCmUmCmAmUmUmGfUmGfGmAmUmGmAmC*mG*mA

[0227] PC c(-GNA) is a positive control without GNA-modified bases, and its structure is as follows:

[0228] Sense strand:

[0229] mG*mU*mCmAmUmCfCmAfCfAfAmUmGmAmGmAmGmUmAmCmA GalNAc(L96) Antisense strand:

[0230] mU*fG*mUmAmCfUmCmUmCmAmUmUmGfUmGfGmAmUmGmAmC*mG*mA

[0231] Experimental data show that some siRNA conjugates of the present invention have excellent anti-off-target effects.

[0232] Example 5: In vivo activity detection of siRNA

[0233] Male hAGT humanized mice at 6-8 weeks old (provided by Jiangsu Jicui, T054372). Mice were not fasted before grouping and dosing. Blood was collected to separate serum for ELISA (abcam#) detection of hAGT. Mice were randomly divided into 4 groups of 6 each according to the hAGT level, defined as day0. On Day1, PBS, AD85481, conjugate 1, and conjugate 2 were subcutaneously injected respectively, and the drug dose was 1.0 mpk. On days 8, 15, 22, and 29 after dosing, blood was collected to separate serum for ELISA detection of hAGT. The serum protein concentration of each group at each time point was compared with the serum protein concentration of the PBS group at the same time point. The detection results of different conjugates are shown in Table 4 or Table 5

[0234] Table 4. Changes in hAGT protein expression before and after dosing

[0235]

[0236] *This value is the relative expression level of hAGT protein content compared with the PBS control group

[0237] #Indicates a significant difference compared with PC c at the same time point (p value < 0.05)

[0238] Table 5. Changes in hAGT protein expression before and after administration

[0239]

[0240]

[0241] * This value is the relative expression level of hAGT protein content compared with the PBS control group

[0242] # Indicates a significant difference compared with PC c at the same time point (p value < 0.05)

[0243] Experimental data show that some siRNA conjugates of the present invention have a good effect of inhibiting hAGT protein expression in vivo.

[0244] In summary, the siRNA provided by the present invention has good stability, excellent AGT gene inhibitory activity, and can significantly reduce the AGT protein concentration at the animal level.

Claims

1. A siRNA for inhibiting AGT gene expression, characterized in that: The siRNA comprises a sense strand and an antisense strand; wherein the antisense strand comprises a sequence that differs from the nucleotide sequence (3'→5') AGCAGUAGGUGUUACUCUCAUGU (SEQ ID NO: 2) by no more than 3 nucleotides; and the sense strand is at least partially complementary to the antisense strand.

2. The siRNA according to claim 1, characterized in that: The antisense strand comprises the nucleotide sequence (3'→5') AGCAGUAGGUGUUACUCUCAUGU (SEQ ID NO: 2); the sense strand comprises the nucleotide sequence (5'→3') GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 1).

3. The siRNA according to claim 1, characterized in that: The antisense strand is 19 to 23 nucleotides long; the sense strand is 19 to 21 nucleotides long.

4. The siRNA according to any one of claims 1 to 3, characterized in that: The siRNA contains at least one modified nucleotide.

5. The siRNA according to claim 4, characterized in that: All nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

6. The siRNA according to claim 5, characterized in that: The modified nucleotides are selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-open ring nucleotide analogs, 2'-fluoroarabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, nucleotides containing 5'-phosphate mimetics, diol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleotides, unlocked nucleotides or glycerol nucleotides.

7. The siRNA according to claim 5, characterized in that: The modified nucleotide is selected from a base-modified nucleotide, and the base has the following structure:

8. The siRNA according to any one of claims 1 to 7, characterized in that: The siRNA modified nucleotide sequence is selected from: 1) The nucleotides at positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and there is at least one 2'-fluoro nucleotide at the remaining positions; and / or 2) The 2nd, 6th, 14th and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least one 2'-fluoro nucleotide at the remaining positions; and / or 3) The 2nd, 8th, 9th, 14th and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least one glycerol nucleotide at the remaining positions; and / or 4) The 2nd, 6th, 8th, 9th, 14th and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least one modified nucleotide at the remaining positions.

9. The siRNA according to claim 8, characterized in that: The siRNA modified nucleotide sequence is selected from: 1) The nucleotides at positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and / or 2) the 2nd, 6th, 14th and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and / or 3) The 2nd, 6th, 14th and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least one modified nucleotide at the remaining positions; and / or 4) the 2nd, 6th, 8th, 9th, 14th and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and / or 5) The 2nd, 6th, 8th, 9th, 14th and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least one modified nucleotide at the remaining positions.

10. The siRNA according to any one of claims 1 to 9, characterized in that: The 5' end and 3' end of the sense strand independently contain 1 or 2 phosphorothioate linkages; and / or the 5' end and 3' end of the antisense strand independently contain 1 or 2 phosphorothioate linkages.

11. The siRNA according to claim 9, characterized in that: The 1st and 2nd nucleotides at the 5' end of the sense chain, the 2nd and 3rd nucleotides at the 5' end of the sense chain, the 1st and 2nd nucleotides at the 3' end of the sense chain, the 2nd and 3rd nucleotides at the 3' end of the sense chain, the 1st and 2nd nucleotides at the 3' end of the antisense chain, the 2nd and 3rd nucleotides at the 3' end of the antisense chain, the 1st and 2nd nucleotides at the 5' end of the antisense chain, and the 2nd and 3rd nucleotides at the 5' end of the antisense chain are all linked by phosphorothioate groups.

12. The siRNA according to any one of claims 1 to 11, characterized in that: The first nucleotide at the 5' end of the antisense strand is a nucleotide modified with (E)-vinyl phosphate.

13. An siRNA conjugate obtained by conjugating the siRNA according to any one of claims 1 to 12 with a delivery vector.

14. The siRNA conjugate according to claim 13, characterized in that: The delivery vector is covalently conjugated to the siRNA.

15. The siRNA conjugate according to claim 14, characterized in that: The delivery vector comprises N-acetylgalactosamine, which is covalently linked to the 3' end of the sense strand of the siRNA.

16. The siRNA conjugate according to claim 15, characterized in that: The delivery vector has the following structure:

17. The siRNA conjugate according to claim 14, characterized in that: The delivery vector comprises N-acetylgalactosamine, which is covalently linked to the 5' end of the sense strand of the siRNA.

18. The siRNA conjugate according to claim 17, characterized in that: The delivery vector has the following structure:

19. The siRNA conjugate according to claim 13, characterized in that: The siRNA conjugate is selected from siRNA conjugates 1-502.

20. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the siRNA according to any one of claims 1 to 12 and / or the siRNA conjugate according to any one of claims 13 to 19 and a pharmaceutically acceptable carrier.

21. Use of the siRNA according to any one of claims 1 to 12 and / or the siRNA conjugate according to any one of claims 13 to 19 and / or the pharmaceutical composition according to claim 20 in the preparation of a medicament for treating and / or preventing a pathological condition or disease associated with overexpression of the AGT gene.

22. The use according to claim 21, characterized in that: The pathological condition or disease is a disease associated with abnormal blood pressure.

Images