Application of SNORA58 as target spot in preparation of medicine for improving esophageal cancer radiotherapy sensitivity

Abstract

The invention provides application of SNORA58 serving as a target spot in preparation of a medicine for improving esophageal cancer radiotherapy sensitivity. The SNORA58 is used as a target to be applied to preparation of the medicine for improving the radiotherapy sensitivity of the esophageal cancer, and the sensitivity of a patient with the esophageal cancer to radiotherapy can be improved by inhibiting the SNORA58 or activating a downstream signal channel JNK signal channel regulated by the SNORA58, so that the radiotherapy curative effect of the patient with the esophageal cancer is promoted. Moreover, the invention discloses a marker SNORA58 for esophageal cancer radiotherapy resistance and a sensitizing radiotherapy target JNK signal channel, and clarifies a new mechanism of esophageal cancer radiotherapy resistance, namely the action and mechanism of SNORNA58 in cell ferroptosis caused by radiotherapy. The method has extremely important clinical significance for deeply analyzing a molecular mechanism of esophageal cancer radiotherapy resistance, explaining radiotherapy differences of esophageal cancer patients and formulating an individualized treatment scheme to improve the radiotherapy curative effect and prognosis of the patients.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to application of SNORA58 as a target in the preparation of a drug for improving the radiotherapy sensitivity of esophageal cancer. Background Art

[0002] Esophageal squamous cell carcinoma (ESCC), also known as ESCC, is the main pathological type of esophageal cancer in East Asia, especially in China. China has the highest incidence and mortality of ESCC in the world. ESCC is a type of cancer that is sensitive to radiotherapy. Radiotherapy alone or radiotherapy combined with chemotherapy or immunotherapy followed by surgery has become the first-line treatment for unresectable or locally advanced ESCC. However, the difference in radiosensitivity between patients with ESCC has become a key factor affecting the efficacy of radiotherapy. For patients who are not sensitive to radiotherapy, their prognosis is significantly poorer.

[0003] Small nucleolar RNA (snoRNA) is a type of non-coding RNA mainly located in the nucleolus. This type of non-coding RNA has the characteristics of being stable in body fluids and serving as a therapeutic target, making it a class of biomarkers with great application prospects in cancer treatment. Although a large number of studies have elucidated the potential mechanisms of differences in radiosensitivity of esophageal squamous cell carcinoma, mainly including DNA damage repair, cancer cell stemness, metabolic changes, cell death and immune surveillance, its practical application in clinical practice is still limited. In addition, there is currently a lack of research on the correlation between snoRNA and radiosensitivity of esophageal squamous cell carcinoma.

[0004] Therefore, in-depth analysis of the molecular mechanism of radiotherapy resistance in esophageal squamous cell carcinoma and the exploration of snoRNA that can be used for efficacy evaluation and treatment have great clinical significance for explaining the differences in radiotherapy in patients with esophageal squamous cell carcinoma and formulating individualized treatment plans to improve radiotherapy efficacy and patient prognosis. Summary of the invention

[0005] The present invention provides the use of SNORA58 as a target in the preparation of a drug for improving the radiotherapy sensitivity of esophageal cancer. SNORA58 is used as a target in the preparation of a drug for improving the radiotherapy sensitivity of esophageal cancer. By inhibiting SNORA58 or activating the downstream signaling pathway JNK signaling pathway regulated by SNORA58, the sensitivity of esophageal cancer patients to radiotherapy can be improved, thereby promoting the radiotherapy efficacy of esophageal cancer patients.

[0006] According to a first aspect of the present invention, there is provided use of SNORA58 as a target in the preparation of a drug for improving the radiosensitivity of esophageal cancer.

[0007] Currently, there is still a lack of effective markers for the evaluation and prediction of the efficacy of radiotherapy for esophageal cancer. snoRNAs have the characteristics of being stable in body fluids and tissues, and the detection technology is simple. For example, the expression of snoRNAs can be determined by extracting RNA from body fluids for qRT-PCR detection, and tissue samples can be tested by RNA in situ hybridization staining technology for high-throughput detection. They can also be preserved for a long time and traced. They are biomarkers with great application prospects for evaluating the efficacy of treatment.

[0008] SNORA58 (small nucleolar RNA, H / ACA box 58) is located on the chromosome 3 arm (3q22.1) of the human genome.

[0009] The inventors of this application found that SNORA58 was significantly highly expressed in esophageal cancer by analyzing three pairs of poorly differentiated esophageal cancer and corresponding adjacent tissues using snoRNA PCR chips. Then, using RNA in situ hybridization technology to detect large sample esophageal cancer tissue chips, it was found that SNORA58 was heterogeneously expressed in esophageal cancer patients, and patients with high expression showed poor prognosis. At the same time, based on multicenter research data, it was found that esophageal cancer patients with high expression of SNORA58 did not respond well to neoadjuvant chemoradiotherapy. Based on the above findings, the present invention uses SNORA58 as a biomolecular marker for evaluating the efficacy of radiotherapy for esophageal cancer. Through further experimental studies, it is clear that SNORA58 can significantly reduce the radiosensitivity of esophageal cancer, but has no significant effect on chemotherapy sensitivity. It is further clarified that SNORA58 inactivates the JNK signaling pathway by downregulating the expression of JNK1, thereby inhibiting the level of cell iron death caused by radiotherapy and ultimately reducing the radiosensitivity of cells, that is, SNORA58 promotes esophageal cancer radiotherapy resistance and tumor growth by regulating JNK1-mediated iron death.

[0010] The present invention uses SNORA58 as a target in the preparation of drugs for improving the radiotherapy sensitivity of esophageal cancer. By inhibiting SNORA58 or activating the downstream signaling pathway JNK signaling pathway regulated by SNORA58, the sensitivity of esophageal cancer patients to radiotherapy can be improved, thereby promoting the radiotherapy efficacy of esophageal cancer patients. In addition, the present invention reveals the marker SNORA58 of esophageal cancer radiotherapy resistance and the JNK signaling pathway of sensitization radiotherapy target, and clarifies the new mechanism of esophageal cancer radiotherapy resistance, namely the role and mechanism of snoRNA in cell ferroptosis caused by radiotherapy. This has extremely important clinical significance for in-depth analysis of the molecular mechanism of esophageal cancer radiotherapy resistance, explanation of radiotherapy differences in esophageal cancer patients, and formulation of individualized treatment plans to improve radiotherapy efficacy and patient prognosis.

[0011] Preferably, the esophageal cancer is esophageal squamous cell carcinoma.

[0012] Preferably, the above-mentioned drug includes at least one of a SNORA58 inhibitor and a JNK signaling pathway activator.

[0013] The present invention has demonstrated through in vivo and in vitro experiments that knocking out SNORA58 or activating the JNK signaling pathway can significantly enhance the sensitivity of esophageal cancer cells to radiotherapy. Therefore, the use of SNORA58 inhibitors and / or JNK signaling pathway activators in the treatment of esophageal cancer can significantly enhance the sensitivity of SNROA58 high-expressing cells to radiotherapy, thereby improving the radiotherapy efficacy of esophageal cancer.

[0014] Preferably, the JNK signaling pathway activator includes at least one of anisomycin, sulfasalazine, amiperidine, heparin, and TNF-α.

[0015] Preferably, the JNK signaling pathway activator comprises anisomycin.

[0016] The combined use of the JNK signaling pathway activator anisomycin can effectively enhance radiotherapy sensitivity, which is expected to provide a more precise and effective treatment plan for patients with esophageal cancer with high expression of SNORA58.

[0017] According to a second aspect of the present invention, a pharmaceutical composition capable of improving the radiosensitivity of esophageal cancer is provided, wherein the pharmaceutical composition comprises at least one of a SNORA58 inhibitor and a JNK signaling pathway activator.

[0018] Preferably, the esophageal cancer is esophageal squamous cell carcinoma.

[0019] Preferably, the JNK signaling pathway activator includes at least one of anisomycin, sulfasalazine, amiperidine, heparin, and TNF-α.

[0020] Preferably, the JNK signaling pathway activator comprises anisomycin. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a graph showing the results of Example 1 using qRT-PCR to detect the expression of SNORA58 in esophageal squamous cell carcinoma and adjacent tissues, as well as the proportion of high and low SNORA58 expression in esophageal squamous cell carcinoma and adjacent tissues.

[0022] Figure 2 This is a result diagram of the RNA-ISH staining detection of SNORA58 expression in esophageal squamous cell carcinoma and adjacent tissues in the tissue chip provided in Example 1, as well as the proportion of high and low SNORA58 expression in esophageal squamous cell carcinoma and adjacent tissues.

[0023] Figure 3This is a graph showing the results of analyzing the correlation between high expression of SNORA58 and the prognosis of patients with esophageal squamous cell carcinoma using the Kaplan-Meier survival curve in Example 1.

[0024] Figure 4 This is a graph showing the results of the prognostic factor analysis of patients with high expression of SNORA58 and esophageal squamous cell carcinoma using univariate and multivariate Cox regression analysis in Example 1.

[0025] Figure 5 CT images of patients with esophageal squamous cell carcinoma with different therapeutic effects before and after neoadjuvant synchronous chemoradiotherapy and the pathological H&E staining section results of the specimens after treatment and surgery provided in Example 1.

[0026] Figure 6 This is a statistical result diagram of the high and low SNORA58 expression groups and pathological remission rates in patients with esophageal squamous cell carcinoma with different therapeutic effects provided in Example 1.

[0027] Figure 7 This is a graph showing the results of Example 2 using a clone formation survival experiment to evaluate the effect of SNORA58 on the radiosensitivity of esophageal squamous cell carcinoma cells.

[0028] Figure 8 This is a graph showing the results of Example 2 using a cell viability experiment to evaluate the effect of SNORA58 on the chemotherapy sensitivity of esophageal squamous cell carcinoma cells.

[0029] Fig. 9 Example 2 provides a graph showing the results of immunohistochemical analysis of subcutaneous tumors in nude mice after radiotherapy.

[0030] Fig.10 This is a graph showing the transcriptome sequencing results of SNORA58 knockout cells and wild-type cells after radiotherapy treatment as provided in Example 3.

[0031] Fig.11 This is the result diagram of Example 3 using GSEA to perform enrichment analysis on differentially expressed genes in SNORA58 knockout cells and wild-type cells.

[0032] Fig.12 This is a graph showing the results of using Western blot to detect the expression of the MAPK pathway in SNORA58 knockout cells and wild-type cells in Example 3.

[0033] Fig.13 This is a graph showing the detection results of Example 3 for the RNA levels of different JNK splicing variants and the JNK1 protein levels in SNORA58 knockout cells and wild-type cells.

[0034] Fig.14This is a graph showing the results of Example 3 using immunohistochemical staining to detect the expression of JNK1 and phosphorylated JNK in subcutaneous transplanted tumors of SNORA58 knockout cells and wild-type cells.

[0035] Fig.15 This is a graph showing the expression of SNORA58, JNK1 and phosphorylated JNK in postoperative specimens after neoadjuvant chemoradiotherapy, as well as the results of correlation analysis using RNA-ISH staining and immunohistochemical staining in Example 3.

[0036] Fig.16 This is a graph showing the results of the correlation analysis of SNORA58, JNK1 or p-JNK expression with the prognosis of patients with esophageal squamous cell carcinoma after neoadjuvant chemoradiotherapy and surgery using Kaplan-Meier survival curves in Example 3.

[0037] Fig.17 Example 4 is a graph showing the results of a clone survival experiment on esophageal squamous cell carcinoma cells treated with a variety of different death mode inhibitors and then subjected to radiotherapy.

[0038] Fig.18 This is the result of Example 4 using flow cytometry and qRT-PCR to detect lipid peroxidation levels and PTGS2 expression in SNORA58 overexpression, knockout and corresponding control cells, as well as TEM detection of mitochondrial morphological changes.

[0039] Fig.19 This is a graph showing the results of observing cell survival in a radiotherapy clone formation survival experiment after the SNORA58 knockout cells and the esophageal squamous cell carcinoma cells in the control group were treated with ferroptosis inhibitors as provided in Example 4.

[0040] Fig. 20 This is a graph showing the results of lipid peroxidation detection in the SNORA58 knockout cells and the esophageal squamous cell carcinoma cells in the control group after treatment with ferroptosis inhibitors as provided in Example 4.

[0041] Fig.21 This is a graph showing the results of Example 4 using immunohistochemical staining to detect the expression of phosphorylated H2AX, cleaved caspase-3 and 4-HNE in nude mouse subcutaneous transplanted tumors with and without radiotherapy.

[0042] Fig. 22 This is a graph showing the expression of SNORA58 and 4-HNE in clinical samples after nCRT surgery detected by immunohistochemical staining and the results of correlation analysis in Example 4.

[0043] Fig.23 This is a graph showing the results of Example 4 using the Kaplan-Meier curve to analyze the correlation between the expression level of 4-HNE and the prognosis of patients after nCRT surgery.

[0044] Fig.24 The results of the clone formation survival experiment, lipid peroxidation level and PTGS2 expression of SNORA58 knockout KYSE510 cells (KO) and wild-type KYSE510 cells (WT) provided in Example 5 are shown in FIG.

[0045] Fig.25 The results of the clone formation survival experiment, lipid peroxidation level and PTGS2 expression of SNORA58-overexpressing KYSE30 cells provided in Example 5 are shown in FIG.

[0046] Fig.26 This is a graph showing the results of the clone survival experiment, radiotherapy sensitivity, lipid peroxidation level and PTGS2 expression of SNORA58 overexpressing cells after treatment with JNK activator provided in Example 5.

[0047] Fig. 27 This is a graph showing the expression of JNK1, 4-HNE and phosphorylated JNK in clinical samples after nCRT surgery detected by immunohistochemical staining in Example 5, and the correlation analysis results between the expression of JNK1 and phosphorylated JNK and 4-HNE, respectively.

[0048] Fig.28 This is a graph showing the results of Example 5 using Western blot to detect the expression of ferroptosis-related proteins in SNORA58 overexpressed or knocked-out cells after radiotherapy.

[0049] Fig.29 Example 6 is a diagram showing the results of an in vivo nude mouse subcutaneous tumor formation experiment to show that the combined use of a JNK pathway activator and radiotherapy significantly enhances the radiotherapy sensitivity of esophageal squamous cell carcinoma cells. DETAILED DESCRIPTION

[0050] The following is a further clear and complete description of the technical features in the technical solution provided by the present invention in conjunction with the specific implementation methods. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0051] Example 1 High expression of SNORA58 indicates poor efficacy of neoadjuvant chemoradiotherapy in patients with esophageal squamous cell carcinoma

[0052] In this example, three pairs of poorly differentiated esophageal squamous cell carcinoma and adjacent tissues were first tested using snoRNA PCR chips to search for snoRNAs associated with esophageal squamous cell carcinoma, and it was found that SNORA58 was highly expressed in esophageal squamous cell carcinoma.

[0053] In order to further verify the high expression of SNORA58 in esophageal squamous cell carcinoma, qRT-PCR was used to detect the expression level of SNORA58 in esophageal squamous cell carcinoma and adjacent tissues. The specific steps were as follows: total RNA was extracted from tissues and cells of esophageal squamous cell carcinoma patients using the RNAiso Plus kit, and cDNA was synthesized using the HiScriptIIQ RT SuperMix kit of Vazyme Biotech, and then analyzed using qRT-PCR. GAPDH or 5srRNA was used as an internal reference to calculate the relative RNA expression level, and three independent experiments were performed for each sample.

[0054] The expression level of SNORA58 in esophageal squamous cell carcinoma (ESCC) and paracancerous tissue (NT) and the proportion of high and low SNORA58 expression in ESCC and paracancerous tissue were detected by qRT-PCR. Figure 1 As shown. Figure 1 It can be seen that SNORA58 expression is significantly upregulated in esophageal squamous cell carcinoma.

[0055] Furthermore, this embodiment also uses RNA in situ hybridization (RISH) technology to verify the above results in a tissue chip containing a larger sample amount. The specific operation steps are as follows: the PinpoRNATM RNA in situ hybridization kit (Cat#PIF1000) of GDPinpoease Biotech Co. Ltd. is used for snoRNA in situ hybridization staining. In this process, a series of short probes (Cat#6778361-A1) designed by a patented algorithm (Chinese patent number ZL202110581853.9) are used to complement the SNORA58 RNA sequence in sequence, covering areas 1-180, and two pathologists (according to a scoring standard of 0 to 4, the standard is: 0 means no staining or ≤1 point per 20 cells, 1 means 1 point / cell, 2 means 2-3 points / cell, 3 means 4-10 points / cell, and 4 means >10 points / cell) jointly score the staining intensity.

[0056] RNA-ISH staining was used to detect the expression of SNORA58 in esophageal squamous cell carcinoma (ESCC) and paracancerous tissue (NT) in tissue microarray, and the proportion of high and low SNORA58 expression in ESCC and paracancerous tissue was as follows Figure 2 As shown. Figure 2 It can be seen that the RNA-ISH staining results showed the same conclusion as the above-mentioned qRT-PCR detection results, that is, SNORA58 expression was significantly upregulated in esophageal squamous cell carcinoma.

[0057] Furthermore, this example further analyzes the correlation between high expression of SNORA58 and clinical case parameters such as prognosis of patients with esophageal squamous cell carcinoma, and draws a Kaplan-Meier survival curve. The results are as follows: Figure 3 As shown. Figure 3 The results of Kaplan-Meier survival curve analysis showed that the overall survival of patients with high expression of SNORA58 was significantly shorter, with a median survival of only 43.8 months, while the median survival of patients with low expression of SNORA58 was as high as 60.8 months. This shows that high expression of SNORA58 indicates a poor prognosis for patients with esophageal squamous cell carcinoma.

[0058] In addition, univariate and multivariate Cox regression analysis was used to analyze the prognostic factors of patients with high expression of SNORA58 and esophageal squamous cell carcinoma. Figure 4 As shown. Figure 4 The results of univariate and multivariate Cox regression analysis showed that high expression of SNORA58 was associated with lymph node metastasis, vascular invasion and TNM stage in patients with esophageal squamous cell carcinoma, and high expression of SNORA58 was an independent prognostic factor in patients with esophageal squamous cell carcinoma.

[0059] Neoadjuvant chemoradiotherapy is currently the first-line treatment for patients with advanced esophageal squamous cell carcinoma who are undergoing downstaging surgery. In this example, in order to study the relationship between SNORA58 and the efficacy of neoadjuvant synchronous chemoradiotherapy in patients with advanced esophageal squamous cell carcinoma, esophageal squamous cell carcinoma specimens before neoadjuvant synchronous chemoradiotherapy were collected from multiple medical institutions and the expression of SNORA58 was detected by RISH. The CT images of patients with esophageal squamous cell carcinoma with different efficacy before neoadjuvant synchronous chemoradiotherapy (Pre-nCRT) and after treatment (Post-nCRT) and the pathological H&E staining sections of the specimens after treatment were as follows Figure 5 The statistical results of the relationship between the high and low SNORA58 expression groups and the pathological response rate in patients with esophageal squamous cell carcinoma with different therapeutic effects are shown in Figure 6 As shown in the figure, pCR means pathological complete response and non-pCR means non-pathological complete response.

[0060] Depend on Figure 5 It can be seen that patients with high expression of SNORA58 have poor efficacy of neoadjuvant chemoradiotherapy, which is mainly manifested by the lack of obvious tumor shrinkage and a large amount of cancer residue in the postoperative specimens.

[0061] Depend on Figure 6 It can be seen that multicenter data showed that the postoperative pathological complete remission rate of patients in the low SNORA58 expression group was as high as 52.4% (22 / 42), while the pathological complete remission rate (pCR) of patients in the high SNORA58 expression group was lower, only 29.7% (11 / 37).

[0062] These results suggest that SNORA58 can not only serve as an independent prognostic factor for patients with esophageal squamous cell carcinoma, but also as a potential biomarker for predicting the efficacy of chemoradiotherapy (nCRT).

[0063] Example 2 SNORA58 promotes radioresistance in esophageal squamous cell carcinoma

[0064] This example aims to study the role of SNORA58 in radiotherapy resistance of esophageal squamous cell carcinoma. The specific experimental methods and operation steps are as follows:

[0065] 1. Transfecting plasmids and small interfering RNA (siRNA) into cells

[0066] Table 1 Nucleotide sequences of siJNK1 and SNORA58 sgRNA

[0067] name Sequence number Specific nucleotide sequence (5'→3') siJNK1 SEQ ID NO: 1 GCTCATGGATGCAAATCTT SNORA58 sgRNA SEQ ID NO: 2 GCTCTAACCAGCTTCATCAG

[0068] PLVX-SNORA58, pEV-M02-JNK1 and their corresponding control plasmids were purchased from GeneCopoeia, while siRNA targeting JNK1 and its matching control siRNA were provided by Shanghai Keya Biotechnology Co., Ltd. (Genepharma). The SNORA58 knockout cell line was constructed using the CRISPR / Cas9 gene editing system, where the nucleotide sequences of the siJNK1 and SNORA58 sgRNAs used are shown in Table 1. The SNORA58 overexpression and knockout plasmids were transfected into human embryonic kidney cells (293FT cells) using Invitrogen's lentiviral packaging mixture, and Hilymax and Lipofectamine RNAimax transfection reagents were used for transient transfection of plasmids and siRNA, respectively. The efficiency of SNORA58 overexpression or knockout was determined by qRT-PCR, and the efficiency of JNK1 overexpression or silencing was evaluated by Western blotting.

[0069] 2. Clone survival assay

[0070] The radiosensitivity of esophageal squamous cell carcinoma cells was detected by clone survival assay. Cells (1000-3000 / well) were cultured in 6-well plates and treated with various conditions, including irradiation (radiotherapy) and pre-treatment with specific inhibitors or dimethyl sulfoxide (DMSO). Radiation was performed at a specified dose using a Rad Source RS2000 X-RAD irradiation system. After 8-10 days, cell clones were stained with 0.5% crystal violet and counted using ImageJ software. The survival score of cells was calculated using GraphPad Prism6 software and normalized to the value of unirradiated cells. The dose survival curve used a single hit multi-target model with the formula SF = 1-((1-exp(-k*D))^N). Radiosensitivity was evaluated by the sensitization enhancement ratio (SER), where SER < 1 indicates radioresistance of cancer cells, and SER > 1 indicates radiosensitivity.

[0071] To further elucidate the role of SNORA58 in chemoradiotherapy (nCRT), SNORA58 overexpression and knockout cell lines were constructed using lentiviral packaging system and CRISPR / Cas9 system, respectively. The effect of SNORA58 on the radiosensitivity of esophageal squamous cell carcinoma cells was evaluated by clonogenic survival assay. Figure 7 As shown, WT represents the wild-type KYSE510 cell line, KO represents the SNORA58 knockout KYSE510 cell line, EV (empty vector, blank control group) represents the KYSE140 cell line transfected with the empty vector, and SNORA58 represents the SNORA58 overexpression KYSE140 cell line.

[0072] Depend on Figure 7 The results of the clone formation survival experiment showed that overexpression of SNORA58 significantly reduced the radiosensitivity of esophageal squamous cell carcinoma cells, while knockout of SNORA58 showed the opposite result.

[0073] 3. Cell Viability Assay

[0074] The cell viability assay was used to evaluate the chemotherapy sensitivity of esophageal squamous cell carcinoma cells. 1000 cells / well were seeded into 96-well plates, and paclitaxel, 5-FU, cisplatin and other chemotherapy drugs were added, and the cell viability was measured using the Cell Counting Kit-8 reagent.

[0075] Cell viability assay was used to evaluate the effect of SNORA58 on the chemotherapy sensitivity of esophageal squamous cell carcinoma cells. Figure 8 As shown. Figure 8The results of the CCK8 cell activity experiment showed that after treatment with first-line chemotherapy drugs for esophageal squamous cell carcinoma (including cisplatin, 5-FU and paclitaxel), overexpression or knockout of SNORA58 had no significant effect on cell activity.

[0076] 4. Nude mouse subcutaneous tumor formation experiment

[0077] 4-week-old male nude mice were purchased from Guangdong Experimental Animal Research Institute. 6 Two SNORA58 knockout KYSE510 cells (KO) and wild-type KYSE510 cells (WT) were subcutaneously injected into the subcutaneous tissue of each mouse. Two weeks later, when the tumor volume reached approximately 100 mm 3 The mice were randomly divided into a control group (Ctrl group, no radiotherapy, n = 7) and an experimental group (IR group, fractionated radiotherapy, 2 Gy / 2 days × 7 days, n = 5). Then, the mice were killed and the tumor tissues were removed and weighed for subsequent immunohistochemical analysis.

[0078] The results of immunohistochemical analysis of subcutaneous tumors in nude mice after radiotherapy are as follows: Fig. 9 As shown, Fig. 9 A is the injection flow chart of the nude mouse subcutaneous tumor formation experiment. Fig. 9 B is the result of H&E staining section. Fig. 9 C is a graph showing tumor volume and weight results.

[0079] Depend on Fig. 9 The results of the subcutaneous tumor formation experiment in nude mice showed that after radiotherapy, the tumor volume, tumor weight and Ki67 expression level of the SNORA58 knockout group decreased significantly.

[0080] The above results indicate that SNORA58 can promote radioresistance of esophageal squamous cell carcinoma cells, but has no significant effect on chemotherapy sensitivity.

[0081] Example 3 SNORA58 downregulates JNK1 and inactivates JNK signaling pathway, leading to radioresistance in esophageal squamous cell carcinoma

[0082] This example aims to study the mechanism by which SNORA58 promotes radioresistance of esophageal squamous cell carcinoma cells. The experimental methods and steps involved are as follows:

[0083] 1. RNA Sequencing Analysis

[0084] In order to explore the molecular mechanism by which SNORA58 promotes radioresistance in esophageal squamous cell carcinoma, in this example, transcriptome sequencing was performed on SNORA58 knockout KYSE510 cells and wild-type KYSE510 cells after radiotherapy. The specific steps are as follows: total RNA was extracted from SNORA58 knockout and wild-type KYSE510 cells treated with radiotherapy, and purified using RNAiso Plus reagent. Then, RNA purity and integrity were evaluated using NanoDrop 2000 and RNA Nano 6000 of Agilent Bioanalyzer 2100 system, respectively. Finally, sequencing was performed using Illumina HiseqTM2500 / 4000 platform of Guangzhou Kidio Biotechnology Co., Ltd., and DESeq2 (version 1.22.2) was used to analyze differentially expressed genes in RNA-seq data. The transcriptome sequencing results of SNORA58 knockout cells and wild-type cells after radiotherapy are shown in Figure 2. Fig.10 As shown, FDR represents the false discovery rate and Fold change represents the fold change.

[0085] Depend on Fig.10 The volcano plot of differentially expressed genes shows that based on P < 0.05 and log 2 The filtering criteria of (fold difference)>1 were used to identify 292 down-regulated differentially expressed genes (Down DEGs) and 380 up-regulated differentially expressed genes (UpDEGs).

[0086] Then, gene set enrichment analysis (GSEA) was performed using GSEA software to analyze the differentially expressed genes to explore the regulatory signaling pathways enriched in DEGs. The results are shown in Fig.11 shown.

[0087] Depend on Fig.11 The GSEA analysis results show that after SNORA58 knockout, the differentially expressed genes are mainly enriched in the stress-activated MAPK signaling pathway, that is, knocking out SNORA58 can activate the stress-related MAPK pathway.

[0088] The MAPK pathway is the most widely studied stress-activated signal transduction pathway, which mainly consists of the JNK, ERK and p38 signaling pathways.

[0089] Next, Western blot was used to detect the expression of MAPK pathway (including JNK, ERK and p38) in SNORA58 knockout KYSE510 cells, KYSE180 cells and wild-type KYSE510 cells and KYSE180 cells. Fig.12As shown, Ctrl represents cells not irradiated with radiotherapy, IR represents cells irradiated with radiotherapy, WT represents wild-type cells, and KO represents SNORA58 knockout cells.

[0090] Depend on Fig.12 Western blot results showed that under radiotherapy conditions, total and phosphorylated JNK were significantly upregulated after SNORA58 knockout, while related proteins in the ERK and p38 pathways did not change significantly.

[0091] The above results indicate that SNORA58 mainly affects the JNK signaling pathway, thereby affecting the radioresistance of esophageal squamous cell carcinoma.

[0092] In order to further verify whether SNORA58 regulates the JNK signaling pathway at the protein or RNA level, this example uses qRT-PCR to detect the RNA expression levels of three different JNK splicing variants (i.e., three JNK encoding genes JNK1, JNK2, and JNK3) in SNORA58 knockout KYSE510 and KYSE180 cells after radiotherapy, and Western blot is used to detect the JNK1 protein level in SNORA58 knockout cells and wild-type cells. The results are as follows Fig.13 As shown, Ctrl indicates not irradiated, IR indicates irradiated, WT indicates wild-type cells, and KO indicates SNORA58 knockout cells.

[0093] Depend on Fig.13 It can be seen that the difference in JNK1 expression is the most significant.

[0094] Based on the above, JNK1 was subsequently selected as a downstream target for further study.

[0095] 2. Immunohistochemical Staining

[0096] Paraffin-embedded sections were dewaxed in xylene, dehydrated with graded ethanol solutions, and then blocked with 3% hydrogen peroxide. Antigen retrieval was performed with citrate buffer. Then, sections were blocked with 50% goat serum in PBS buffer for 1 hour at room temperature, and then incubated with primary antibodies overnight at 4°C. Sections were incubated sequentially with the Dako Envision detection system for color development, and nuclei were counterstained with hematoxylin. Images were taken using an Olympus FSX100 microscope. Two pathologists evaluated the IHC staining results. The proportion of immunopositive cells was scored between 0 and 4 (0%, 1-25%, 26-50%, 51-75%, 76-100%). The staining intensity was divided into four levels: negative (0), weak (1), moderate (2), and strong (3). The final score was calculated according to the following formula: the proportion of immunopositive score multiplied by the intensity score (total score 0 to 12). The median of the immunohistochemical score was selected as the threshold for determining the upregulation or downregulation of the target gene and is explained in the corresponding legend.

[0097] 3. Immunofluorescence Staining

[0098] KYSE150 and KYSE180 cells were plated at 5 × 10 4 The cells were seeded in a confocal dish at a density of 100 cells, cultured overnight, and exposed to a dose of 10 Gy of radiation the next day. After 12 hours of culture, the cells were fixed with formalin. Then, the cells were blocked with BSA for 1 hour, incubated with primary antibodies overnight at 4°C, and stained with secondary antibodies the next day. Finally, the cells were counterstained with DAPI and images were acquired with an Olympus fluorescence microscope.

[0099] In order to further confirm that SNORA58 inhibits the JNK signaling pathway mainly by regulating JNK1, the protein levels of JNK1 and phosphorylated JNK in nude mouse subcutaneous transplanted tumor samples and neoadjuvant postoperative tumor tissues were detected by immunohistochemical staining, and the expression of SNORA58 in the above tissues was detected by RNA in situ hybridization staining. The results are as follows: Fig.14 and Fig.15 As shown, Fig.14 The results of immunohistochemical staining to detect the expression of JNK1 and phosphorylated JNK (p-JNK) in subcutaneous transplanted tumors of SNORA58 knockout cells and wild-type cells are shown in the figure. Fig.15 RNA-ISH staining and immunohistochemical staining were used to detect the expression of SNORA58, JNK1 and phosphorylated JNK in postoperative specimens after neoadjuvant chemoradiotherapy, and correlation analysis was performed. Ctrl means no radiotherapy treatment, IR means radiotherapy treatment, WT means wild-type cells, and KO means SNORA58 knockout cells.

[0100] Depend on Fig.14 It can be seen that after radiotherapy, the expression of JNK1 and phosphorylated JNK in subcutaneous transplanted tumor tissues from SNORA58 knockout cells was significantly increased.

[0101] Depend on Fig.15 It can be seen that in the detection of tumor tissues after neoadjuvant chemoradiotherapy, the expression levels of SNORA58 and JNK1 or phosphorylated JNK were negatively correlated, while the expression of JNK1 and phosphorylated JNK were positively correlated.

[0102] In addition, Kaplan-Meier survival curves were used to analyze the correlation between SNORA58, JNK1 or p-JNK expression and the prognosis of patients with esophageal squamous cell carcinoma after neoadjuvant chemoradiotherapy and surgery. Fig.16 shown.

[0103] Depend on Fig.16 It can be seen that among patients after neoadjuvant chemoradiotherapy, those with high expression of SNORA58 have a poor prognosis, while those with higher expression levels of JNK1 or phosphorylated JNK have a better prognosis.

[0104] These results, on the one hand, illustrate that SNORA58 inhibits the JNK signaling pathway by downregulating the expression of JNK1 and ultimately promotes radioresistance in esophageal squamous cell carcinoma. On the other hand, they indicate that the expression levels of SNORA58, JNK1 and phosphorylated JNK are related to the prognosis of patients after neoadjuvant chemoradiotherapy.

[0105] Example 4 SNORA58 inhibits radiotherapy-induced cell ferroptosis and promotes radiotherapy resistance in esophageal squamous cell carcinoma

[0106] The JNK signaling pathway is associated with cell death modes including apoptosis, necrosis, pyroptosis, and the recently discovered ferroptosis, as well as autophagy. This example aims to study how SNORA58 affects radiotherapy-induced cell death. The experimental methods and steps involved are as follows:

[0107] 1. Lipid Peroxidation Detection

[0108] According to the inoculum size of 5×10 4SNORA58 knockout or wild-type KYSE510 and KYSE180 cells were seeded into 12-well plates, treated with or without drugs for 24 hours, and then exposed to the specified doses of radiotherapy. After incubation for 12 hours, fresh culture medium containing 5 μM BODIPY 581 / 591C11 dye was added to each well and incubated at 37°C for 30 minutes. Then, the cells were gently washed with pre-cooled PBS buffer and flow cytometric analysis was performed using a Beckman coulter CytoFLEX flow cytometer. Finally, the data were analyzed using FlowJo (BD Biosciences, version 10.7.2).

[0109] 2. Transmission Electron Microscopy

[0110] Transmission electron microscopy was used to analyze the ultrastructure of mitochondria. The specific steps were as follows: SNORA58 knockout or wild-type KYSE510 and KYSE180 cells were exposed to or not exposed to radiotherapy. After trypsin digestion, the cell pellets were collected, washed three times with 0.1 M phosphate buffer (pH 7.2-7.4), and incubated with 1% osmium tetroxide (OsO) at 4°C. 4 ) for 2 h, then washed again three times with 0.1 M phosphate buffer, dehydrated through an ethanol gradient, and then embedded in Spurr's resin for embedding, followed by ultrathin sections obtained using a Leica EMUC7 ultramicrotome and stained with 2% uranylacetic acid or 3% lead acetate, and finally, images were captured using a JEOL JEM-1200EX transmission electron microscope.

[0111] First, a clone survival experiment after radiotherapy was conducted after treating esophageal squamous cell carcinoma cells with a variety of different death mode inhibitors. Fig.17 As shown, Ctrl means no radiotherapy treatment, IR means radiotherapy treatment, WT means wild-type cells, KO means SNORA58 knockout cells, and dimethyl sulfoxide (DMSO) was used as a control in the treatment of different inhibitors.

[0112] Depend on Fig.17 It can be seen that a significant increase in cell survival was observed in the ferroptosis inhibitor (Ferrostatin-1, referred to as Ferr-1) treatment group, which indicates that the addition of ferroptosis inhibitors can significantly reverse the effect of knocking out SNORA58 to improve the radiosensitivity of esophageal squamous cell carcinoma cells, while other death mode inhibitors, including apoptosis inhibitors (Z-VAD-FMK), necrosis inhibitors (Necrostatin-1, referred to as NEC-1), pyroptosis inhibitors (DSF) and autophagy inhibitors (3-MA) ​​failed to significantly reverse the effect. The above results can prove that SNORA58 mainly acts on cell death caused by radiotherapy through the ferroptosis pathway.

[0113] Secondly, flow cytometry was used to detect the levels of lipid peroxidation in SNORA58 knockout KYSE510 cells and KYSE180 cells, overexpressing KYSE30 cells, and corresponding control group cells. qRT-PCR was used to detect the expression level of prostaglandin-endoperoxide synthase 2 (PTGS2) in the above cells. Transmission electron microscopy (TEM) was used to observe the mitochondrial morphology of SNORA58 knockout KYSE510 cells, KYSE180 cells, and corresponding control cells. The results are as follows: Fig.18 As shown, Fig.18 A is the result diagram of lipid peroxidation expression level. Fig.18 B is the result diagram of PTGS2 expression level. Fig.18 C is the result of observing mitochondrial morphology using a transmission electron microscope, where Ctrl indicates no radiotherapy treatment, IR indicates radiotherapy treatment, WT indicates wild-type cells, KO indicates SNORA58 knockout cells, EV (empty vector, blank control group) indicates control group cells transfected with a blank vector, SNORA58 indicates SNORA58 overexpressing cells, and Post-IR indicates radiotherapy treatment.

[0114] Depend on Fig.18 It can be seen that SNORA58 can inhibit cell ferroptosis caused by radiotherapy, which is manifested by a significant decrease in lipid peroxidation and PTGS2 levels in the overexpression group cells, while knocking out SNORA58 significantly increased the lipid peroxidation level and PTGS2 expression in esophageal squamous cell carcinoma cells after radiotherapy. Transmission electron microscopy observed that the mitochondrial volume of this group of cells was reduced and the number of mitochondrial cristae was reduced.

[0115] Furthermore, the ferroptosis inhibitors Ferrostatin-1 (Ferr-1) and Liproxstatin-1 (Lipro-1) were added to the KYSE510 cell line (KO) with SNORA58 knockout and the esophageal squamous cell carcinoma cell line in the control group, and then the IR clone survival experiment was performed to observe the survival of the cells. The results are as follows: Fig.19 As shown, flow cytometry was used to detect the degree of lipid peroxidation in cells. Fig. 20 As shown in the figure, Ctrl means not irradiated, IR means irradiated, WT means wild-type cells, KO means SNORA58 knockout cells, IR+Ferr-1 means adding Ferr-1 and then irradiating, and IR+Lipro-1 means adding Lipro-1 and then irradiating.

[0116] Depend on Fig.19 It can be seen that compared with the esophageal squamous cell carcinoma cells in the control group, the proportion of cell survival was higher after adding ferroptosis inhibitors Ferr-1 and Lipro-1 to the KYSE510 cell line in which SNORA58 was knocked out and then subjected to radiotherapy.

[0117] Depend on Fig. 20 It can be seen that the increase in cellular lipid peroxidation levels caused by knocking out SNORA58 was also reversed by ferroptosis inhibitors.

[0118] Furthermore, referring to the experimental steps of Example 2, the KYSE510 cell line (KO) with SNORA58 knockout and the wild-type KYSE510 cell line (WT) were injected into the subcutaneous tissue of each mouse, respectively. After 2 weeks, the mice were randomly divided into a control group (Ctrl group, not receiving radiotherapy) and an experimental group (IR group, fractionated irradiation, 2Gy / 2 days × 7 days). Subsequently, the mice were killed and the tumor tissues were removed for immunohistochemical staining. The results are as follows: Fig.21 As shown, Ctrl represents cells not irradiated with radiotherapy, IR represents cells irradiated with radiotherapy, WT represents wild-type cells, and KO represents SNORA58 knockout cells.

[0119] Depend on Fig.21 The results of immunohistochemical staining showed that in the subcutaneous transplanted tumor tissue samples of radiotherapy nude mice, the expression level of ferroptosis protein marker (4-HNE) in the SNROA58 knockout group was significantly upregulated compared with the wild-type KYSE510 cell line, while the apoptosis protein marker (cleaved Caspase-3) and phosphorylated DNA double-strand break marker (H2AX) had no significant effect.

[0120] Based on the above content, immunohistochemical staining was used to detect the expression of SNORA58 and 4-HNE in tissue samples of clinical esophageal squamous cell carcinoma patients after neoadjuvant chemotherapy and radiotherapy (nCRT) and the correlation analysis was performed. Fig. 22 The Kaplan-Meier curve was used to analyze the correlation between the expression level of 4-HNE and the prognosis of patients after nCRT. Fig.23 As shown in the figure, Good response indicates better efficacy, and Poor response indicates worse efficacy.

[0121] Depend on Fig. 22 and Fig.23 It can be seen that the test results of tissue samples from patients with esophageal squamous cell carcinoma after neoadjuvant chemoradiotherapy and surgery showed that the expression levels of SNORA58 and 4-HNE were negatively correlated, and in this type of patients, low expression of 4-HNE indicated a poor prognosis.

[0122] Example 5: JNK1 mediates SNORA58 to inhibit radiotherapy-induced cell ferroptosis

[0123] In order to verify whether SNORA58 inhibits radiotherapy-induced cell ferroptosis is mediated by JNK1, in this example, JNK1 was silenced in SNORA58 knockout KYSE510 cells, JNK1 was transfected in SNORA58 overexpressing KYSE30 cells, and clone formation survival experiments were performed, lipid peroxidation levels in cells were detected by flow cytometry, and PTGS2 expression levels were detected by qRT-PCR to detect and observe whether the effects of SNORA58 on radiotherapy sensitivity and ferroptosis levels of esophageal squamous cell carcinoma cells were mediated by JNK1. The results are shown in Figure 2 Fig.24 and Fig.25 As shown, Fig.24 The results of the clone formation survival experiment, lipid peroxidation level and PTGS2 expression of SNORA58 knockout KYSE510 cells (KYSE510-KO) and wild-type KYSE510 cells (KYSE510-WT) after silencing JNK1 are shown in the figure. Fig.25 The results of the clone formation survival experiment, lipid peroxidation level and PTGS2 expression in SNORA58-overexpressing KYSE30 cells after transient transfection of JNK1 are shown in the figure. Fig.25 In the figure, Ctrl represents the control group, i.e., the wild-type cell line, JNK1 represents the JNK1 silencing group induced by siJNK1, EV (empty vector, blank control group) represents the KYSE30 control group cells transfected with the blank vector, and SNORA58 represents the SNORA58 overexpressing KYSE30 cells.

[0124] Depend on Fig.24 and Fig.25 It can be seen that silencing JNK1 effectively reversed the ferroptosis effect of esophageal squamous cell carcinoma cells induced by radiotherapy promoted by knocking out SNORA58, which was manifested by increased clone formation ability, decreased lipid peroxidation level and PTGS2 expression, while the opposite result was observed when JNK1 overexpression plasmid was transfected in SNORA58 overexpressing cells.

[0125] Secondly, this example further explored the reversal of the inhibitory effect of SNORA58 on radiotherapy-induced cell ferroptosis by activating the JNK signal. Anisomycin is a commonly used JNK signaling pathway activator. After adding anisomycin to KYSE30 cells overexpressing SNORA58 and then irradiating them with radiotherapy, the survival of the clones, the level of lipid peroxidation, and the expression of PTGS2 were observed to explore the effect of overexpressing SNORA58 on the radiotherapy sensitivity, lipid peroxidation level, and PTGS2 expression of esophageal squamous cell carcinoma cells. The results are as follows Fig.26shown.

[0126] Depend on Fig.26 It can be seen that anisomycin can significantly restore the increased clone survival rate, lipid peroxidation level and decreased PTGS2 expression caused by overexpression of SNORA58, which may indicate that anisomycin can restore the sensitivity of cells with high expression of SNORA58 to radiotherapy.

[0127] Furthermore, this example also uses immunohistochemical staining to detect the expression of JNK1, phosphorylated JNK and 4-HNE in tissue samples of esophageal squamous cell carcinoma patients after neoadjuvant chemoradiotherapy and analyzes the correlation therebetween. The results are as follows: Fig. 27 shown.

[0128] Depend on Fig. 27 It can be seen that 4-HNE is positively correlated with the expression of JNK1 or phosphorylated JNK.

[0129] Current studies have revealed a GPX4-independent defense mechanism against ferroptosis mediated by dihydroorotate dehydrogenase (DHODH) in the mitochondrial lumen.

[0130] In order to explore whether SNORA58 regulates ferroptosis through the classical mechanism, mainly including the synthesis and peroxidation of polyunsaturated fatty acids (PUFA)-rich phospholipids (PUFA-PL), iron metabolism, mitochondrial metabolism, and glutathione peroxidase 4 (GPX4) and reduced glutathione (GSH) system, Western blot was used to detect the expression of ACSL4 (key metabolic enzyme in PUFA-PL synthesis), GPX4, NCOA4, FTH1 (important regulatory factor for maintaining iron homeostasis) and DHODH in KYSE510, KYSE180 cell lines overexpressing or knocking out SNORA58 and wild-type KYSE510, KYSE180 cell lines, so as to explore the expression of important proteins of the existing ferroptosis mechanism in SNORA58 overexpressing or knocking out cells after radiotherapy. The results are as follows: Fig.28 It is knowable.

[0131] Depend on Fig.28 It can be seen that SNORA58 was not found to have any effect on the proteins ACSL4, GPX4, NCOA4, FTH1, and DHODH.

[0132] The above results can prove that the cell ferroptosis induced by radiotherapy by SNORA58 is mainly mediated by JNK1. Example 6 The combined use of JNK pathway activator and radiotherapy can enhance the radiosensitivity of esophageal squamous cell carcinoma cells

[0133] The purpose of this example is to further explore whether there is a synergistic effect between the JNK activator (anisomycin) and radiotherapy. Anisomycin and radiotherapy can sensitize esophageal squamous cell carcinoma cells. A subcutaneous tumor model of mice overexpressing SNORA58 was constructed, and a blank control group and different treatment groups (specifically including anisomycin alone group, radiotherapy alone group and anisomycin and radiotherapy combined treatment group) were set up. The specific operation steps are as follows: SNORA58 overexpressing and control KYSE30 cells (4×10 6 Two weeks later, when the tumor volume reached an appropriate size, the mice were randomly divided into a control group (n=6) that did not receive radiotherapy, an azithromycin group (50 mg / kg, n=6) that did not receive radiotherapy, a group that received radiotherapy (fractionated radiotherapy, 2 Gy / 2 days × 7 days, n=6), and a group that received radiotherapy combined with azithromycin (50 mg / kg, fractionated radiotherapy, 2 Gy / 2 days × 7 days, n=6). The tumor size was monitored every 2 days and the formula "length × width" was used to calculate the tumor size. 2 ×0.5” to calculate the tumor volume. After completing the treatment regimen, the mice were killed, the subcutaneous transplanted tumors were removed, weighed, and tissue sections were taken for immunohistochemical (IHC) staining analysis. The results are shown in Fig.29 As shown, Fig.29 A is a schematic diagram of the experimental design. Fig.29 B is the tumor growth curve of nude mice in different treatment groups. Fig.29 C is the tumor size of nude mice in different treatment groups. Fig.29 D is the tumor weight of nude mice in different treatment groups. Fig.29 E is the result of immunohistochemical staining to detect the expression of JNK1, phosphorylated JNK, 4-HNE, Ki67, phosphorylated H2AX and cleaved caspase3 in different treatment groups, where EV represents wild-type cells (complete blank control group), SNORA58 represents SNORA58 overexpression cell group, EV-Anisomycin represents control group cells treated with Anisomycin alone, EV-IR represents control group cells treated with radiotherapy (IR), SNORA58-IR represents SNORA58 overexpression cells treated with radiotherapy, EV-IR-Anisomycin represents control group cells transfected with blank vector combined with radiotherapy and Anisomycin, and SNORA58-IR-Anisomycin represents SNORA58 overexpression cells combined with radiotherapy and Anisomycin.

[0134] Depend on Fig.29It can be seen that the tumor growth rate, tumor volume and tumor weight of the combined treatment group were the most significantly reduced among all groups, and immunohistochemical staining also showed enhanced expression of phosphorylated JNK and 4-HNE.

[0135] The above results indicate that the JNK signaling pathway activator anisomycin can significantly enhance the radiosensitivity of SNORA58-overexpressing esophageal squamous cell carcinoma cells. That is, the combined use of JNK pathway activators and radiotherapy significantly enhances the radiosensitivity of esophageal squamous cell carcinoma cells, thereby providing preclinical evidence for the precision treatment of patients with esophageal squamous cell carcinoma with high expression of SNORA58.

[0136] In summary, the present invention uses SNORA58 as a target in the preparation of drugs for improving the radiotherapy sensitivity of esophageal cancer. By inhibiting SNORA58 or activating the downstream signaling pathway JNK signaling pathway regulated by SNORA58, the sensitivity of esophageal cancer patients to radiotherapy can be improved, thereby promoting the radiotherapy efficacy of esophageal cancer patients. In addition, the present invention reveals the marker SNORA58 of esophageal cancer radiotherapy resistance and the JNK signaling pathway of sensitization radiotherapy target, and clarifies the new mechanism of esophageal cancer radiotherapy resistance, namely, the role and mechanism of snoRNA in cell ferroptosis caused by radiotherapy, which has extremely important clinical significance for in-depth analysis of the molecular mechanism of esophageal cancer radiotherapy resistance, explanation of radiotherapy differences in esophageal cancer patients, and formulation of individualized treatment plans to improve radiotherapy efficacy and patient prognosis.

[0137] The above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention is described in detail with reference to the above embodiments, ordinary technicians in the relevant field should understand that the technical solutions of the present invention can be modified or equivalently replaced, but these modifications or replacements are all within the protection scope of the present invention.

Claims

1. Application of SNORA58 as a target in the preparation of drugs for improving the radiosensitivity of esophageal cancer.

2. The use of SNORA58 as a target in the preparation of a drug for improving the radiosensitivity of esophageal cancer as claimed in claim 1, characterized in that: The esophageal cancer is esophageal squamous cell carcinoma.

3. The use of SNORA58 as a target in the preparation of a drug for improving the radiosensitivity of esophageal cancer as claimed in claim 1, characterized in that: The drug includes at least one of a SNORA58 inhibitor and a JNK signaling pathway activator.

4. The use of SNORA58 as a target in the preparation of a drug for improving the radiosensitivity of esophageal cancer as claimed in claim 3, characterized in that: The JNK signaling pathway activator includes at least one of anisomycin, sulfasalazine, amiperidine, heparin, and TNF-α.

5. The use of SNORA58 as a target in the preparation of a drug for improving the radiosensitivity of esophageal cancer as claimed in claim 4, characterized in that: The JNK signaling pathway activator includes anisomycin.

6. A pharmaceutical composition for improving the radiosensitivity of esophageal cancer, characterized in that: The pharmaceutical composition comprises at least one of a SNORA58 inhibitor and a JNK signaling pathway activator.

7. The pharmaceutical composition for improving the radiotherapy sensitivity of esophageal cancer according to claim 6, characterized in that: The esophageal cancer is esophageal squamous cell carcinoma.

8. The pharmaceutical composition for improving the radiosensitivity of esophageal cancer according to claim 6, characterized in that: The JNK signaling pathway activator includes at least one of anisomycin, sulfasalazine, amiperidine, heparin, and TNF-α.

9. The pharmaceutical composition for improving the radiosensitivity of esophageal cancer according to claim 6, characterized in that: The JNK signaling pathway activator includes anisomycin.

Images