Armillaria mellea, fungicide containing armillaria mellea and application of fungicide

Abstract

The invention discloses armillaria mellea, a fungicide containing the armillaria mellea and application of the fungicide, and relates to the field of microorganisms. The invention provides any one of the following armillaria mellea which is preserved in the China General Microbiological Culture Collection Center: a) Armillaria mellea sp. With the preservation number of CGMCC No.41696, b) Armillaria mellea sp. With the preservation number of CGMCC No.41696, c) Armillaria mellea sp. The preservation number of the Armillaria sp. Is CGMCC No.41697. The preservation number of the Armillaria sp. Is CGMCC No.41697. The preservation number of the Armillaria sp. Is CGMCC No.41698. The three Armillaria sp. Strains provided by the invention can establish a better symbiotic relationship with the gastrodia elata, and the yield and quality of the gastrodia elata can be improved and the content of polysaccharide, gastrodin and p-hydroxybenzyl alcohol in the gastrodia elata can be improved after the gastrodia elata is sown or planted together by using the Armillaria sp. Strains.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and in particular to Armillaria mellea, a bacterial agent containing Armillaria mellea, and applications thereof. Background Art

[0002] Gastrodia elata is one of the traditional precious Chinese medicinal materials with a history of more than 2,000 years of medicinal use. The 2020 edition of the Chinese Pharmacopoeia records that Gastrodia elata "tastes sweet, is neutral in nature, and enters the liver meridian. It has the effects of calming wind and stopping spasms, calming liver yang, and removing wind and unblocking meridians." In recent years, the amount of Gastrodia elata used has increased significantly. The natural growth of wild Gastrodia elata is slow, and long-term excavation has led to a gradual decrease in Gastrodia elata resources. Wild Gastrodia elata has been included in the "List of Rare and Endangered Protected Plants in China" and the "List of National Key Protected Wild Plants". Therefore, artificially cultivated products have gradually become the main source of Gastrodia elata products. Ensuring the yield and quality of artificially cultivated Gastrodia elata is of great significance to alleviating the contradiction between supply and demand of Gastrodia elata resources.

[0003] Armillaria is a symbiotic fungus of Gastrodia elata, an orchid plant. Gastrodia elata needs to coexist with Armillaria elata to grow and develop normally. Gastrodia elata is a heterotrophic plant without roots or leaves, and needs Armillaria elata to provide it with nutrition. Therefore, Armillaria elata plays an important role in the nutrient supply and growth regulation of Gastrodia elata. Studies have found that Armillaria elata is closely related to the yield and quality of Gastrodia elata. Armillaria elata can directly affect the growth of Gastrodia elata protocorms and later tubers, as well as the formation of the yield and quality of Gastrodia elata medicinal materials. Therefore, screening and applying high-quality Gastrodia elata symbiotic Armillaria elata is of great significance for improving the yield and quality of Gastrodia elata medicinal materials. Summary of the invention

[0004] In view of this, the object of the present invention is to provide Armillaria mellea, a fungal agent containing Armillaria mellea and applications thereof, so as to overcome the problems of low yield and poor quality of artificially cultivated Gastrodia elata in the prior art and to improve the yield and quality of Gastrodia elata.

[0005] In a first aspect, the present invention provides a new strain of the genus Armillaria, which is any one of the following Armillaria: a) The honey fungus is Armillaria sp. , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No.41696.

[0006] b) The Armillaria mellea Armillaria sp. , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No.41697.

[0007] c) The honey fungus is Armillaria sp. , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No.41698.

[0008] The deposit number is CGMCC No.41696 Armillaria sp., Its ITS sequence is shown in SEQ ID NO.3.

[0009] The deposit number is CGMCC No.41697 Armillaria sp. , and its ITS sequence is shown in SEQ ID NO.4.

[0010] The deposit number is CGMCC No.41698 Armillaria sp. , and its ITS sequence is shown in SEQ ID NO.5.

[0011] In a second aspect, the present invention provides a bacterial agent, comprising at least one strain of the above-mentioned Armillaria mellea.

[0012] Furthermore, the fungal agent is used for companion sowing or planting of Gastrodia elata.

[0013] In a third aspect, the present invention provides the use of the above-mentioned honey fungus or bacterial agent in any of the following: (1) Used for companion sowing or planting of Gastrodia elata.

[0014] (2) Used for preparing Gastrodia elata companion sowing products or Gastrodia elata companion planting products.

[0015] Furthermore, the above-mentioned Armillaria mellea or bacterial agent is used to improve the quality and / or yield of Gastrodia elata.

[0016] Furthermore, the above-mentioned Armillaria mellea or bacterial agent is used to increase the polysaccharide content in Gastrodia elata.

[0017] Furthermore, the above-mentioned Armillaria mellea or bacterial agent is used to increase the content of gastrodin in Gastrodia elata.

[0018] Furthermore, the above-mentioned Armillaria mellea or bacterial agent is used to increase the content of p-hydroxybenzyl alcohol in Gastrodia elata.

[0019] Beneficial effects: The present invention obtains three strains of Armillaria mellea through separation, identification, comparison and screening. Compared with the prior art, the three strains of Armillaria mellea provided by the present invention have the characteristics of fast growth rate, high total terpene and total sugar content, strong extracellular enzyme activity, etc., and can increase the yield of Gastrodia elata medicinal materials and the content of polysaccharides, gastrodin and p-hydroxybenzyl alcohol after being sown or planted with Gastrodia elata.

[0020] Storage Instructions 1: Category naming: Armillaria sp. .

[0021] The biological material of the ginseng is Qiangmi 56.

[0022] Depository: General Microbiology Center, China Culture Collection Administration.

[0023] The abbreviation of the collection agency is: CGMCC.

[0024] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0025] Date of preservation: December 13, 2024.

[0026] The registration number of the Collection Center is: CGMCC No.41696.

[0027] Preservation Instructions 2: Category naming: Armillaria sp. .

[0028] The biological material used in the study: Qiangmi 41.

[0029] Depository: General Microbiology Center, China Culture Collection Administration.

[0030] The abbreviation of the collection agency is: CGMCC.

[0031] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0032] Date of preservation: December 13, 2024.

[0033] The registration number of the Collection Center is: CGMCC No.41697.

[0034] Storage Instructions 3: Category naming: Armillaria sp. .

[0035] The biological material of the ginseng is Qiangmi 47.

[0036] Depository: General Microbiology Center, China National Microbiological Culture Collection Administration.

[0037] The abbreviation of the collection agency is: CGMCC.

[0038] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0039] Date of preservation: December 13, 2024.

[0040] The registration number of the Collection Center is: CGMCC No.41698. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 This is the growth state of the Armillaria mycelium in Example 2.

[0042] Figure 2 is the biomass of Armillaria mellea in Example 2.

[0043] Figure 3This is the ursolic acid standard curve in Example 3.

[0044] Figure 4 This is the glucose standard curve in Example 4.

[0045] Figure 5 This is the glucose standard curve in Example 7. DETAILED DESCRIPTION

[0046] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0047] In order to better illustrate the technical solution of the present invention, the present invention also provides the following specific examples. It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified. Example 1

[0048] Isolation and identification of Armillaria mellea Source of strains: The inventors collected samples from the Gastrodia elata distribution area in Hanzhong City, Shaanxi Province, and obtained three Armillaria strains through separation and screening, which were numbered JQ1, JQ2 and JQ3.

[0049] The above three strains of Armillaria mellea were identified by the following specific methods: (1) The three Armillaria strains were inoculated on PDA semi-solid culture medium respectively, cultured at 24°C for 20 days, and then samples were taken to extract DNA.

[0050] (2) Using the DNA extracted in step (1) as a template, amplify the ITS fragment using universal primers ITS1 and ITS4 to obtain a PCR product.

[0051] ITS1:TCCGTAGGTGAACCTGCGG (SEQ ID NO. 1).

[0052] ITS4:TCCTCCGCTTATTGATATGC (SEQ ID NO. 2).

[0053] (3) The obtained PCR products were sequenced to obtain the ITS sequences of JQ1, JQ2 and JQ3 as shown in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, respectively. Comparison with the published rDNA-ITS sequences of biological species of the genus Armillaria showed that these three strains were Armillaria. Example 2

[0054] Determination of Growth Indexes of Armillaria mellea A section of mature cords from each of the three Armillaria strains JQ1, JQ2 and JQ3 was inoculated into a columnar PDA semi-solid culture medium, and the culture was repeated 30 times at 24°C in the dark.

[0055] Observe and record the time when the mycelium starts to germinate and grow, and the growth conditions. Observe and record the mycelium length, number of branches and other morphological indicators uniformly 15 days after inoculation, and calculate the average mycelium growth rate (unit: mm / d, average mycelium growth rate = longest mycelium length / (culture time-mycelium germination time) and biomass (unit: g, the strain was taken out and dried after 15 days of culture, and the weight was determined). All three honey fungus strains germinated 5 days after inoculation, with fast growth rates and biomasses of more than 0.1 g. Among them, JQ2 had the largest biomass (see Figure 1 , Figure 2 ).

[0056] JQ1 has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 13, 2024, with the deposit number CGMCC No.41696 and the classification name Armillaria sp. .

[0057] JQ2 has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 13, 2024, with the deposit number CGMCC No.41697 and the classification name Armillaria sp. .

[0058] JQ3 has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 13, 2024, with the deposit number CGMCC No.41698 and the classification name Armillaria sp. . Example 3

[0059] Determination of total terpene content in Armillaria strains (1) A commercial Armillaria mellea commonly used in the Tianma production area of ​​Hanzhong City, Shaanxi Province was used as a control (CK). Mycelial powders of JQ1, JQ2, JQ3 and CK were sieved, and 0.5 g of each was placed in a centrifuge tube. Ethyl acetate was added, and ultrasonic extraction was performed and centrifuged. The supernatants were combined and shaken to obtain the test solution.

[0060] (2) Weigh 5.0 mg of ursolic acid standard, dissolve it in ethyl acetate and dilute to 50 mL in a volumetric flask. Shake well to obtain the ursolic acid reference solution.

[0061] (3) Preparation of ursolic acid standard curve Take 1 mL, 1.5 mL, 2 mL, 3 mL, 3.5 mL and 4 mL of ursolic acid reference solution respectively and place them in test tubes, add 1.0 mL of 5% vanillin-glacial acetic acid solution and 2 mL of concentrated sulfuric acid, shake well and heat in a 60℃ water bath for 15 min, immediately cool in an ice bath, add 5 mL of glacial acetic acid, shake well and let stand to room temperature, use the solution without ursolic acid reference as a blank control, and measure its absorbance at 543 nm. Draw a standard curve with the concentration of ursolic acid reference as the horizontal axis and the absorbance as the vertical axis (see Figure 3 ). The concentration of ursolic acid in the range of 0.0199~0.0531mg / mL showed a good linear relationship with the absorbance, and the regression equation was: y=88.207x-0.4603, R 2 =0.9946 (n=6).

[0062] (4) Determination of total terpene content Take 3.0 mL of the test solution prepared in (1) above and place it in a test tube, add 1.0 mL of 5% vanillin-glacial acetic acid solution and 2 mL of concentrated sulfuric acid, shake well and heat in a 60°C water bath for 15 min, immediately cool in an ice bath, add 5 mL of glacial acetic acid, shake well and let stand to room temperature, measure the absorbance of each solution at 543 nm, and calculate the total terpene content. The results are shown in Table 1, where % is the mass percentage.

[0063] Table 1 Total terpene content of different Armillaria strains serial number Total terpenes (%) JQ1 0.743±0.024 JQ2 0.700±0.017 JQ3 0.330±0.010 CK 0.253±0.012 As shown in Table 1, the total terpene contents of the main chemical components in Armillaria strains JQ1, JQ2 and JQ3 were higher than those in the control, among which the total terpene contents of JQ1 and JQ2 were higher. Example 4

[0064] Determination of Total Sugar Content in Armillaria Strains (1) A commercial Armillaria mellea commonly used in the Gastrodia elata producing area of ​​Hanzhong City, Shaanxi Province was used as a control (CK). The mycelial powder of JQ1, JQ2, JQ3 and CK was sieved, and 0.3 g of each was placed in a centrifuge tube. 12 mL of distilled water was added and the mixture was incubated at 70°C for 3.5 h. Ultrasonic extraction was performed for 25 min, and the filtrate was concentrated to 10 mL. 80% ethanol was added and the mixture was precipitated for 16 h. The mixture was centrifuged for 10 min, and the supernatant was removed to obtain crude polysaccharides.

[0065] (2) Take the above crude polysaccharide and dilute it to 10 mL with distilled water to obtain the crude polysaccharide mother solution. Take 2.0 mL of the mother solution and dilute it to 50 mL to obtain the test solution.

[0066] (3) Weigh 10.0 mg of anhydrous glucose into a 100 mL volumetric flask and add distilled water to prepare a 0.1 mg / mL glucose reference solution.

[0067] (4) Preparation of glucose standard curve Pipette 0.2 mL, 0.4 mL, 0.6 mL, 0.8 mL, 1.0 mL, and 1.2 mL of glucose reference solution into test tubes, add distilled water to make up to 2.0 mL, and pipette 2.0 mL of distilled water as a blank control. Add 1.0 mL of 5% phenol solution to each tube, shake well, and quickly add 5 mL of concentrated sulfuric acid, shake well immediately, let stand for 30 min, and measure the absorbance at a wavelength of 490 nm. Draw a standard curve with the concentration of glucose dilution as the horizontal axis and the absorbance value as the vertical axis (see Figure 4 ). Glucose concentration showed a good linear relationship with absorbance in the range of 0.0101~0.0606 mg / mL, and the regression equation was: y=16.203x+0.0576, R 2 =0.9982 (n=6).

[0068] (5) Determination of total sugar content 2.0 mL of the test solution was taken into a test tube, 2.0 mL of distilled water was taken as a blank control, 1.0 mL of 5% phenol solution was added to each tube, 5 mL of concentrated sulfuric acid was quickly added after shaking, and then immediately shaken. After standing for 30 min, the absorbance of each solution was measured at a wavelength of 490 nm, and the total sugar content was calculated. The results are shown in Table 2, where % is the mass percentage.

[0069] Table 2 Total sugar content of different Armillaria strains serial number Total sugar (%) JQ1 1.581±0.038 JQ2 2.704±0.058 JQ3 2.334±0.050 CK 0.963±0.028 As shown in Table 2, the total sugar content of the main chemical components in the three Armillaria strains was higher than that in the control, among which the total sugar content of strain JQ2 was the highest. Example 5

[0070] Detection of extracellular enzyme activity of Armillaria strains (1) A commercial Armillaria mellea commonly used in the Gastrodia elata producing area of ​​Hanzhong City, Shaanxi Province was used as the control (CK). A 0.5 cm long mature cord of each of JQ1, JQ2, JQ3 and CK was inoculated in a culture dish containing PDA semi-solid medium and cultured in the dark at 24°C. Starting from the 4th day after inoculation, samples were taken every 4 days to measure the activities of the three extracellular enzymes until the 32nd day after inoculation. A total of 8 measurements were made, and each measurement was repeated 3 times.

[0071] (2) The laccase activity of each strain was determined using a laccase activity kit (BC1635, Solai Biotechnology Co., Ltd.); the xylanase activity of each strain was determined using a xylanase detection kit (GEL-W-TDX059, Jin Enlai Biotechnology Co., Ltd.); and the cellulase activity of each strain was determined using a cellulase activity kit (GEL-W-TDX036, Jin Enlai Biotechnology Co., Ltd.). The maximum value of the three extracellular enzyme activities of each strain was entered into Table 3.

[0072] Table 3 Comparison of three extracellular enzyme activities of different Armillaria strains serial number Extracellular laccase activity (U / mL) Extracellular xylanase activity (nmol / min / mL) Extracellular cellulase activity (μg / h / mL) JQ1 831.693±8.988 452.340±0.909 585.625±51.850 JQ2 1254.847±13.771 911.059±1.591 332.081±1.336 JQ3 726.401±1.902 744.561±6.356 356.650±2.805 CK 929.920±13.646 395.378±0.263 232.078±1.336 As shown in Table 3, the extracellular xylanase activity and extracellular cellulase activity of JQ1, JQ2 and JQ3 were higher than those of the control, while the extracellular laccase activity and extracellular xylanase activity of JQ2 were the highest, and the extracellular cellulase activity of JQ1 was the highest. Example 6

[0073] Yield of Gastrodia elata sown with honey fungus strains Gastrodia elata was sown with Armillaria mellea strains JQ1, JQ2, JQ3 and CK respectively. After Gastrodia elata matured, 1×1m 2 The samples were dug up three times and the yield of Gastrodia elata was measured after cleaning. See Table 4.

[0074] Table 4 Comparison of the yield of different Armillaria strains sown with Gastrodia elata serial number Comparison of yield between Gastrodia elata and CK planted with Gastrodia elata JQ1 <![CDATA[The yield of Gastrodia elata Blume accompanied by CK is 3.57 kg / m higher 2 > JQ2 <![CDATA[2.25 kg / m higher yield than CK with Gastrodia elata Blume companion broadcasting 2 > JQ3 <![CDATA[The yield of Gastrodia elata Blume with CK companion broadcasting is 0.46 kg / m higher. 2 > As shown in Table 4, the yield of Gastrodia elata after sowing with JQ1, JQ2 and JQ3 strains was higher than that of the control, among which the yield of Gastrodia elata sown with JQ1 was the highest. Example 7

[0075] Determination of extracts, polysaccharides, gastrodin and p-hydroxybenzyl alcohol in Gastrodia elata sown with Armillaria mellea strains (1) Steam the cleaned Gastrodia elata until there is no white core, cool it to room temperature, dry it at 55°C, grind it, sieve it and set aside.

[0076] (2) The content of the extract shall be determined in accordance with the method for determining the content of alcohol-soluble extract in General Chapter 2201 of the 2020 edition of the Chinese Pharmacopoeia. The content of gastrodin and p-hydroxybenzyl alcohol shall be determined in accordance with the method for determining the content of gastrodin and p-hydroxybenzyl alcohol under the item of Gastrodia elata in the 2020 edition of the Chinese Pharmacopoeia.

[0077] (3) The polysaccharide content was determined by the phenol-concentrated sulfuric acid method. Glucose was used as the standard substance to prepare glucose standard solutions of different concentrations. The absorbance was measured at a wavelength of 490 nm. The glucose standard curve was drawn with the concentration of the glucose standard solution as the horizontal axis and the absorbance value as the vertical axis (see Figure 5), the linear range of Gastrodia elata polysaccharide was 0.00648 ~ 0.324 mg / mL, the formula was Y =9.9123 X - 0.0208, R 2 = 0.9994, and the linear relationship is good within this range. Pipette the sample solution into a test tube, add 5% phenol solution, mix well, and then add 5 mL of concentrated H 2 SO 4 The solution was allowed to stand for 10 min, heated in a boiling water bath for 15 min, taken out and quickly cooled to room temperature, and the absorbance was measured at a wavelength of 490 nm. The polysaccharide content was calculated according to the formula *100%. In the formula, C is the mass concentration of polysaccharide obtained from the standard curve, mg / mL; V is the fixed volume, mL; N is the dilution factor; and W is the sample mass, g.

[0078] The results are shown in Tables 5 and 6.

[0079] Table 5 Comparison of extracts and polysaccharide contents in Gastrodia elata sown with different Armillaria strains

[0080] Table 6 Comparison of gastrodin and p-hydroxybenzyl alcohol contents in Gastrodia elata sown with different Armillaria strains

[0081] It can be seen from Tables 5 and 6 that after Gastrodia elata was sown with Armillaria mellea JQ1, JQ2 and JQ3, the contents of extracts, polysaccharides, gastrodin and p-hydroxybenzyl alcohol in the harvested Gastrodia elata were relatively high.

[0082] From the test results of Examples 6-7 above, it can be seen that by sowing Gastrodia elata with Armillaria mellea JQ1, JQ2 and JQ3, high yield and high quality Gastrodia elata can be obtained.

[0083] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Any one of the following honey fungi, characterized in that: a) The Armillaria mellea Armillaria sp. , deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit number of CGMCC No.41696; b) The Armillaria mellea Armillaria sp. , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number of CGMCC No.41697; c) The honey fungus is Armillaria sp. , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No.41698.

2. A bacterial agent, characterized in that The bacterial agent contains at least one strain of the Armillaria mellea described in claim 1.

3. The bacterial agent according to claim 2, characterized in that The microbial agent is used for accompanying sowing or planting of Gastrodia elata.

4. Use of the honey fungus described in claim 1 or the bacterial agent described in claim 2 or 3 in any of the following: (1) Used for companion sowing or planting of Gastrodia elata; (2) Used for preparing Gastrodia elata companion sowing products or Gastrodia elata companion planting products.

5. Use of the Armillaria mellea described in claim 1 or the bacterial agent described in claim 2 or 3 in improving the quality and / or yield of Gastrodia elata.

6. Use of the Armillaria mellea described in claim 1 or the bacterial agent described in claim 2 or 3 in increasing the polysaccharide content in Gastrodia elata.

7. Use of the Armillaria mellea described in claim 1 or the bacterial agent described in claim 2 or 3 in increasing the content of gastrodin in Gastrodia elata.

8. Use of the Armillaria mellea described in claim 1 or the bacterial agent described in claim 2 or 3 in increasing the content of p-hydroxybenzyl alcohol in Gastrodia elata.

Images