A recombinant microorganism and application thereof in screening of high-yield FPP related target
By constructing recombinant microorganisms and utilizing the fluorescence properties of β-carotene and flow cytometry sorting technology, the high-throughput problem of screening the terpene precursor content in Saccharomyces cerevisiae was solved, and the production efficiency of terpene compounds and the accuracy of gene target screening were improved.
Patent Information
- Application Number
- CN202510520737.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-24
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2045-04-24
AI Technical Summary
Existing technologies lack high-throughput screening probes to characterize the terpene precursor content of Saccharomyces cerevisiae, which limits the smoothness of the terpene compound synthesis pathway and makes it difficult to effectively increase production.
Recombinant microorganisms were constructed to heterologously express the CrtE, CrtYB and CrtI genes. Combined with CRISPRi and SCRaMBLE mutant libraries, the autofluorescence properties of β-carotene were used to screen gene targets affecting the terpene precursor FPP through flow cytometry sorting technology.
High-throughput and efficient screening of terpene precursor FPP-related gene targets was achieved, the production efficiency and screening accuracy of terpenoid compounds were improved, and the range of target selection for chassis cell transformation was broadened.
Smart Images

Figure CN120025917B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microorganisms, in particular, to a recombinant microorganism and its application in screening high-yield FPP related target. BACKGROUND
[0002] Terepenoids are natural products linked by isoprene or isopentane in various ways, with more than 55,000 types identified, accounting for 60% of all natural compounds. Terepenoids are divided into monoterpenes (C10), sesquiterpenes (C15), diterpenes (C20), steroterpenes (C25), triterpenes (C30), tetraterpenes (C40) and polyterpenes (C>40) according to the number of derived isoprene (C5) units. Terepenoids have excellent properties such as anti-infection, antibacterial, antioxidant, etc., and are widely used in chemical industry, medicine, food, pesticide and other fields, with high commercial value. At present, the main chassis cells for microbial synthesis of terepenoids are yeast and Escherichia coli, and the model Saccharomyces cerevisiae is the most stable host for expressing heterologous terpene synthase genes, because it has clear genetic background, recognized safety, short growth cycle, easy genetic manipulation and low culture cost, etc. Therefore, constructing a high-quality S. cerevisiae chassis is of great significance to improve the synthesis yield of terepenoids.
[0003] The yield of terepenoids synthesized by S. cerevisiae mainly depends on the smoothness of the biosynthetic pathway, and the smoothness of the synthesis pathway is mainly restricted by the supply of precursors. Therefore, it is crucial to improve the precursor supply of S. cerevisiae chassis for terepenoids. There are many gene targets in the metabolic regulation network of S. cerevisiae that affect the content of terpene precursors, and knocking out or overexpressing key gene targets can effectively improve the content of terpene precursors, thereby obtaining a chassis cell more conducive to the synthesis of terepenoids. High-throughput screening of mutagenesis library has been widely used in gene mining or identification of key targets related to specific phenotypes, but there is no high-throughput screening probe for directly characterizing the content of terpene precursors. Therefore, developing a high-throughput screening probe that can characterize the content of terpene precursors can promote the research progress of mining key gene targets of terpene precursors. SUMMARY
[0004] The present application is based on the findings and recognitions of the inventors on the following problems:
[0005] The pathway of S. cerevisiae synthesizing terpenes is as follows: Figure 1As shown, glucose produces pyruvate through the glycolysis pathway, pyruvate produces acetyl-CoA through the tricarboxylic acid cycle, and acetyl-CoA produces isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP) through the mevalonate pathway (MVA). Different combinations of IPP and DMAPP can produce important precursors of terpenoids, including geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP), bis(geranyl) diphosphate (GGPP) and squalene epoxide.
[0006] β-carotene is a tetraterpenoid compound with FPP as its precursor. It can make the production strain chassis color, which is a favorable feature for screening microbial chassis cells. β-carotene can spontaneously emit green fluorescence under the conditions of excitation light of 488nm and emission light of 535nm. The pathway of heterologous synthesis of β-carotene in Saccharomyces cerevisiae is as follows Figure 2 As shown, FPP is converted into GGPP by geranylgeranyl diphosphate synthase (CrtE), and then into phytoene by the bifunctional enzyme phytoene synthase / lycopene cyclase (CrtYB), and then into lycopene by phytoene dehydrogenase (CrtI), and finally into β-carotene by the bifunctional enzyme (CrtYB). The present application constructs a heterologous expression microorganism and screens and optimizes the heterologously expressed genes, so that the content of the terpene precursor FPP is proportional to the content of β-carotene. At this time, β-carotene can be used as a high-throughput screening probe to efficiently screen potential gene targets that affect the terpene precursor FPP, thereby enriching the modification targets that can improve the synthesis of terpenoids by chassis cells, and further improving the production efficiency of terpenoids on the basis of safety and effectiveness.
[0007] Therefore, in its first aspect, the present invention provides a recombinant microorganism. According to an embodiment of the present invention, the recombinant microorganism heterologously expresses: CrtE gene, CrtYB gene, and CrtI gene, wherein: the CrtE gene has the nucleotide sequence set forth in SEQ ID NO:2, or a nucleotide sequence at least 85% identical thereto; the CrtYB gene has the nucleotide sequence set forth in SEQ ID NO:3, or a nucleotide sequence at least 85% identical thereto; and the CrtI gene has the nucleotide sequence set forth in SEQ ID NO:4, or a nucleotide sequence at least 85% identical thereto. This result was achieved by screening and optimizing multiple heterologously expressed genes. In this case, the recombinant microorganism is capable of efficiently expressing β-carotene, and the content of the terpene precursor FPP is proportional to the content of β-carotene. The phrase "at least 85% identity" refers to at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity.
[0008] According to an embodiment of the present application, the recombinant microorganism described above can further comprise at least one of the following additional technical features:
[0009] According to an embodiment of the present application, the ROX1 gene in the recombinant microorganism is silenced. In this way, the recombinant microorganism is able to express β-carotene more efficiently, and the content of terpene precursor FPP is still proportional to the content of β-carotene.
[0010] According to an embodiment of the present application, the CrtE gene is derived from at least one of Sulfolobus acidocaldarius, Phaffia rhodozyma and Pantoea ananatis.
[0011] According to an embodiment of the present application, the CrtYB gene is derived from at least one of Blakeslea trispora, Mucor circinelloides and Phaffia rhodozyma.
[0012] According to an embodiment of the present application, the CrtI gene is derived from at least one of Blakeslea trispora, Mucor circinelloides and Phaffia rhodozyma.
[0013] The present application finds that the source of the geranylgeranyl pyrophosphate synthase (CrtE), phytoene synthase (CrtYB) and phytoene dehydrogenase (CrtI) has an impact on the product obtained by the recombinant microorganism and its yield, for example, β-carotene has spontaneous green fluorescence, lycopene does not, and different CrtE sources make the color of the strain appear red and yellow, and red is high-yield lycopene, and yellow is high-yield β-carotene.
[0014] According to an embodiment of the present application, the recombinant microorganism overexpresses a HMG1 gene truncation.
[0015] According to an embodiment of the present application, the HMG1 gene truncation has the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity thereto.
[0016] According to an embodiment of the present application, the recombinant microorganism is Saccharomyces cerevisiae.
[0017] In a second aspect of the present application, the present application provides a use of the recombinant microorganism described in the first aspect in the preparation of β-carotene. As described above, the recombinant microorganism is able to produce β-carotene efficiently after optimization.
[0018] In a third aspect of the present application, the present application provides a use of the recombinant microorganism of the first aspect in screening a high-yield FPP related target. As described above, the present application can be used to efficiently screen potential gene targets affecting terpene precursor FPP by constructing a heterologous expression microorganism, so that the content of terpene precursor FPP is proportional to the content of β-carotene, and β-carotene can be used as a high-throughput screening probe.
[0019] In a fourth aspect of the present application, the present application provides a method for preparing β-carotene. According to an embodiment of the present application, the method comprises:
[0020] liquid culturing the recombinant microorganism of the first aspect; and isolating β-carotene from a culture product of the liquid culturing.
[0021] According to an embodiment of the present application, the liquid culturing comprises being carried out in a YPD liquid culture medium at 30°C for 48-96 hours.
[0022] In a fifth aspect of the present application, the present application provides a method for screening a high-yield FPP related target. According to an embodiment of the present application, the method comprises: (1) constructing a mutant library of the recombinant microorganism of the first aspect; and (2) screening the recombinant microorganism and the mutant library thereof by a flow cytometer to obtain a target.
[0023] According to an embodiment of the present application, the method for screening a high-yield FPP related target can further comprise at least one of the following additional technical features:
[0024] According to an embodiment of the present application, the mutant library comprises at least one of a single gene inhibition mutant library and a random mutant library.
[0025] According to an embodiment of the present application, the single gene inhibition mutant library is a single gene inhibition CRISPRi mutant library.
[0026] According to an embodiment of the present application, the random mutant library is a SCRaMBLE mutant library.
[0027] According to an embodiment of the present application, the single gene inhibition mutant library is obtained by: transferring a gRNA plasmid of a CRISPRi mutant library into the recombinant microorganism, and carrying out liquid culturing at 30-35°C for 48-96 hours, wherein the mass / volume ratio of the gRNA plasmid of the CRISPRi mutant library and the bacterial liquid of the recombinant microorganism is 1:50.
[0028] According to a specific embodiment of the present application, the OD600 of the bacterial liquid of the recombinant microorganism is 0.2. At this time, the inoculation of the recombinant microorganism into the culture medium is good.
[0029] According to an embodiment of the present application, the liquid culture medium is selected from YPD liquid culture medium or SC liquid culture medium.
[0030] According to an embodiment of the present application, the random mutant library is obtained by transforming a plasmid carrying a CRE enzyme coding fragment into the recombinant microorganism and inducing culture in a 30-35°C SD-His medium containing β-estradiol for 12-48 hours.
[0031] According to a specific embodiment of the present application, the OD600 of the bacterial solution of the recombinant microorganism is 0.2 when the plasmid carrying the CRE enzyme coding fragment is transformed into the recombinant microorganism. At this time, the inoculation of the recombinant microorganism into the culture medium is effective.
[0032] According to an embodiment of the present application, the strain with a significant difference in fluorescence value from the recombinant microorganism in the mutant library is the target strain, and the mutant gene carried by the target strain is the target site. The significant difference herein includes a significant decrease or increase in the fluorescence value detected by flow cytometry of the mutant library strain and the recombinant microorganism.
[0033] The advantages of the present application compared to the prior art at least include:
[0034] (1) Overcome the limitations of traditional methods: the traditional screening method using β-carotene color coating has subjectivity, and is limited by manual operation, resulting in low screening throughput. The present application uses the spontaneous green fluorescence effect of β-carotene, and through the high-throughput screening technology of flow cytometry sorting, it gets rid of the limitation of manual operation, and realizes high-throughput strain screening;
[0035] (2) Improve screening efficiency and accuracy: the flow cytometry sorting technology of the present application significantly improves the strain screening throughput, and the sorting cell speed is >1000 / second, and through the laser recognition system, the recognition accuracy and accuracy of the strain are effectively improved;
[0036] (3) Develop new screening probes for terpenoid compound chassis cells: there is no specific probe for the precursor of the chassis cell at present, and the content of the terpenoid precursor can be indirectly indicated by the content of the downstream tetraterpenoid compound β-carotene, thereby widening the selection range of the terpenoid compound chassis cell probe;
[0037] (4) Provide different gene level dimension research ideas: the present application constructs CRISPRi and SCRaMBLE mutant libraries, and studies from the single gene level and the large fragment level of the chromosome, and the screening results of the two are verified with each other, which can effectively improve the success rate of the verification of the target gene in the later stage.
[0038] Additional aspects and advantages of the application will be set forth in part in the description which follows, and in part will become apparent to those skilled in the art upon examination of the following and the attendant drawings or can be learned by practice of the application. BRIEF DESCRIPTION OF DRAWINGS
[0039] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments will be briefly introduced as follows. It should be understood that the following drawings only show some of the embodiments of the present application, and therefore should not be considered as a limitation to the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of the drawings.
[0040] Figure 1 Pathway diagram for synthesis of terpenes by Saccharomyces cerevisiae according to the present application;
[0041] Figure 2 Pathway diagram for heterologous synthesis of β-carotene by Saccharomyces cerevisiae according to the present application;
[0042] Figure 3 Graph of the detection results of FPP production by 2369R, 2R and 2RH strains according to Example 2 of the present application;
[0043] Figure 4 Graph of the detection results of β-carotene production by 2-EYBI, 2R-EYBI and 2RH-EYBI strains according to Example 2 of the present application;
[0044] Figure 5 Graph of the flow cytometry analysis results of 2369R and 2-EYBI strains according to Example 2 of the present application;
[0045] Figure 6 Graph of the flow cytometry analysis results of 2RH-EYBI and 2RH-EYBI-CRISPRi mutant library strains according to Example 2 of the present application;
[0046] Figure 7 Graph of the flow cytometry analysis results of 2RH-EYBI and 2RH-EYBI-CRE-Induce (2RH-EYBI-SCRaMBLE) mutant library strains according to Example 2 of the present application. DETAILED DESCRIPTION
[0047] Embodiments of the present application are described in detail below, examples of which are shown in the accompanying drawings. The embodiments described below by reference to the drawings are exemplary and are intended to explain the present application, and should not be understood as a limitation to the present application.
[0048] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Thus, a feature specified as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "plurality" or "multiple" means at least two or two, for example, two, two, three, three, etc., unless otherwise specifically defined.
[0049] In this document, the terms “include”, “have” or “include” are open expressions, that is, they include the contents specified in the present invention but do not exclude other aspects.
[0050] As used herein, the term "optionally" generally means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0051] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.
[0052] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which the present invention belongs.
[0053] In this invention, the single-gene knockdown CRISPRi mutant library is a tool for studying gene function, which inhibits the expression of specific genes through CRISPR interference technology (CRISPRi). The following are the main steps for constructing a single-gene knockdown CRISPRi mutant library: (1) sgRNA design and synthesis, (2) vector construction, (3) library construction and validation, (4) viral packaging and transduction, (5) cell screening and functional validation, and (6) high-throughput sequencing and data analysis.
[0054] In the present application, "CRISPR interference (CRISPRi)" is a gene expression regulation technology based on the CRISPR / Cas9 system, mainly used for inhibiting the transcription level of genes. It uses the dead Cas9 protein (dCas9) combined with guide RNA (sgRNA) to target the specific promoter region or transcription start site of the gene, thereby preventing the binding of transcription factors and the initiation of RNA polymerase, and achieving the inhibition of gene expression. Specifically, the dCas9 protein retains the ability to bind with sgRNA and target specific regions of the genome, but loses the activity of cutting DNA. When the dCas9-sgRNA complex binds to the promoter region of the target gene, it physically hinders the initiation of transcription, inhibiting the expression of the gene. This technology has high specificity and reversibility, and does not cause permanent changes to the genome.
[0055] In the present application, the "SCRaMBLE (Synthetic Chromosome Rearrangement and Modification by LoxP-mediated Evolution) mutant library" is a synthetic yeast chromosome-based genome rearrangement technology that induces chromosomal rearrangement and modification by introducing a large number of LoxP sites on the synthetic chromosome of yeast using Cre recombinase, thereby generating a large number of genetic variations. The construction of the SCRaMBLE mutant library mainly includes the following operations: 1. Constructing a designed synthetic chromosome: (1) Determine the target genes: Clearly define the target genes for chromosomal rearrangement, which can be genes related to specific traits or functions. (2) Select a suitable yeast strain: Select a suitable Saccharomyces cerevisiae strain as the research object, usually using a genetically edited yeast strain that has integrated a synthetic chromosome in its genome. (3) Construct a synthetic chromosome: Introduce multiple LoxP sites on the synthetic chromosome, which will serve as the action site for Cre recombinase for subsequent chromosomal rearrangement. 2. Introduce LoxP sites: (1) Design primers and sgRNA: Design specific primers and sgRNA for the target region on the synthetic chromosome to insert LoxP sites into specific locations on the chromosome. (2) Gene editing: Use CRISPR / Cas9 technology to insert LoxP sites into the synthetic chromosome, achieving the integration of LoxP sites through homologous recombination or non-homologous end joining. 3. Induce chromosomal rearrangement: (1) Culture the yeast strain: Culture the constructed synthetic chromosome yeast strain with LoxP sites in an appropriate medium to grow to the logarithmic phase. (2) Induce Cre recombinase expression: Induce the expression of Cre recombinase in yeast cells by adding an inducer (such as heat shock, chemical inducer, etc.) or using a constitutive promoter. (3) Chromosomal rearrangement: Under the action of Cre recombinase, recombination occurs between LoxP sites, leading to deletion, inversion, or translocation of chromosomal fragments, thereby generating a large number of genetic variations. 4. Screening and verification: (1) Select superior strains: According to the experimental purpose, screen the rearranged yeast strains, such as through specific phenotype screening (such as heat resistance, drug resistance, etc.) or detection of metabolic products, to select strains with superior traits. (2) Sequencing verification: Perform whole-genome sequencing on the selected superior strains to analyze the specific circumstances of chromosomal rearrangement and confirm whether the rearrangement and modification of the target genes meet the expected requirements.
[0056] In the present application, "CRISPRi mutant library" is synonymous with "CRISPRi library", and "SCRaMBLE mutant library" is synonymous with "SCRaMBLE library".
[0057] The present application aims to develop a high-throughput screening probe for characterizing the content of terpene precursors, and to screen gene targets that potentially affect the content of terpene precursors in a chassis cell using current high-throughput screening methods (flow cytometry sorting and microfluidics, etc.), thereby not only improving the screening efficiency of gene targets, but also enriching the modification sites of current gene targets, which greatly promotes the research progress of terpenoid biosynthesis. The method for screening gene targets that potentially affect the content of terpene precursors in a chassis cell of the present application is summarized as follows, mainly comprising the following steps:
[0058] Step 1: Constructing chassis strains with different FPP expression levels
[0059] In the present application, knocking out the ROX1 gene of Saccharomyces cerevisiae and overexpressing the truncated HMG1 gene (tHMG1) can increase the synthesis yield of terpene precursor FPP, wherein ROX1 is a heme-dependent transcriptional repressor, and HMG1 is a key gene in the mevalonate pathway (MVA). By modifying the ROX1 and tHMG1 gene sites, the present application can obtain yeast strains expressing different FPP yields.
[0060] Step 2: Constructing a β-carotene synthesis pathway in strains expressing different FPP levels
[0061] The CrtE gene from Sulfolobus acidocaldarius, the CrtYB gene from Blakeslea trispora, and the CrtI gene from Blakeslea trispora are codon-optimized, and are inserted into different yeast chassis strains that can differentially express FPP using CRISPR / Cas9 gene editing technology, so that the yeast strains obtain the ability to express β-carotene.
[0062] Step 3: Constructing a mutant library strain in a Saccharomyces cerevisiae strain expressing β-carotene
[0063] a. Constructing a CRISPRi mutant library
[0064] The CRISPRi library is constructed by expressing a dCas9 protein without gene cleavage activity and occupying the gene transcription start site, thereby achieving the purpose of inhibiting gene expression. The CRISPRi library used in the present application is purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Syno® Yeast Whole Genome CRISPR Inhibition Library, item number STCRI222531), wherein the number of gRNA in the plasmid library is 61080, which can cover the whole yeast genome.
[0065] Each gRNA plasmid in the CRISPRi library enters a single strain and inhibits the expression of single gene activity, so by constructing a CRISPRi yeast mutant library, the influence of single genes on terpenoids can be obtained, and potential unknown gene targets can be screened.
[0066] b. Constructing SCRaMBLE mutant library strains
[0067] The SCRaMBLE system refers to inserting a large number of LoxP sites on a yeast artificial chromosome, which can cause rapid random chromosomal structural variation of the yeast artificial chromosome when CRE recombinase and beta-estradiol are induced. The artificial chromosome yeast strain 2369R used in the present application is a gift from the Shenzhen Huada Shen Yue team, and a large number of LoxP sites are inserted in the right arms of chromosomes II, III, VI and IX.
[0068] Step 4: Analysis of mutant library strains by flow cytometry sorting technology
[0069] The strains were constructed in the 488 / 535 nm channel for flow cytometry analysis to determine the fluorescence difference of the yeast strains before and after the construction of the mutant, thereby verifying the feasibility of beta-carotene as a terpene chassis cell high-throughput screening probe.
[0070] In summary, through the above steps, the present application uses beta-carotene as a probe, constructs CRISPRi and SCRaMBLE mutant libraries, and then uses high-throughput technology to screen chassis cells with high yield of terpene precursor FPP, thereby achieving the purpose of mining new gene targets that affect the yield of terpenoids. This provides a novel and efficient solution for terpenoid chassis cell modification.
[0071] The scheme of the present application will be explained below in conjunction with the examples. Those skilled in the art will understand that the following examples are only used to illustrate the present application and should not be regarded as limiting the scope of the present application. If the specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in the art or according to the product instructions are used. If the reagents or instruments are not specified by the manufacturer, they are all conventional products that can be obtained by purchase.
[0072] Example 1:
[0073] 1. Experimental materials
[0074] (1) Strain, plasmid and primer information
[0075] The strains used in the present application are shown in Table 1, the plasmid information used is shown in Table 2, and the primer information used is shown in Table 3.
[0076] Table 1: Strain characteristics and sources
[0077]
[0078] Table 2: Plasmid characteristics and sources
[0079]
[0080] Table 3: Target fragments for insertion and primer sequences used in the present application
[0081]
[0082] 2. Construction of strains
[0083] (1) Construction of heterologous gene expression cassette
[0084] Construction of CrtE-Sa gene expression vector: The target fragments of X-4L, P TDH3 , T PGK1 , X-4R were amplified by PCR using the genome of BY4741 yeast strain as template, and the large fragment X-4L-P TDH3 -T PGK1 -X-4R was assembled by Overlap PCR technology, in which the enzyme cutting sites KpnI and SacI were inserted between the P TDH3 promoter and T PGK1 terminator. Then, the Gibson technology was used to assemble the large fragment X-4L-P TDH3 -T PGK1 -X-4R into the linear vector PRS426 which was cut by KpnI and SacI, to construct the plasmid TG-1. The target fragment of CrtE-Sa which was synthesized after codon optimization was assembled into the linear vector TG-1 which was cut by KpnI and SacI, to construct the CrtE-Sa gene expression cassette TG-1-CrtE.
[0085] Construction of CrtYB-Bt gene expression vector: The target fragments of Int3L, P PGK1 , T PGK1 , Int3R were amplified by PCR using the genome of BY4741 yeast strain as template, and the large fragment Int3L-P PGK1 -T PGK1 -Int3R was assembled by Overlap PCR technology, in which the enzyme cutting sites KpnI and SacI were inserted between the P PGK1 promoter and T PGK1 terminator. Then, the Gibson technology was used to assemble the large fragment Int3L-P PGK1 -T PGK1- Int3R was assembled into the PRS426 linear vector digested with Kpnl and Sad, to construct plasmid TG-2. The CrtYB-Bt gene of interest synthesized after codon optimization was assembled into the TG-2 linear vector digested with Kpnl and Sad, to construct the CrtYB-Bt gene expression cassette TG-2-CrtYB.
[0086] CrtI-Bt gene expression vector construction: Int10L, P CYC1 , T CYC1 , Int10R gene of interest fragments were amplified by PCR using the BY4741 yeast strain genome as template, and assembled into a large fragment Int10L-P CYC1 -T CYC1 -Int10R using Overlap PCR technology, in which the restriction sites BamHI and EcoRI were inserted between the P CYC1 promoter and T CYC1 terminator. The large fragment Int10L-P CYC1 -T CYC1 -Int10R was assembled into the PRS426 linear vector digested with BamHI and EcoRI, to construct plasmid TG-3. The CrtI-Bt gene of interest synthesized after codon optimization was assembled into the TG-3 linear vector digested with BamHI and EcoRI, to construct the CrtI-Bt gene expression cassette TG-3-CrtI.
[0087] tHMG1 gene expression vector construction: XI-2L, P CYC1 , T ADH1 , XI-2R gene of interest fragments were amplified by PCR using the BY4741 yeast strain genome as template, and assembled into a large fragment XI-2L-P CYC1 -T ADH1 -XI-2R using Overlap PCR technology, in which the restriction sites Kpnl and Sad were inserted between the P CYC1 promoter and T ADH1 terminator. The large fragment XI-2L-P CYC1 -T ADH1 -XI-2R was assembled into the PRS426 linear vector digested with Kpnl and Sad, to construct plasmid TG-4. The tHMG1 gene truncated by PCR amplification using the BY4741 yeast strain genome as template, and the tHMG1 gene of interest was assembled into the TG-4 linear vector digested with Kpnl and Sad, to construct the tHMG1 gene expression cassette TG-4-tHMG1.
[0088] ROX1 gene knockout fragment assembly: PCR amplification of the genomic template of BY4741 yeast strain excluding the CDS region of the gene ROX1 at both ends ± 500 bp sequence, The donor DNA fragment del-ROX1 not containing the CDS region of the ROX1 gene was assembled by Overlap PCR technology.
[0089] (2) CRISPR-Cas9 expression cassette construction
[0090] The CRISPR-Cas9 gene expression cassette designed in the application mainly inserts a 20bp recognition site, a gRNA scaffold and a URA protein screening resistance on the basis of pCas9, wherein the gRNA recognition site is designed using the CHOPCHOP online design tool (https: / / chopchop.cbu.uib.no / ).
[0091] Construction of CRISPR-Cas9 expression cassette of CrtE-Sa gene: The CrtE-Sa gene is designed to be inserted between the LSB6 and GSH1 genes of the Xth chromosome of the 2369R strain, i.e. site X-4, and the recognition sequence is CGCCATTCAAGAGCAGCAAC (SEQ ID NO: 59). The sequence X-4 gRNA-Ura is synthesized by PCR, and then the pCas9 vector and the X-4 gRNA-Ura fragment are assembled by Golden-gate cloning using BsaI restriction endonuclease to construct the pCAS-X-4 expression cassette.
[0092] Construction of CRISPR-Cas9 expression cassette of CrtYB-Bt gene: The CrtYB-Bt gene is designed to be inserted between the RPO21 and SCM3 genes of the IVth chromosome of the 2369R strain, i.e. site Int3, and the recognition sequence is AACATTAATTGCTCTCACAG (SEQ ID NO: 60). The sequence Int3 gRNA-Ura is synthesized by PCR, and then the pCas9 vector and the Int3 gRNA-Ura fragment are assembled by Golden-gate cloning using BsaI restriction endonuclease to construct the pCAS-Int3 expression cassette.
[0093] Construction of CRISPR-Cas9 expression cassette of CrtI-Bt gene: CrtI-Bt gene is designed to be inserted between IPI3 and PBR1 genes of chromosome XIV of 2369R strain, i.e. site Int10, and the recognition sequence is CATGAGCAGCCACTGTATCG (SEQ ID NO: 61). Int10 gRNA-Ura sequence is synthesized by PCR, and pCas9 vector and Int10 gRNA-Ura fragment are assembled by Golden-gate cloning with BsaI restriction endonuclease to construct pCAS-Int10 expression cassette.
[0094] Construction of CRISPR-Cas9 expression cassette of tHMG1 gene: tHMG1 gene is designed to be inserted between FAT3 and MTR2 genes of chromosome XI of 2369R strain, i.e. site XI-2, and the recognition sequence is GTTGACCAGTTGATCAGTTG (SEQ ID NO: 62). XI-2 gRNA-Ura sequence is synthesized by PCR, and pCas9 vector and XI-2 gRNA-Ura fragment are assembled by Golden-gate cloning with BsaI restriction endonuclease to construct pCAS-XI-2 expression cassette.
[0095] Construction of CRISPR-Cas9 expression cassette for ROX1 gene knockout: the gRNA recognition sequence of the CDS region of ROX1 gene is designed by using CHOPCHOP online design tool, which is CAACAACAGCAGTCAAACAC (SEQ ID NO: 63). del-ROX1-gRNA-Ura sequence is synthesized by PCR, and pCas9 vector and del-ROX1-gRNA-Ura fragment are assembled by Golden-gate cloning with BsaI restriction endonuclease to construct pCAS-del-ROX1 expression cassette.
[0096] (3) Construction of strains
[0097] In the present application, the yeast strains are genetically overexpressed or knocked out based on CRISPR-Cas9 gene editing technology, and the modified strains are constructed as follows:
[0098] Construction of FPP content strain with differential expression: 2369R is used as a chassis cell, and donor DNA fragment del-ROX1 and pCAS-del-ROX1 plasmid are transformed, so as to obtain strain 2R with ROX1 gene knocked out; 2R is used as a chassis cell, and donor DNA fragment XI-2L-P CYC1 -tHMG1-T ADH1 -XI-2R and pCAS-XI-2 plasmid are transformed, so as to obtain strain 2RH with tHMG1 gene overexpressed.
[0099] Construction of β-carotene-expressing strains: 2369R, 2R, 2RH strains as the chassis cells, respectively, donor DNA X-4L-P TDH -CrtE-Sa-T PGK1 -X-4R, Int3L-P PGK1 -CrtYB-Bt-T PGK1 -Int3R, Int10L-P CYC1 -CrtI-Bt-T CYC1 -Int10R and gRNA plasmid pCAS-X-4, pCAS-Int3, pCAS-Int10 into the chassis cell, that is, the β-carotene-expressing strains 2-EYBI, 2R-EYBI and 2RH-EYBI can be obtained.
[0100] 3. Yeast transformation
[0101] The present application uses LiAc-mediated chemical transformation method for yeast gene editing, and the specific experimental operation process is as follows:
[0102] (1) Take the frozen bacteria liquid, streak on the YPD plate, and invert culture for 3 d;
[0103] (2) Take single colony to 3 mL YPD liquid medium (2% glucose, 1% yeast extract and 2% peptone; peptone is purchased from Shengong, batch number A505247-0500; glucose is purchased from Shengong, batch number A501991-0500; yeast extract is purchased from OXOID, batch number LP0021B.), 30°C, 220 rpm shaking bacteria overnight;
[0104] (3) inoculate the initial OD600=0.2 into 50 mL of YPD medium, and culture at 30°C, 220 rpm for about 4.5 h to OD=0.8~1, centrifuge the obtained bacteria liquid at 4500 rpm for 5 min, and remove the supernatant;
[0105] (4) resuspend the obtained precipitate in step (3) in 20 mL of 1xTE solution, and centrifuge at 4500 rpm for 5 min;
[0106] (5) add 2 mL of solution 1 (1.7 mL ddH2O, 200 μL 10×lithium acetate, 100 μL 1xTE) to the obtained precipitate in step (4), and culture in a 30°C incubator for 10 min, to obtain competent cells;
[0107] (6) Take 100 μL competent cells and 20 μL ssDNA, mix, add about 3 μg of donor DNA fragment, about 500 ng of gRNA, and solution 2 (600 μL 50% PEG4000, 75 μL 1M lithium acetate, 75 μL 10x TE), vortex to mix, place in a 30°C constant temperature box for 30 min, add 88 μL DMSO, mix;
[0108] (7) The mixed product obtained in step (6) is heated at 42°C for 20 min, centrifuged at 13000 rpm for 1 min, the supernatant is discarded, then 1 mL of YPD liquid medium is added, resuspended by blowing, centrifuged at 13000 rpm for 1 min, the supernatant is discarded, then 1 mL of YPD liquid medium is added, resuspended by blowing, and incubated at 30°C, 220 rpm on a shaker for 60 min;
[0109] (8) The product of step (7) is centrifuged at 13000 rpm for 1 min, the supernatant is discarded, then 1 mL of 1x TE is added to resuspend, centrifuged at 13000 rpm for 1 min, the supernatant is discarded, and 100 μL of 1x TE is added to the bacterial solution, which is then plated on a SD-URA solid plate and incubated for 3-4 d.
[0110] 4. CRISPRi and SCRaMBLE mutant library construction
[0111] (1) Method for constructing CRISPRi mutant library
[0112] The gRNA plasmid of the CRISPRi library is transformed into a Saccharomyces cerevisiae strain by a LiAc-mediated chemical transformation method, wherein 100 μL of competent cells are added to 2 μg of the gRNA plasmid library, 10 tubes are prepared, and 3 mL of YPD liquid medium corresponding to the resistance G418 is added to each tube, which is incubated at 30°C, 220 rpm for 3 d, then 1 mL of bacterial solution is taken from each of the 10 tubes into 50 mL of YPD+G418 liquid medium, which is incubated at 30°C, 220 rpm for 24 h to obtain the CRISPRi mutant library, and 1 mL of bacterial solution is taken to extract plasmids for sequencing analysis, which shows that the gRNA coverage of the mutant library can be as high as 98%.
[0113] (2) Construction of SCRaMBLE mutant library
[0114] The CRE-EBD plasmid capable of expressing CRE enzyme was introduced into a strain, and after screening on an SD-His solid plate, a single colony strain was picked and inoculated in 5 mL of SD-His liquid medium (purchased from Solabio, batch number: S0020-40g) for culture at 30°C and 220 rpm for 24 h, and then inoculated in 50 mL of SD-His liquid medium added with 1 μmol / L β-estradiol at an initial OD of 0.2 for induction culture at 30°C and 220 rpm for 24 h, to construct an SCRaMBLE mutant library of the strain.
[0115] 5. FPP and β-carotene content detection
[0116] (1) FPP content detection
[0117] Bacterial cell collection: 100 mL of bacterial cell culture was collected from 100 mL of YPD liquid medium inoculated with bacterial liquid with an initial OD600 of 0.1 and cultured for 24 h, and stored at -20°C.
[0118] Sample pretreatment: 1 mL of extraction solution (methanol: acetonitrile = 1:1) was added to the above bacterial sample, vortexed and mixed, and then placed in an ultrasonic cleaner for ultrasonic treatment for 10 min, centrifuged at 15000 rcf for 10 min, and 100 μL of supernatant was taken and dried by nitrogen blowing, 100 μL of ultrapure water was added for redissolution, and LC-MS / MS detection was performed.
[0119] LC-MS / MS detection method and parameters: LC-MS / MS detection was used in the present application, the mass spectrometry condition was Full Scan negative mode with a scanning range of 200-400 m / z; the chromatography condition was using mobile phase A: H2O (0.1% NH4OH) and B: ACN (0.1% NH4OH), the chromatography column type was ACQUITY UPLC BEH C18 Column 130Å, 1.7 µm, 2.1 mm X 100 mm, the column temperature was 40°C, the injection amount was 5 μL, the flow rate was 0.3 mL / min, and the elution condition was: 0 min for A:B = 90:10 v / v, 0.5 min for A:B = 90:10 v / v, 1 min for A:B = 60:40 v / v, 3.5 min for A:B = 5:95 v / v, 4.1 min for A:B = 5:95 v / v, 4.5 min for A:B = 90:10 v / v, and 7 min for A:B = 90:10 v / v.
[0120] (2) β-carotene content detection
[0121] Bacterial cell collection: a. Centrifuge 1 mL of bacterial solution at 1000 g for 10 min at 4℃, and discard the supernatant; b. Quench the bacterial cells in liquid nitrogen for 30 s, and thaw on ice; c. Wash the bacterial cells with 1 mL of 4℃ pre-cooled 1x PBS buffer; d. Centrifuge at 1000 g for 10 min, and discard the supernatant; e. Centrifuge at 12000 rpm for 1 min, and remove the excess liquid to obtain the bacterial cells for mass spectrometry;
[0122] Sample pretreatment: a. Add 200 μg of 0.5 mm glass beads and 1 mL of acetone to the bacterial cells to resuspend the bacterial cells; b. Vortex in the dark for 20 min until the cells are colorless; c. Centrifuge at 13000 rpm for 10 min, and take 10 μL of the supernatant; d. Dry with nitrogen, and then add 100 μL of methanol for redissolution before machine detection.
[0123] Beta-carotene detection method and parameters: The present application adopts HPLC detection, uses a YMC Carotenoid S-3 μm (150*4.6mm) liquid chromatography column, the sample amount is 5 μL, the column temperature is 40℃, the detection wavelength is 450 nm, the mobile phase A (MeOH), the mobile phase B (MeOH:MTBE:H2O=20:75:5), the flow rate is 1.0 mL / min, and the elution gradient is 0 min A:B (100:0 v / v), 15 min A:B (39:61 v / v), 25 min A:B (0:100 v / v), 25.1 min A:B (100:0 v / v), and 30 min A:B (100:0 v / v).
[0124] Example 2
[0125] 1. Construction of a chassis strain with different FPP content
[0126] The FPP content of the strains 2369R, 2R and 2RH was detected by the LC-MS / MS method in Reference Example 1, and the results are shown in Table 1. Figure 3 Knocking out the gene ROX1 based on the initial chassis strain 2369R can increase the content of FPP, and overexpressing the gene tHMG1 based on this can significantly increase the concentration of FPP, and the FPP content concentration can reach 412 ng / L, which is 1.27 times higher than that of the initial 2369R chassis strain.
[0127] 2. Construction of a beta-carotene synthesis path in a strain with different FPP content
[0128] Referring to the method in Example 1, a β-carotene heterologous synthesis pathway was constructed on the strains 2369R, 2R and 2RH, that is, strains 2-EYBI, 2R-EYBI and 2RH-EYBI were obtained, and the obtained strains were cultured according to the method in Example 1. The constructed strains expressed β-carotene content as shown in FIG. Figure 4 As shown, the higher the FPP content of the strain, the higher the β-carotene content it expresses, which indicates that the β-carotene content is proportional to the FPP content, and the β-carotene content can be used to characterize the changes in the FPP content of the chassis strain.
[0129] 3. Flow cytometric analysis of the constructed strain and its mutant library strain
[0130] (1) Flow cytometric analysis of strains 2369R and 2-EYBI
[0131] Take 1 mL of the 2369R and 2-EYBI culture solution described in Example 1, centrifuge at 12000 rpm for 1 min, resuspend the bacteria in 1 mL 1X sterile PBS, remove the supernatant by centrifugation, resuspend the bacteria in 1X sterile PBS, and dilute the bacteria solution to an OD600 of about 0.2-0.5 before transferring the bacteria solution to a flow cytometer. The results of flow cytometer analysis are as follows: Figure 5 As shown, the results showed that the fluorescence signal of the β-carotene-producing strain 2-EYBI was stronger than that of the non-β-carotene-producing strain 2369R, indicating that β-carotene can spontaneously emit green fluorescence and has the conditions to be used as a high-throughput screening probe.
[0132] (2) Flow cytometric analysis of the constructed CRISPRi library strain
[0133] According to the method described in Example 1, 2RH-EYBI was used as the chassis strain and the CRISPRi plasmid library was transferred to obtain the 2RH-EYBI-CRISPRi mutant library, which was then subjected to flow cytometry analysis. The flow cytometry results were as follows: Figure 6 As shown. Figure 6 It can be seen that after the strain 2RH-EYBI was transformed with the CRISPRi library, the fluorescence signal shifted to the left, that is, the fluorescence signal weakened, which indicates that the single-gene inhibition library of CRISPRi tends to weaken the expression of β-carotene.
[0134] (3) Flow cytometric analysis of the SCRaMBLE mutant library constructed from strain 2RH-EYBI
[0135] According to Example 1, using 2RH-EYBI as the base strain, by introducing CRE enzyme and adding β-estradiol for induction, a mutant library 2RH-EYBI-CRE-Induce with chromosomal structural variation was obtained. The flow cytometry results were as follows:Figure 7 As shown. Figure 7 It can be seen that the fluorescence effect of strain 2RH-EYBI was significantly enhanced after SCRaMBLE mutagenesis, which indicates that the random chromosome mutation caused by the SCRaMBLE system helps to increase the β-carotene content. The flow sorting module can collect and culture single-cell strains with strong fluorescence signals, thus laying the foundation for subsequent gene target mining research.
[0136] In the description of this specification, reference to the terms "one embodiment," "some embodiments," "an embodiment," or "a specific embodiment" means that the specific features, structures, materials, or characteristics described in conjunction with the embodiment are included in at least one embodiment of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment. Moreover, the specific features, structures, materials, or characteristics described can be combined in any suitable manner in any one or more embodiments. In addition, those skilled in the art may combine and combine different embodiments and features of different embodiments described in this specification without any contradiction.
[0137] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.
Claims
1. Use of a recombinant microorganism in screening high-yield FPP-related targets, characterized in that: The purposes described are: (1) constructing a mutant library of the recombinant microorganism, wherein the mutant library includes at least one of a single gene suppressor mutant library and a random mutant library; (2) Using a β-carotene probe, the recombinant microorganism and its mutant library are screened through a high-throughput platform to obtain the target, Among them, the strain in the mutant library that has a fluorescence value significantly different from that of the recombinant microorganism is the target strain, and the mutant gene carried by the target strain is the target point. The recombinant microorganism heterologously expresses: CrtE gene, CrtYB gene and CrtI gene, the ROX1 gene in the recombinant microorganism is silenced, and the recombinant microorganism overexpresses the HMG1 gene truncation, wherein: The CrtE gene has the nucleotide sequence shown in SEQ ID NO: 2; The CrtYB gene has the nucleotide sequence shown in SEQ ID NO: 3; The CrtI gene has the nucleotide sequence shown in SEQ ID NO: 4; The HMG1 gene truncation is the nucleotide sequence shown in SEQ ID NO: 1; The CrtE gene is derived from Sulfolobus acidocaldarius, The CrtYB gene is derived from Blakeslea trispora, The CrtI gene is derived from Blakeslea trispora, The recombinant microorganism is Saccharomyces cerevisiae.
2. A method for screening high-yield FPP-related target points, characterized in that, The method is: (1) constructing a mutant library of a recombinant microorganism, wherein the mutant library comprises at least one of a single gene suppressor mutant library and a random mutant library; (2) Using a β-carotene probe, the recombinant microorganism and its mutant library are screened through a high-throughput platform to obtain the target, Among them, the strain in the mutant library that has a fluorescence value significantly different from that of the recombinant microorganism is the target strain, and the mutant gene carried by the target strain is the target point. The recombinant microorganism heterologously expresses: CrtE gene, CrtYB gene and CrtI gene, the ROX1 gene in the recombinant microorganism is silenced, and the recombinant microorganism overexpresses the HMG1 gene truncation, wherein: The CrtE gene has the nucleotide sequence shown in SEQ ID NO: 2; The CrtYB gene has the nucleotide sequence shown in SEQ ID NO: 3; The CrtI gene has the nucleotide sequence shown in SEQ ID NO: 4; The HMG1 gene truncation is the nucleotide sequence shown in SEQ ID NO: 1; The CrtE gene is derived from Sulfolobus acidocaldarius, The CrtYB gene is derived from Blakeslea trispora, The CrtI gene is derived from Blakeslea trispora, The recombinant microorganism is Saccharomyces cerevisiae.
3. The method of claim 2, wherein, The single gene suppression mutant library is a single gene suppression CRISPRi mutant library, or the random mutant library is a SCRaMBLE mutant library.
4. The method of claim 2, wherein, The single gene suppressor mutant library is obtained by the following method: transferring gRNA plasmids of the CRISPRi mutant library into the recombinant microorganism, and culturing at 30-35 DEG C in a liquid medium for 48-96 hours, wherein the mass / volume ratio of the gRNA plasmids of the CRISPRi mutant library and the bacterial liquid of the recombinant microorganism is 1:50; and / or the random mutant library is obtained by: transferring a plasmid carrying a CRE enzyme coding fragment into the recombinant microorganism, and inducing culture in a 30-35 DEG C SD-His medium containing beta-estradiol for 12-48 h.
Citation Information
Patent Citations
Biosynthetic genes of blakeslea trispora beta-carotene that code for lycopene cyclase / phytoene synthase (carRP) and phytoene dehydrogenase (carB)
CN1558953A