PtrSAUR32 gene and application thereof in enhancing growth of citrus root system

Abstract

The invention discloses a PtrSAUR32 gene and application of the PtrSAUR32 gene in enhancing the growth of a citrus root system, relates to the field of agricultural biological genes, and solves the technical problem that a technical blank exists in the aspect of regulating and controlling the growth of the citrus root system by using SAUR in the prior art. The coding sequence of the PtrSAUR32 gene is a nucleotide sequence as shown in SEQ ID NO.1, the coding sequence of the PtrSAUR32 gene is cloned, a PtrSAUR32 overexpression vector is constructed, the PtrSAUR32 overexpression vector is subjected to genetic transformation, and a transgenic plant with enhanced root growth is obtained through identification; on the basis of PtrSAUR32 overexpression, the expression level of PtrSAUR32 is improved, a transgenic citrus plant with enhanced root growth is obtained, the root length of the plant is remarkably higher than that of a control plant, and the method has great application value for improving citrus rootstocks and enhancing citrus stress resistance.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological gene technology, and in particular to a PtrSAUR32 gene and its application in enhancing the growth of citrus root system. Background Art

[0002] Citrus is the largest fruit in my country, with the largest planting area and yield, and has important economic value. Citrus is mainly propagated by grafting. Excellent rootstocks can promote early fruiting and high yield of citrus, improve the yield and quality of citrus fruit, enhance citrus disease resistance and adaptability to environmental stress (Snoussi et al. 2012). The root system of the rootstock is the first organ to perceive changes in the soil environment, and then regulate the growth and development of the root system and water absorption and transportation to enhance the plant's resistance to adversity (Pan Xiaodi et al. 2017). In an adverse environment, the root system usually grows to areas with higher water availability and away from the soil layer with the most severe stress. For example, in a drought environment, the root system usually grows deep into the soil, and the deeper root system can effectively capture deep soil water to respond to drought stress (Karlova et al. 2021). Therefore, the morphological structure of the root system has an important influence on the growth and development and stress resistance of the plant.

[0003] Root system architecture (RSA) refers to the spatial shape and soil distribution of the root system, which is mainly determined by root growth, lateral root branching and root angle, and has strong plasticity (Lavenus et al. 2013). RSA is regulated by many factors, among which plant hormones such as auxin, cytokinin, ethylene, abscisic acid and gibberellin are involved in regulating the growth and development of plant roots (Guo Jin et al. 2014).

[0004] SAUR (Small auxin up-regulated RNA) is the largest class of early auxin response genes, which play an important role in regulating cell expansion, leaf growth and senescence, and root growth and development (Ren and Gray 2015; Wang Fusheng et al. 2020). For example, in Arabidopsis, AtSAUR15 promotes lateral root and adventitious root development (Yin et al. 2020). AtSAUR76 plays an active role in Arabidopsis root elongation growth (Markakis et al. 2013). Heterologous expression of cherry PavSAUR55 in Arabidopsis significantly increased root length (Hou et al. 2023).

[0005] However, in the current reports, there is no research and application on the regulation of citrus root growth by SAUR. Summary of the invention

[0006] The present invention is intended to solve the technical problem that there is a technical gap in the prior art in using SAUR to regulate the growth of citrus root systems. The purpose is to provide a PtrSAUR32 gene and its application in enhancing the growth of citrus root systems. By overexpressing the PtrSAUR32 gene and increasing the expression level of PtrSAUR32, a transgenic citrus strain with enhanced root growth is obtained, which has great application value for enhancing the stress resistance of citrus.

[0007] The present invention is achieved through the following technical solutions:

[0008] The first object of the present invention is to provide a PtrSAUR32 gene, wherein the coding sequence of the PtrSAUR32 gene is the nucleotide sequence shown in SEQ ID NO.1.

[0009] The second object of the present invention is to provide a citrus early auxin response protein, which is encoded by the aforementioned PtrSAUR32 gene. The protein encoded by the PtrSAUR32 gene provided by the present invention is a citrus early auxin response protein, which plays an important role in regulating cell expansion, leaf growth and senescence, and root growth and development.

[0010] The third object of the present invention is to provide an application of a PtrSAUR32 gene or a citrus early auxin response protein in enhancing the growth of citrus root system.

[0011] Furthermore, the specific application method is:

[0012] (1) Cloning the PtrSAUR32 gene coding sequence;

[0013] (2) Construction of PtrSAUR32 overexpression vector;

[0014] (3) The PtrSAUR32 overexpression vector was used to genetically transform citrus, and transgenic plants with enhanced root growth were identified.

[0015] The present invention integrates a citrus auxin early response gene into citrus through an expression vector, and based on the overexpression of PtrSAUR32, increases the expression level of PtrSAUR32, thereby obtaining transgenic citrus plants with enhanced root growth, effectively enhancing the root growth of citrus, which has great application value for enhancing the stress resistance of citrus.

[0016] Furthermore, in step (1), the cloning method of the PtrSAUR32 gene coding sequence is:

[0017] Extract total RNA from citrus, then reverse transcribe it into cDNA. Using the cDNA as a template, perform PCR amplification with the forward primer OE-PtrSAUR32-F and the reverse primer OE-PtrSAUR32-R, and recover the DNA fragment encoding the PtrSAUR32 gene sequence;

[0018] The primers OE-PtrSAUR32-F and OE-PtrSAUR32-R have the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3 respectively.

[0019] Furthermore, in step (2), the method for constructing the PtrSAUR32 overexpression vector is as follows:

[0020] Recombine the recovered DNA fragment encoding the PtrSAUR32 gene sequence onto the PFGC5941M3F-FN vector digested and recovered with BamHI / SmiI to construct the overexpression vector PFGC5941M3F-PtrSAUR32.

[0021] Furthermore, in step (3), the method for genetically transforming citrus with the PtrSAUR32 overexpression vector is as follows:

[0022] The overexpression vector PFGC5941M3F-PtrSAUR32 is transformed into Agrobacterium tumefaciens by electroporation, and then the Agrobacterium-mediated method is used to transform citrus explants. The genetically transformed explants are identified for GFP fluorescence using a handheld fluorescent lamp, PCR identification, and qRT-PCR analysis of the PtrSAUR32 expression level to obtain transgenic plants.

[0023] Furthermore, the primers for PCR identification of transgenic plants are ID-PtrSAUR32-F and ID-PtrSAUR32-R. The ID-PtrSAUR32-F and ID-PtrSAUR32-R are a segment of the sequence taken from the PFGC5941M3F-FN vector and have the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.

[0024] Furthermore, the primers for qRT-PCR analysis of the PtrSAUR32 expression level are RT-PtrSAUR32-F and RT-PtrSAUR32-R. The RT-PtrSAUR32-F and RT-PtrSAUR32-R have the nucleotide sequences shown in SEQ ID NO.6 and SEQ ID NO.7 respectively.

[0025] Furthermore, after obtaining transgenic plants in step (3), the transgenic plants are cuttaged and rooted to determine that the overexpression of PtrSAUR32 enhances the root growth of citrus cuttings.

[0026] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0027] 1. The present invention clones the coding sequence of the citrus PtrSAUR32 gene, constructs an overexpression vector, and then genetically transforms the citrus. Based on the overexpression of PtrSAUR32, the expression level of PtrSAUR32 is increased, and transgenic citrus plants with enhanced root growth are obtained.

[0028] 2. The root length of the transgenic plant cuttings obtained in the present invention can be increased by up to 42.7% compared with the WT control group, which effectively proves that the present invention can significantly enhance the growth of citrus root length based on PtrSAUR32 overexpression, which has great application value for improving citrus rootstocks and enhancing citrus stress resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings:

[0030] Figure 1 : The bioinformatics characteristics of the PtrSAUR32 gene of the present invention, wherein A is the gene structure of citrus PtrSAUR32; B is a multiple sequence alignment of PtrSAUR32 homologous proteins, with the red line marking the SAUR conserved domain; C is the evolutionary development tree of the PtrSAUR32 gene;

[0031] Figure 2 The electrophoresis diagram of PCR amplification of the PtrSAUR32 gene clone of the present invention, wherein M represents a DNA molecular weight standard;

[0032] Figure 3 This is a schematic diagram of the structure of the PtrSAUR32 overexpression vector of the present invention;

[0033] Figure 4 This is a diagram of the genetic transformation process of citrus in Example 4 of the present invention;

[0034] Figure 5 This is a PCR identification diagram of the transgenic plant of the present invention, wherein M represents a DNA molecular weight standard, and WT represents a wild-type plant;

[0035] Figure 6This is the analysis diagram of the expression level of PtrSAUR32 in the leaves of the transgenic plants of the present invention. Among them, WT represents the wild-type plants, * indicates extremely significant difference compared with WT (P≤0.05), and OE-1 and OE-3 respectively represent different transgenic plants;

[0036] Figure 7 This is the phenotypic diagram of the roots of the transgenic plants of the present invention;

[0037] Figure 8 This is the statistical diagram of the root length of the transgenic plants of the present invention. Among them, WT represents the wild-type plants, * indicates extremely significant difference compared with WT (P≤0.05), and OE-1 and OE-3 respectively represent different transgenic plants. Detailed implementation manners

[0038] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are some, rather than all, of the embodiments of the present invention.

[0039] Hereinafter, the detailed implementation manners of a PtrSAUR32 gene of the present invention and its application in enhancing the root growth of citrus will be described in detail with appropriate reference to the accompanying drawings. However, there will be cases where unnecessary detailed descriptions are omitted. For example, there are cases where detailed descriptions of well-known matters and repeated descriptions of actually identical contents are omitted. This is to avoid the following descriptions from becoming unnecessarily lengthy and to facilitate the understanding of those skilled in the art.

[0040] In addition, the accompanying drawings and the following descriptions are provided for those skilled in the art to fully understand the present application, and are not intended to limit the subject matter recited in the claims.

[0041] The following detailed descriptions of the embodiments are not intended to limit the scope of the present invention claimed, but merely represent selected embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0042] The technical solutions of the present invention will be further described in detail below in conjunction with the embodiments.

[0043] It should be noted that in the embodiments of the present invention, trifoliate orange is used as the test object. In actual applications, this method can also be used to improve the roots of other citrus rootstocks. The experimental methods used in the embodiments are all conventional methods unless otherwise specified. The materials, reagents, methods and instruments used, unless otherwise specified, are all conventional materials, reagents, methods and instruments in the art, and those skilled in the art can obtain them through commercial channels.

[0044] Example 1

[0045] Bioinformatics Analysis of PtrSAUR32 Gene in Citrus

[0046] The citrus PtrSAUR32 gene has only one exon and no intron structure. Its CDS is 336 bp in length and encodes 111 amino acids, which is consistent with most SAUR proteins. PtrSAUR32 contains a SAUR conserved domain. The phylogenetic tree shows that PtrSAUR32 is closely related to PtSAUR14 in poplar (e.g. Figure 1 shown).

[0047] The PtrSAUR32 gene provided by the present invention has a nucleotide sequence as shown in SEQ ID NO.1, and the encoded protein is a citrus auxin early response protein. The prior art shows that this auxin early response gene plays an important role in regulating cell expansion, leaf growth and senescence, and root growth and development. Based on this, the inventors have found through a large number of research experiments that by overexpressing the PtrSAUR32 gene having a nucleotide sequence as shown in SEQ ID NO.1 and increasing the expression level of the PtrSAUR32 gene, a transgenic citrus strain with enhanced root growth can be obtained, and experiments have proved that this transgenic citrus strain can significantly enhance the growth of citrus root length, which has great application value for improving citrus rootstocks and enhancing citrus stress resistance.

[0048] The following examples are specific experimental procedures.

[0049] Example 2

[0050] Cloning of the coding sequence of the citrus PtrSAUR32 gene

[0051] 1. RNA Extraction and cDNA Synthesis

[0052] Total RNA from citrus (Prunus dulcis) leaves was extracted using the EASYspinPlus Plant RNA Rapid Extraction Kit (RN38, Adelaide). RNA quality was verified by agarose gel electrophoresis and its concentration was measured using a concentration meter. TM cDNA was synthesized using Master Mix (M16325, Thermo Fisher Scientific).

[0053] 2. PCR amplification of the coding sequence of PtrSAUR32 gene

[0054] The PtrSAUR32 encoding DNA fragment was amplified from citrus cDNA using primers OE-PtrSAUR32-F (SEQ ID NO. 2), OE-PtrSAUR32-R (SEQ ID NO. 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The fragment length was 336 bp ( Figure 2 The agarose gel containing the PtrSAUR32 fragment was cut out under ultraviolet light, and the DNA fragment was recovered using a Biospin gel recovery kit (BioFlux, BSC02M1). The amplified DNA fragment was determined to be the coding sequence of the citrus PtrSAUR32 gene (SEQ ID NO.1) by sequencing.

[0055] PCR amplification program: 98°C, 3 min; 98°C, 10 s, 60°C, 15 s, 72°C, 25 s, 35 cycles; extension at 72°C for 10 min.

[0056] Example 3

[0057] Construction of PtrSAUR32 overexpression vector and transformation of Agrobacterium

[0058] 1. Construction of overexpression vector

[0059] The PtrSAUR32 gene coding sequence DNA fragment and the overexpression vector PFGC5941M3F-FN were digested with restriction endonucleases BamHI and SmiI (ThermoFisher) and recovered, and the recombination reaction was carried out at 50°C using homologous recombinase (ThermoFisher, 639649). The recombinant product was transformed into Escherichia coli DH5α by heat shock method, and the plasmid of the positive clone was extracted using the plasmid extraction kit EZNATM Plasmid Mini Kit (Omega, CAT: D6943) to obtain the PtrSAUR32 overexpression vector PFGC5941M3F-PtrSAUR32 (such as Figure 3 shown).

[0060] 2. Transformation of Agrobacterium with Overexpression Vector

[0061] PFGC5941M3F-PtrSAUR32 was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: the competent cell EHA105 is melted on ice, 50 μL of the competent cell is drawn to the bottom of the previously dried and pre-cooled electroporation cup, 2.5 μL of PFGC5941M3F-PtrSAUR32 plasmid is added and mixed by pipetting, the electroporation instrument mode is adjusted to AGR, the electroporation cup is placed in the electroporation tank and the click button is pressed; 600 μL of LB liquid culture medium without antibiotics is added to the electroporation cup, mixed by pipetting, and transferred to a 1.5 mL sterile centrifuge tube, and cultured in a shaking incubator at 28° C. and 220 r / min for 2-3 h; centrifuged at 6000 r / mi for 5 min, discarded part of the supernatant, resuspended and coated on LB solid culture medium containing 50 mg / L Kana, and inverted and darkly cultured at 28° C. for 2 days; after the growth of bacterial plaques, primers OE-PtrSAUR32-F (SEQ ID NO.2) and OE-PtrSAUR32-R (SEQ ID NO.3) Perform PCR verification on single colonies and store them in an ultra-low temperature refrigerator.

[0062] PCR reaction conditions: 95°C for 5 min; 95°C for 10 s, 55°C for 10 s, 72°C for 25 s, 35 cycles; 72°C for 10 min.

[0063] Example 4

[0064] Genetic transformation of citrus with PtrSAUR32 overexpression vector

[0065] 1. Obtaining epicotyls of citrus seedlings

[0066] The ripe citrus fruits were washed and surface disinfected with 75% alcohol. The seeds were taken out under sterile conditions and the inner and outer seed coats were peeled off. The seeds were germinated on seed germination medium (MS), cultured in the dark at 28°C for 4 weeks, and then cultured under 16 h light / 8 h dark conditions for 1 week. The epicotyls of the seedlings were cut obliquely into 1 cm stem segments under sterile conditions, and the stem segments were placed in MS liquid culture medium for standby use.

[0067] 2. Preparation of Agrobacterium tumefaciens

[0068] Before transfection, Agrobacterium (containing PFGC5941M3F-PtrSAUR32 plasmid) stored in an ultra-low temperature refrigerator was streaked on LB solid medium containing 50 mg / L Kana and cultured at 28°C for 2 days. A single colony was picked and placed in LB liquid medium containing the same antibiotics and cultured overnight at 28°C with shaking. The bacterial solution was diluted 1:100 and continued to be cultured until OD 600 =0.5, centrifuge at 5000r / min for 10min, discard the supernatant, and resuspend the bacteria in MS liquid culture medium to OD600=0.5.

[0069] 3. Transformation of Citrus Epicotyls

[0070] Place the citrus stem segments in the prepared bacterial suspension and infect for 10-12 minutes, then wipe dry. Transfer the stem segments to the co-cultivation medium and culture them in the dark at 26°C for 3 days. After the co-cultivation is completed, transfer the epicotyls to the screening medium and culture them in the dark at 28°C for 14 days. Culture the epicotyls at 28°C, 16h light / 8h dark conditions, subculture every two weeks, and then use a handheld fluorescent lamp to identify GFP fluorescence.

[0071] 4. Seedling Culture of Transformants

[0072] When the young shoots grow to more than 1 cm, they are cut off and grafted onto a 1-2 month old trifoliate orange rootstock; when the seedlings grow to about 5 cm, they are grafted onto a 2-year-old Ziyang orange rootstock.

[0073] Operation process as Figure 4 shown.

[0074] The culture medium used in this embodiment is as follows:

[0075] Seed germination medium: MS + 30g / L sucrose + 3.5g plant gel, pH 5.8.

[0076] Co-culture medium: MS + 30 g / L sucrose + 3.5 g phytagel + 1 mg / L 6-BA + 0.5 mg / L NAA + 100 μM AS, pH 5.8.

[0077] Screening medium: MS+30g / L sucrose+3.5g phytagel+1mg / L 6-BA+0.5mg / L NAA+10mg / LG418+500mg / L Carb, pH 5.8.

[0078] Example 5

[0079] Verification of PtrSAUR32 overexpressing transgenic plants

[0080] 1. GFP and PCR identification of transgenic plants

[0081] After the graft survived, the GFP fluorescence of the transgenic seedlings was identified using a handheld fluorescent lamp. The positive plants showed green fluorescence (such as Figure 4 The leaves of the transgenic plants obtained in the initial screening (containing GFP fluorescence) were ground in liquid nitrogen, and genomic DNA was extracted according to the CTAB method. PCR was used to detect the integration of the PtrSAUR32 coding sequence in the citrus genome. The detection primers were ID-PtrSAUR32-F (SEQ ID NO.4) and ID-PtrSAUR32-R (SEQ ID NO.5). The positive plants could obtain amplified fragments, while the WT control plants had no bands (as shown in Figure 2). Figure 5shown).

[0082] PCR reaction conditions: 95°C for 5 min; 95°C for 10 s, 55°C for 10 s, 72°C for 25 s, 35 cycles; 72°C for 10 min.

[0083] 2. qRT-PCR Analysis of Transgenic Plants

[0084] The leaves of the transgenic plants identified by GFP and PCR were ground, and the total RNA of the leaves of the transgenic plants was extracted according to the kit EASYspinPlus Plant RNA Kit (RN38, Adlai), and the reverse transcription kit RevertAid TM Master Mix (M16325, Thermo Fisher Scientific) was used to synthesize cDNA, and the expression of the target gene was detected by qRT-PCR. The detection primers were RT-PtrSAUR32-F (SEQ ID NO.6) and RT-PtrSAUR32-R (SEQ ID NO.7). -△△Ct The relative expression level of PtrSAUR32 gene in transgenic plants was calculated by this method.

[0085] The results are as follows Figure 6 As shown, from Figure 6 It can be seen that the expression level of the PtrSAUR32 gene in transgenic plants is significantly higher than that in WT wild-type plants.

[0086] qRT-PCR reaction conditions: 95°C for 30 s, 95°C for 15 s, 58°C for 30 s, for 40 cycles.

[0087] Example 6

[0088] Identification of root phenotypes of PtrSAUR32 overexpressing transgenic plants

[0089] After the transgenic plants were grafted onto 2-year-old Ziyang orange rootstocks for 2-3 months, the branches were cut into 3-5 cm segments and rooted in vermiculite. The rooting temperature was 23-25°C. After 20 days, the root length of the cuttings was counted.

[0090] The root phenotype of the transgenic plants is shown in Figure 2. Figure 7 As shown, from Figure 7 It can be seen that compared with the WT wild-type plants, the main root length of the plants overexpressing the PtrSAUR32 gene is significantly longer. The root length statistics are shown in the figure below. Figure 8 As shown, from Figure 8 It can be seen that the root length of OE-1 cuttings increased by 42.7% compared with the WT control group, and the root length of OE-3 cuttings increased by 28.8% compared with the control group.

[0091] This proves that overexpression of the PtrSAUR32 gene can significantly enhance the growth of citrus root length, which has great application value for improving citrus rootstocks and enhancing citrus stress resistance.

[0092] The following is the nucleotide sequence involved in the present invention:

[0093] SEQ ID NO.1 (CDS sequence of PtrSAUR32 gene):

[0094] ATGGGGGGTCAGTTCAAGCAAATTAAGCTGGTTGATTGGAGGTGGAAGAGCTTATTATAAGAGACTCAGAGGGACTAGTAGTTGCAGTACTGCTCAATTGATGACTACTCCGAAAGGTTATGTGCCAATTTGTGTTGGTTTGGGCAATGATACAAAGCTTTTTATTGTT CGCACAACAGCACTCGGCGATGCTGATTTCTTGCAGTTTCCTGTAAATCTGCCGAGGAATATGGCTTCTGTAATGAAGGAATTTTGAGGATCCCATGTGAAGCTGAAGCGTTCGAAGATTGGATGATTAGAAGAGCCAATCACAAGTTTAGAGTTAAAACAGTTTAG

[0095] SEQ ID NO.2 (CDS cloning forward primer OE-PtrSAUR32-F, containing restriction site SmiI):

[0096] GCCCAATCGATGATTTAAATATGGGGGTCAGTTCAAGCAA

[0097] SEQ ID NO.3 (CDS cloning reverse primer OE-PtrSAUR32-R, containing restriction site BamHI):

[0098] CTCTAGACTCACCTAGGATCCCTAAACTGTTTTAACTCTAAACTTG

[0099] SEQ ID NO.4 (transgenic plant PCR identification forward primer ID-PtrSAUR32-F):

[0100] CACGCTCGAGTATAAGAGCTCT

[0101] SEQ ID NO.5 (reverse primer ID for PCR identification of transgenic plants-PtrSAUR32-R):

[0102] GGACTAGTCCCGGGTCTTAAT

[0103] SEQ ID NO.6 (RT-PCR identification of transgenic plants forward primer RT-PtrSAUR32-F):

[0104] TGGTTTGGGCAATGATACAAAG

[0105] SEQ ID NO.7 (RT-PCR identification of transgenic plants reverse primer RT-PtrSAUR32-R):

[0106] ACATGGGATCCTCAAAATTCCT

[0107] Finally, it should be noted that the above specific embodiments are only used to explain in detail the purpose, technical solutions and beneficial effects of the present invention. It should be understood that the above description is only a specific implementation method of the present invention and is not used to limit the protection scope of the present invention. Although the present invention is described in detail with reference to the above specific embodiments, ordinary technicians in this field should understand that it is still possible to modify the technical solutions recorded in the above embodiments, or to replace or improve some or all of the technical features therein. These modifications, equivalent replacements and improvements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be included in the scope of the claims and description of the present invention.

Claims

1. A PtrSAUR32 gene, characterized in that The PtrSAUR32 gene coding sequence is the nucleotide sequence shown in SEQ ID NO.

1.

2. A citrus early auxin response protein, characterized in that Encoded by the PtrSAUR32 gene described in claim 1.

3. Use of the PtrSAUR32 gene as described in claim 1 or the citrus early auxin response protein as described in claim 2 in enhancing citrus root growth.

4. The use according to claim 3, characterized in that: The specific application method is: (1) Cloning the PtrSAUR32 gene coding sequence; (2) Construction of PtrSAUR32 overexpression vector; (3) The PtrSAUR32 overexpression vector was used to genetically transform citrus, and transgenic plants with enhanced root growth were identified.

5. The use according to claim 4, characterized in that: In step (1), the cloning method of the PtrSAUR32 gene coding sequence is: Total RNA was extracted from citrus, and then reverse transcribed into cDNA. Using cDNA as template, PCR amplification was performed using forward primer OE-PtrSAUR32-F and reverse primer OE-PtrSAUR32-R to recover the PtrSAUR32 gene coding sequence DNA fragment. The primers OE-PtrSAUR32-F and OE-PtrSAUR32-R have the nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO.3, respectively.

6. The use according to claim 5, characterized in that: In step (2), the method for constructing the PtrSAUR32 overexpression vector is as follows: The recovered PtrSAUR32 gene coding sequence DNA fragment was recombined into the PFGC5941M3F-FN vector recovered by BamHI / SmiI digestion to construct the overexpression vector PFGC5941M3F-PtrSAUR32.

7. The use according to claim 6, characterized in that: In step (3), the method for genetically transforming citrus with the PtrSAUR32 overexpression vector is as follows: The overexpression vector PFGC5941M3F-PtrSAUR32 was transformed into Agrobacterium tumefaciens by electroporation, and then transformed into citrus explants by Agrobacterium-mediated method. The explants after genetic transformation were identified by handheld fluorescent lamp for GFP fluorescence, PCR identification, and qRT-PCR analysis for PtrSAUR32 expression to obtain transgenic plants.

8. The use according to claim 7, characterized in that: The primers for PCR identification of transgenic plants are: ID-PtrSAUR32-F and ID-PtrSAUR32-R. The ID-PtrSAUR32-F and ID-PtrSAUR32-R are taken from a sequence on the PFGC5941M3F-FN vector and have the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

9. The use according to claim 7, characterized in that: The primers for qRT-PCR analysis of the expression amount of PtrSAUR32 are: RT-PtrSAUR32-F and RT-PtrSAUR32-R, and the RT-PtrSAUR32-F and RT-PtrSAUR32-R have the nucleotide sequences shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.

10. The use according to claim 4, characterized in that: After the transgenic plants are obtained in step (3), the transgenic plants are rooted by cuttings to determine whether the overexpression of PtrSAUR32 enhances the root growth of citrus cuttings.

Images