Ptrsaury32 gene and application in enhancing citrus root growth

By cloning and overexpressing the PtrSAUR32 gene, the technical gap in the regulation of citrus root growth was filled, resulting in a significant increase in citrus root length and stress resistance.

CN120026033BActive Publication Date: 2025-11-25SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510248058.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-04
Publication Date
2025-11-25
Estimated Expiration
2045-03-04

AI Technical Summary

Technical Problem

There is currently no research or application of the SAUR gene in regulating citrus root growth, resulting in a technological gap in improving citrus root growth and stress resistance.

Method used

By cloning the PtrSAUR32 gene, an overexpression vector was constructed and genetically transformed into citrus, thereby increasing the expression level of PtrSAUR32 and enhancing citrus root growth.

Benefits of technology

It significantly enhances the root length of citrus trees and improves their resistance to adverse conditions, thus possessing significant application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120026033B_ABST
    Figure CN120026033B_ABST
Patent Text Reader

Abstract

The application discloses a PtrSAUR32 gene and application thereof in enhancing growth of citrus root, relates to the field of agricultural biological genes, and solves the technical problem of a technical blank in the prior art in regulating growth of the citrus root by using SAUR; the coding sequence of the PtrSAUR32 gene is a nucleotide sequence as shown in SEQ ID NO.1; the transgenic plant with enhanced root growth is obtained by cloning the coding sequence of the PtrSAUR32 gene, constructing a PtrSAUR32 overexpression vector, genetically transforming the citrus by using the PtrSAUR32 overexpression vector, and identification; the application improves the expression level of the PtrSAUR32 based on the PtrSAUR32 overexpression, and obtains the transgenic citrus plant with enhanced root growth; the root length of the plant is significantly higher than that of a control plant, and the plant has great application value in improving the citrus rootstock and enhancing the stress resistance of the citrus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of agricultural biological gene technology, and particularly relates to a PtrSAUR32 gene and application thereof in enhancing growth of citrus root systems. BACKGROUND

[0002] Citrus is mainly propagated by grafting, and excellent rootstocks can promote early fruiting of citrus, improve yield and quality of citrus fruits, and enhance disease resistance and adaptability to environmental stress of citrus (Snoussi et al. 2012). Root system of rootstock is the first organ to perceive changes in soil environment, and adjusts growth and development of root system and water absorption and transportation to enhance resistance of the plant to adversity (Pan Xiaodi et al. 2017). In adversity environment, root system usually grows to the area with higher water availability, far away from the soil layer with the most serious stress. For example, in drought environment, root system usually grows to the deep soil, and the deeper root system can effectively capture water in the deep soil to respond to drought stress (Karlova et al. 2021). Therefore, morphological structure of root system has important influence on growth and development and stress resistance of the plant.

[0003] Root system architecture (RSA) refers to spatial modeling and soil distribution of root system, and is mainly determined by growth of root system, lateral root branching and root angle, and has strong plasticity (Lavenus et al. 2013). RSA is regulated by multiple factors, and plant hormones such as auxin, cytokinin, ethylene, abscisic acid and gibberellin are involved in regulation of growth and development of plant root system (Guo Jin et al. 2014).

[0004] SAUR (Small auxin up-regulated RNA) is the largest class of early auxin response genes, and plays an important role in regulation of cell swelling, leaf growth and senescence and growth and development of root system (Ren and Gray 2015; Wang Fusen et al. 2020). For example, in Arabidopsis, AtSAUR15 promotes development of lateral roots and adventitious roots (Yin et al. 2020). AtSAUR76 plays a positive role in elongation growth of Arabidopsis root system (Markakis et al. 2013). After heterologous expression of cherry PavSAUR55 in Arabidopsis, the root length is significantly increased (Hou et al. 2023).

[0005] However, in the current reports, there is no research and application of SAUR in regulation of growth of citrus root system. SUMMARY

[0006] The application aims to provide a PtrSAUR32 gene and application of the gene in enhancing growth of citrus roots, and the application has great application value in enhancing stress resistance of the citrus.

[0007] The application achieves the above-mentioned technical solutions by the following technical solutions.

[0008] The first object of the application is to provide a PtrSAUR32 gene, and the coding sequence of the gene is the nucleotide sequence shown in SEQ ID NO. 1.

[0009] The second object of the application is to provide a citrus early auxin response protein, which is encoded by the aforementioned PtrSAUR32 gene. The protein encoded by the PtrSAUR32 gene provided by the application is a citrus early auxin response protein, and plays an important role in regulating cell swelling, leaf growth and aging, and growth and development of roots.

[0010] The third object of the application is to provide application of the PtrSAUR32 gene or the citrus early auxin response protein in enhancing growth of citrus roots.

[0011] Further, the specific application method is as follows.

[0012] (1) cloning a coding sequence of the PtrSAUR32 gene;

[0013] (2) constructing a PtrSAUR32 overexpression vector;

[0014] (3) genetically transforming the citrus with the PtrSAUR32 overexpression vector, and obtaining a transgenic plant with enhanced root growth through identification.

[0015] The application integrates a citrus early auxin response gene into the citrus through an expression vector, improves the expression level of the PtrSAUR32 based on overexpression of the PtrSAUR32, and obtains a transgenic citrus plant with enhanced root growth, which effectively enhances the growth of the roots of the citrus, and has great application value in enhancing stress resistance of the citrus.

[0016] Further, in step (1), the cloning method of the coding sequence of the PtrSAUR32 gene is as follows.

[0017] The total RNA of the citrus is extracted, and then reverse transcribed into cDNA, and the cDNA is used as a template to perform PCR amplification by using a forward primer OE-PtrSAUR32-F and a reverse primer OE-PtrSAUR32-R, and a DNA fragment of a coding sequence of the PtrSAUR32 gene is recovered;

[0018] The primer OE-PtrSAUR32-F and the primer OE-PtrSAUR32-R have the nucleotide sequences as shown in SEQ ID NO. 2 and SEQ ID NO. 3 respectively.

[0019] Further, in the step (2), the construction method of the PtrSAUR32 overexpression vector is as follows:

[0020] The recovered DNA fragment of the coding sequence of the PtrSAUR32 gene is recombined into the PFGC5941M3F-FN vector recovered by the BamHI / SmiI enzyme cutting, and an overexpression vector PFGC5941M3F-PtrSAUR32 is constructed.

[0021] Further, in the step (3), the method for genetically transforming the citrus by using the PtrSAUR32 overexpression vector is as follows:

[0022] The overexpression vector PFGC5941M3F-PtrSAUR32 is transformed into Agrobacterium tumefaciens by using an electric shock method, and then the Agrobacterium tumefaciens is used to transform the citrus explant by using an agrobacterium-mediated method. The transgenic plant is obtained after the genetically transformed explant is identified by using a hand-held fluorescent lamp to identify the GFP fluorescence, PCR identification, and qRT-PCR analysis of the expression amount of PtrSAUR32.

[0023] Further, the primers for PCR identification of the transgenic plant are ID-PtrSAUR32-F and ID-PtrSAUR32-R, and the ID-PtrSAUR32-F and the ID-PtrSAUR32-R are a sequence taken from the PFGC5941M3F-FN vector, and have the nucleotide sequences as shown in SEQ ID NO. 4 and SEQ ID NO. 5 respectively.

[0024] Further, the primers for qRT-PCR analysis of the expression amount of PtrSAUR32 are RT-PtrSAUR32-F and RT-PtrSAUR32-R, and the RT-PtrSAUR32-F and the RT-PtrSAUR32-R have the nucleotide sequences as shown in SEQ ID NO. 6 and SEQ ID NO. 7 respectively.

[0025] Further, after the transgenic plant is obtained in the step (3), the transgenic plant is cut and rooted, and it is determined that the overexpression of PtrSAUR32 enhances the growth of the root system of the cuttings of the citrus.

[0026] Compared with the prior art, the present application has the following advantages and beneficial effects:

[0027] 1. The present application improves the expression level of PtrSAUR32 by cloning the coding sequence of the PtrSAUR32 gene of citrus, constructing an overexpression vector, and then genetically transforming the citrus, based on the overexpression of PtrSAUR32, and obtains transgenic citrus plants with enhanced root growth;

[0028] 2. The root length of the transgenic plant cuttings obtained in the present application can be increased by 42.7% compared with the WT control group, effectively proving that the present application can significantly enhance the growth of the root length of citrus based on the overexpression of PtrSAUR32, which has great application value for improving citrus rootstocks and enhancing the stress resistance of citrus. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present application, the following will briefly introduce the drawings needed in the examples. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be considered as limiting the scope. For those skilled in the art, other related drawings can also be obtained without creative labor. In the drawings:

[0030] Figure 1 Figure 1 is the bioinformatics characteristics of the PtrSAUR32 gene of the present application, wherein A is the structure of the citrus PtrSAUR32 gene; B is the multiple sequence alignment diagram of the PtrSAUR32 homologous protein, and the red line indicates the SAUR conserved domain; C is the evolutionary tree of the PtrSAUR32 gene;

[0031] Figure 2 Figure 2 is the PCR amplification electrophoretogram of the cloning of the PtrSAUR32 gene of the present application, wherein M represents the DNA molecular weight standard;

[0032] Figure 3 Figure 3 is a schematic diagram of the overexpression vector structure of the PtrSAUR32 gene of the present application;

[0033] Figure 4 Figure 4 is a process diagram of the genetic transformation of citrus in Example 4 of the present application;

[0034] Figure 5 Figure 5 is a PCR identification diagram of the transgenic plant of the present application, wherein M represents the DNA molecular weight standard, and WT represents the wild type plant;

[0035] Figure 6Figure for analysis of expression amount of PtrSAUR32 in leaves of transgenic plants of the application, wherein WT represents wild type plants, * represents extremely significant difference (P≤0.05) compared with WT, OE-1 and OE-3 represent different transgenic plants respectively;

[0036] Figure 7 Figure for root system phenotype of transgenic plants of the application;

[0037] Figure 8 Figure for root system length statistics of transgenic plants of the application, wherein WT represents wild type plants, * represents extremely significant difference (P≤0.05) compared with WT, OE-1 and OE-3 represent different transgenic plants respectively. DETAILED DESCRIPTION

[0038] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments.

[0039] Hereinafter, a specific embodiment of a PtrSAUR32 gene and application thereof in enhancing root growth of citrus will be described in detail with appropriate reference to the accompanying drawings. However, there will be cases where unnecessary detailed description is omitted. For example, there will be cases where detailed description of matters known well and repeated description of substantially the same contents are omitted. This is to avoid the following description from becoming unnecessarily lengthy and to facilitate understanding by those skilled in the art.

[0040] In addition, the accompanying drawings and the following description are provided for those skilled in the art to fully understand the present application, and are not intended to limit the subject matter recited in the claims.

[0041] The following detailed description of the embodiments is not intended to limit the scope of the claimed application, but merely represents selected embodiments of the application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without making creative efforts fall within the scope of the present application.

[0042] The technical solutions of the present application will be further described below in combination with the embodiments.

[0043] It should be noted that the embodiments of the present application take the Fructus Aurantii as the test object, and in actual application, the method can also be used to improve the root system of other citrus rootstocks. The experimental methods used in the embodiments are all conventional methods unless otherwise specified. The materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by commercial channels by those skilled in the art.

[0044] Example 1

[0045] Bioinformatics analysis of citrus PtrSAUR32 gene

[0046] The citrus PtrSAUR32 gene has only one exon and does not have an intron structure, and the full length of the CDS is 336 bp, encoding 111 amino acids, which is consistent with most SAUR proteins, PtrSAUR32 contains a SAUR conserved domain, and the phylogenetic tree shows that PtrSAUR32 is relatively close to PtSAUR14 in poplar (as shown in Figure 1 ).

[0047] The PtrSAUR32 gene provided by the application has a nucleotide sequence as shown in SEQ ID NO. 1, and the encoded protein is a citrus auxin early response protein. The prior art shows that this auxin early response gene plays an important role in regulating cell swelling, leaf growth and aging, and root growth and development. Based on this, the inventors found through a large number of research experiments that overexpression of the PtrSAUR32 gene with the nucleotide sequence as shown in SEQ ID NO. 1 can improve the expression level of the PtrSAUR32 gene, and a transgenic citrus strain with enhanced root growth can be obtained, and experiments have proved that the transgenic citrus strain can significantly enhance the growth of the length of the citrus root, which has great application value for improving citrus rootstock and enhancing the stress resistance of citrus.

[0048] The following examples are specific experimental processes.

[0049] Example 2

[0050] Cloning of the coding sequence of the citrus PtrSAUR32 gene

[0051] 1. RNA extraction and cDNA synthesis

[0052] The total RNA of citrus (Donghai Citrus) leaves was extracted according to the kit EASYspinPlus Plant RNA Fast Extraction (RN38, Aidley), the RNA quality was verified by agarose gel electrophoresis, and the concentration was determined by concentration meter. The cDNA was synthesized using the reverse transcription kit RevertAid™ Master Mix (M16325, Thermo);

[0053] 2. PCR amplification of the coding sequence of the PtrSAUR32 gene

[0054] The PtrSAUR32 coding DNA fragment was amplified from the citrus cDNA using primers OE-PtrSAUR32-F (SEQ ID NO. 2), OE-PtrSAUR32-R (SEQ ID NO. 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q), and the length of the fragment was 336 bp (as shown in Figure 2 The agarose gel block containing the PtrSAUR32 fragment was cut under the ultraviolet lamp, and the DNA fragment was recovered using the Biospin gel recovery kit (BioFlux, BSC02M1). Sequencing confirmed that the amplified DNA fragment was the coding sequence of the citrus PtrSAUR32 gene (SEQ ID NO. 1);

[0055] PCR amplification procedure: 98°C, 3 min; 98°C, 10 s, 60°C, 15 s, 72°C, 25 s, 35 cycles; 72°C extension for 10 min.

[0056] Example 3

[0057] Construction of PtrSAUR32 overexpression vector and transformation of Agrobacterium

[0058] 1. Construction of overexpression vector

[0059] The PtrSAUR32 gene coding sequence DNA fragment and the overexpression vector PFGC5941M3F-FN were digested with restriction enzymes BamHI and Smil (ThermoFisher) and then recovered and subjected to recombination reaction at 50°C using homologous recombination enzyme (Thermo, 639649). The recombination product was transformed into E. coli DH5a by heat shock method, and the plasmid of the positive clone was extracted using the plasmid extraction kit E.Z.N.A.™ Plasmid Mini Kit (Omega, CAT: D6943) to obtain the overexpression vector PFGC5941M3F-PtrSAUR32 of PtrSAUR32 (as shown in Figure 3

[0060] 2. Transformation of Agrobacterium with overexpression vector

[0061] ​PFGC5941M3F-PtrSAUR32 was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: the competent cells EHA105 were thawed on ice, 50 μL competent cells were taken to the bottom of the pre-dried and pre-cooled electroporation cup, 2.5 μL PFGC5941M3F-PtrSAUR32 plasmid was added and mixed, the electroporation instrument mode was adjusted to AGR, the electroporation cup was placed in the electroporation groove and the click button was pressed; 600 μL LB liquid medium without antibiotics was added to the electroporation cup, mixed, and then transferred to a 1.5 mL sterile centrifuge tube, which was cultured at 28°C, 220 r / min on a shaker for 2-3 h; centrifuged at 6000 r / min for 5 min, resuspended and plated on LB solid medium containing 50 mg / L Kana, and cultured at 28°C in the dark for 2 days; after the bacterial plaque grew, single colonies were verified by PCR using primers OE-PtrSAUR32-F (SEQ ID NO. 2) and OE-PtrSAUR32-R (SEQ ID NO. 3), and stored in an ultra-low temperature freezer;

[0062] PCR reaction conditions: 95°C for 5 min; 95°C for 10 s, 55°C for 10 s, 72°C for 25 s, 35 cycles; 72°C for 10 min.

[0063] Example 4

[0064] Genetic transformation of citrus with PtrSAUR32 overexpression vector

[0065] 1. Obtaining of the epicotyls of citrus seedlings

[0066] The mature citrus fruits were washed and surface sterilized with 75% alcohol, and the seeds were taken out under sterile conditions and the inner and outer seed coats were peeled off, and then the seeds were germinated on seed germination medium (MS) and cultured in the dark at 28°C for 4 weeks, and then cultured under 16 h light / 8 h dark conditions for 1 week; the epicotyls of the seedlings were obliquely cut into 1 cm stem segments under sterile conditions, and the stem segments were placed in MS liquid medium for use.

[0067] 2. Preparation of Agrobacterium tumefaciens bacterial solution

[0068] Before transfection, the Agrobacterium (containing PFGC5941M3F-PtrSAUR32 plasmid) stored in the ultra-low temperature freezer was streaked on LB solid medium containing 50 mg / L Kana and cultured at 28°C for 2 days, and single colonies were picked on LB liquid medium containing the same antibiotic and cultured overnight at 28°C; the bacterial solution was diluted 1:100 and cultured to OD 600 =0.5, centrifuged at 5000 r / min for 10 min, the supernatant was discarded, and the bacterial cells were resuspended in MS liquid medium to OD600=0.5.

[0069] 3. Citrus epicotyl transformation

[0070] After the citrus stem segments were infected in the prepared bacterial suspension for 10-12 min, they were dried and transferred to the co-culture medium, and cultured in the dark at 26°C for 3 days. After the co-culture, the epicotyls were transferred to the selection medium and cultured in the dark at 28°C for 14 days. The epicotyls were cultured at 28°C under the condition of 16 h light / 8 h dark, subcultured every two weeks, and then identified for GFP fluorescence using a hand-held fluorescent lamp.

[0071] 4. Seedling culture of transformants

[0072] When the sprouts grew to more than 1 cm, they were cut off and grafted onto 1-2 month-old Citrus trifoliate rootstocks. When the seedlings grew to about 5 cm, they were grafted onto 2-year-old Zixiang sweet orange rootstocks.

[0073] The operation procedure is shown in Figure 4 .

[0074] The culture media used in this example are as follows:

[0075] Seed germination medium: MS + 30 g / L sucrose + 3.5 g plant gel, pH 5.8;

[0076] Co-culture medium: MS + 30 g / L sucrose + 3.5 g plant gel + 1 mg / L 6-BA + 0.5 mg / L NAA + 100 μM AS, pH 5.8;

[0077] Selection medium: MS + 30 g / L sucrose + 3.5 g plant gel + 1 mg / L 6-BA + 0.5 mg / L NAA + 10 mg / L G418 + 500 mg / L Carb, pH 5.8.

[0078] Example 5

[0079] Verification of PtrSAUR32 overexpression transgenic plants

[0080] 1. GFP and PCR identification of transgenic plants

[0081] After the grafts survived, the GFP fluorescence of the transgenic seedlings was identified using a hand-held fluorescent lamp, and the positive plants showed green fluorescence (as shown in Figure 4The leaves of the transgenic plants obtained from the primary screening (containing GFP fluorescence) were ground in liquid nitrogen, and the genomic DNA was extracted according to the CTAB method, and the integration of the PtrSAUR32 coding sequence in the citrus genome was detected by PCR. The detection primers were ID-PtrSAUR32-F (SEQ ID NO. 4) and ID-PtrSAUR32-R (SEQ ID NO. 5). Positive plants can obtain an amplified fragment, while the WT control plant has no band (as shown in FIG. 2B). Figure 5

[0082] PCR reaction conditions: 95°C for 5 min; 95°C for 10 s, 55°C for 10 s, 72°C for 25 s, 35 cycles; 72°C for 10 min.

[0083] 2. qRT-PCR analysis of transgenic plants

[0084] The leaves of the transgenic plants identified by GFP and PCR were ground in the leaves, and the total RNA of the transgenic plant leaves was extracted according to the kit EASYspinPlus Plant RNA Kit (RN38, AIDLY). The cDNA was synthesized using the reverse transcription kit RevertAid™ Master Mix (M16325, Thermo). The expression amount of the target gene was detected by qRT-PCR. The detection primers were RT-PtrSAUR32-F (SEQ ID NO. 6) and RT-PtrSAUR32-R (SEQ ID NO. 7). The relative expression amount of the PtrSAUR32 gene in the transgenic plants was calculated by the 2 -△△Ct method.

[0085] The results are shown in FIG. 3B. Figure 6 As can be seen from Figure 6 , the expression level of the PtrSAUR32 gene in the transgenic plants was significantly higher than that in the WT wild type plants.

[0086] qRT-PCR reaction conditions: 95°C for 30 s, 95°C for 15 s, 58°C for 30 s, 40 cycles.

[0087] Example 6

[0088] Phenotypic identification of the root system of the PtrSAUR32 overexpression transgenic plant cutting seedlings

[0089] After the transgenic plants were grafted to 2-year-old Ziyang orange rootstocks and grew for 2-3 months, the branches were cut into 3-5 cm small sections, and rooting was carried out in vermiculite. The rooting temperature was 23-25°C. The root system length of the cutting seedlings was counted after 20 days.

[0090] The root system phenotype diagram of the transgenic plant is shown in FIG. 4B. Figure 7 ​As shown in Figure 2, the length of the main root of the PtrSAUR32 gene overexpression plant was significantly longer than that of the WT wild type plant, and the root length histogram is as shown in Figure 3. Figure 7 As shown in Figure 2, the length of the main root of the PtrSAUR32 gene overexpression plant was significantly longer than that of the WT wild type plant, and the root length histogram is as shown in Figure 3. Figure 8 As shown in Figure 2, the length of the main root of the PtrSAUR32 gene overexpression plant was significantly longer than that of the WT wild type plant, and the root length histogram is as shown in Figure 3. Figure 8 As shown in Figure 2, the length of the main root of the PtrSAUR32 gene overexpression plant was significantly longer than that of the WT wild type plant, and the root length histogram is as shown in Figure 3.

[0091] It is proved that the PtrSAUR32 gene overexpression can significantly enhance the growth of citrus root length, which has great application value for improving citrus rootstock and enhancing citrus stress resistance.

[0092] The following is the nucleotide sequence involved in the present application:

[0093] SEQ ID NO. 1 (CDS sequence of PtrSAUR32 gene):

[0094] ATGGGGGTCAGTTCAAGCAAATTAAGCTGGTTGATTGGAGGTGGAAGAGCTTATTATAAGAGACTCAGAGGGACTAGTAGTTGCAGTACTGCTCAATTGATGACTACTCCGAAAGGTTATGTGCCAATTTGTGTTGGTTTGGGCAATGATACAAAGCTTTTTATTGTTCGCACAACAGCACTCGGCGATGCTGATTTCTTGCAGTTTCTCTGTAAATCTGCCGAGGAATATGGCTTCTGTAATGAAGGAATTTTGAGGATCCCATGTGAAGCTGAAGCGTTCGAAGATTGGATGATTAGAAGAGCCAATCACAAGTTTAGAGTTAAAACAGTTTAG

[0095] SEQ ID NO. 2 (CDS cloning forward primer OE-PtrSAUR32-F, containing enzyme digestion site SmiI):

[0096] GCCCAATCGATGATTTAAATATGGGGGTCAGTTCAAGCAA

[0097] SEQ ID NO. 3 (CDS cloning reverse primer OE-PtrSAUR32-R, containing enzyme digestion site BamHI):

[0098] CTCTAGACTCACCTAGGATCCCTAAACTGTTTTAACTCTAAACTTG

[0099] SEQ ID NO. 4 (forward primer for PCR identification of transgenic plants ID- PtrSAUR32-F):

[0100] CACGCTCGAGTATAAGAGCTCT

[0101] SEQ ID NO. 5 (reverse primer for PCR identification of transgenic plants ID- PtrSAUR32-R):

[0102] GGACTAGTCCCGGGTCTTAAT

[0103] SEQ ID NO. 6 (forward primer for RT-PCR identification of transgenic plants RT- PtrSAUR32-F):

[0104] TGGTTTGGGCAATGATACAAAG

[0105] SEQ ID NO. 7 (reverse primer for RT-PCR identification of transgenic plants RT- PtrSAUR32-R):

[0106] ACATGGGATCCTCAAAATTCCT.

[0107] Finally, it should be noted that: the above specific examples are only used to the purpose, technical solutions and beneficial effects of the present application are described in detail, it should be understood that the above described only for the specific embodiments of the present application has been, and not for limiting the scope of the present application; although the present application is described in detail with reference to the foregoing specific examples, those skilled in the art should be understood: it is still possible to modify the technical solutions recorded in the foregoing examples, or part or all of the technical features of the equivalent replacement, improvement, etc.; and these modifications, equivalent replacement, improvement, and do not make the essence of the corresponding technical solutions out of the scope of the embodiments of the present application technical solutions, it should be covered in the scope of the claims and the present application.

Claims

1. The application of overexpression of the PtrSAUR32 gene in enhancing citrus root growth, characterized by, The PtrSAUR32 gene sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The specific application method is as follows: (1) Cloning the coding sequence of the PtrSAUR32 gene; (2) Construct a PtrSAUR32 overexpression vector; (3) Citrus was genetically transformed using the PtrSAUR32 overexpression vector, and transgenic plants with enhanced root growth were obtained after identification.

3. The application according to claim 2, characterized in that, In step (1), the cloning method for the PtrSAUR32 gene coding sequence is as follows: Total RNA was extracted from citrus and then reverse transcribed into cDNA. Using cDNA as a template, PCR amplification was performed using forward primer OE-PtrSAUR32-F and reverse primer OE-PtrSAUR32-R, and the DNA fragment encoding the PtrSAUR32 gene sequence was recovered. The primers OE-PtrSAUR32-F and OE-PtrSAUR32-R have nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

4. The application according to claim 3, characterized in that, In step (2), the method for constructing the PtrSAUR32 overexpression vector is as follows: The recovered PtrSAUR32 gene coding sequence DNA fragment was recombined into the PFGC5941M3F-FN vector recovered by BamHI / SmiI restriction enzyme digestion to construct the overexpression vector PFGC5941M3F-PtrSAUR32.

5. The application according to claim 4, characterized in that, In step (3), the method for genetically transforming citrus fruits using the PtrSAUR32 overexpression vector is as follows: The overexpression vector PFGC5941M3F-PtrSAUR32 was transformed into Agrobacterium tumefaciens by electroporation, and then citrus explants were transformed by Agrobacterium-mediated transformation. After genetic transformation, the explants were identified by handheld fluorescent lamp for GFP fluorescence, PCR identification, and qRT-PCR analysis of PtrSAUR32 expression level to obtain transgenic plants.

6. The application according to claim 5, characterized in that, The primers used for PCR identification of transgenic plants are ID-PtrSAUR32-F and ID-PtrSAUR32-R. ID-PtrSAUR32-F and ID-PtrSAUR32-R are sequences taken from the PFGC5941M3F-FN vector and have nucleotide sequences as shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

7. The application according to claim 5, characterized in that, The primers for qRT-PCR analysis of PtrSAUR32 expression levels are RT-PtrSAUR32-F and RT-PtrSAUR32-R, which have nucleotide sequences as shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.

8. The application according to claim 2, characterized in that, After obtaining the transgenic plants in step (3), the transgenic plants were propagated by cuttings, and it was determined that PtrSAUR32 overexpression enhanced the root growth of citrus cuttings.