Application of rice Os3BGlu6 gene in plant growth

Abstract

The invention provides application of a rice Os3BGlu6 gene in plant growth, and belongs to the field of plant genetic engineering. According to the application, the Os3BGlu6 gene is overexpressed to promote plant growth. According to the application, the Os3BGlu6 gene is overexpressed to promote plant growth, including increase of root hair length, density and biomass, and by improving the mRNA expression level of the Os3BGlu6 gene, the nitrogen utilization level of rice plants under low nitrogen can be improved, and the effective tiller number of rice in the mature period can be improved. On the basis, the gene has wide application prospects and values in the aspects of regulating and controlling the moisture, nutrient absorption and tillering capacity of the rice, and can be used for crop genetic precise improved breeding.

Description

Technical Field

[0001] The present disclosure relates to the field of plant genetic engineering, and in particular to an application of rice Os3BGlu6 gene in plant growth. Background Art

[0002] Rice (Oryza sativa L.) is an important food crop in the world, and more than half of the world's population relies on it as their staple food. Scientific research in recent years has shown that differences in rice plant shape, fertility, stress resistance, and yield are closely related to the physiological state and growth vitality of its roots. Root hairs are a special structure formed by the protrusions of epidermal cells in the root elongation zone, which occupies 80% of the root surface area and plays an important role in the crop's absorption of water and nutrients, anchoring to the soil, and interaction with microorganisms.

[0003] In the context of implementing the concept of green development and developing a resource-saving and environmentally friendly agricultural production system, the molecular improvement of rice root hairs using key genes for genetic regulation of root hairs will greatly improve the utilization rate of water and fertilizers by rice varieties themselves, reduce the waste of human and material resources, and reduce the pollution to the environment caused by the loss of a large amount of chemical fertilizers and pesticides. However, the regulatory mechanism of rice root hair development is still unclear. Therefore, discovering excellent genes for regulating rice root hair development with independent intellectual property rights and applying them to molecular genetic improvement of rice roots is of great significance for improving the international competitiveness of my country's crop breeding and developing sustainable and efficient green agriculture.

[0004] Public Content

[0005] In order to solve the problems of the prior art, the present disclosure provides an application of the rice Os3BGlu6 gene in plant growth. The technical solution is as follows:

[0006] The present disclosure provides an application of a rice Os3BGlu6 gene in plant growth, and the application comprises: overexpressing the Os3BGlu6 gene to promote plant growth.

[0007] Specifically, the application also includes: overexpressing the Os3BGlu6 gene to increase the length, density and biomass of root hairs.

[0008] Specifically, the application also includes: overexpressing the Os3BGlu6 gene to improve the ability of plants to utilize and absorb nitrogen under low nitrogen conditions.

[0009] Specifically, the application also includes: overexpressing the Os3BGlu6 gene to improve the tillering ability of mature plants.

[0010] Furthermore, the application also includes:

[0011] Extraction of total RNA from rice materials;

[0012] Reversely transcribing the total RNA to obtain cDNA;

[0013] The cDNA is used as a template and a forward primer and a reverse primer are used for amplification to obtain an amplified product, that is, the coding region of the Os3BGlu6 gene. The sequence of the amplified product is shown in SEQ ID NO: 1 in the sequence listing, the sequence of the forward primer is shown in SEQ ID NO: 2 in the sequence listing, and the reverse primer is shown in SEQ ID NO: 3 in the sequence listing.

[0014] Specifically, the rice material is Zhonghua 11.

[0015] Specifically, each 25 μL amplification system includes: 0.5 μL cDNA, 12.5 μL 2×KOD-FX Buffer, 5 μL 2 mM dNTP, 0.5 μL KOD enzyme, 0.2 μL forward primer with a concentration of 10 μM, 0.2 μL reverse primer with a concentration of 10 μM, and 6.1 μL water.

[0016] Specifically, the amplification program includes: pre-denaturation at 98°C for 2 minutes; then 32 amplification cycles, each cycle including: denaturation at 98°C for 15 seconds, annealing at 60°C for 15 seconds, extension at 60°C for 90 seconds; and final extension at 68°C for 5 minutes.

[0017] Specifically, the application also includes: connecting the amplified product after enzyme digestion with the pU1301 vector after enzyme digestion to obtain a connection product; transferring the connection product into Escherichia coli competent cells by electrotransformation, and obtaining a single clone after cultivation; and introducing the single clone into a receptor material by Agrobacterium-mediated method to obtain a transgenic plant.

[0018] The beneficial effects of the technical solution provided by the embodiments of the present disclosure are as follows: the present disclosure provides an application of the rice Os3BGlu6 gene in plant growth, which includes: overexpressing the Os3BGlu6 gene to promote plant growth, including increasing the length, density and biomass of root hairs, and increasing the nitrogen utilization level of rice plants under low nitrogen conditions by increasing the expression level of the Os3BGlu6 gene mRNA, and increasing the number of effective tillers of rice at maturity. Based on this, the gene has broad application prospects and value in regulating rice water, nutrient absorption and tillering ability, and can be used for crop genetic precision improvement breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] To more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only some embodiments of the present disclosure. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0020] Figure 1 It is the vector map of Pu1301 provided by the embodiments of the present disclosure;

[0021] Figure 2 It is the structural diagram of Pu1301-Os3BGlu6 provided by the embodiments of the present disclosure;

[0022] Figure 3 It is the statistical chart of the mRNA expression level of the Os3BGlu6 gene provided by the embodiments of the present disclosure, where the expression level of the wild-type plant WT is set to 1, and the asterisk indicates significant difference;

[0023] Figure 4 It is the root hair phenotype diagram of the wild-type WT plant provided by the embodiments of the present disclosure;

[0024] Figure 5 It is Figure 4 The partial enlarged view of;

[0025] Figure 6 It is the root hair phenotype diagram of the OE1 plant provided by the embodiments of the present disclosure;

[0026] Figure 7 It is Figure 6 The partial enlarged view of;

[0027] Figure 8 It is the root hair phenotype diagram of the OE2 plant provided by the embodiments of the present disclosure;

[0028] Figure 9 It is Figure 8 The partial enlarged view of;

[0029] Figure 10 It is the root hair phenotype diagram of the OE3 plant provided by the embodiments of the present disclosure;

[0030] Figure 11 It is Figure 10 The partial enlarged view of;

[0031] Figure 12 It is the statistical chart of the root hair length of the plants provided by the embodiments of the present disclosure;

[0032] Figure 13 It is the statistical chart of the root hair density of the plants provided by the embodiments of the present disclosure;

[0033] Figure 14is a statistical diagram of plant root hair biomass provided by an embodiment of the present disclosure;

[0034] Figure 15 It is a comparison diagram of the growth of wild-type WT and OE1, OE2 and OE3 plants under normal vegetative growth conditions provided in the embodiments of the present disclosure;

[0035] Figure 16 It is a comparison diagram of the growth of wild-type WT and OE1, OE2 and OE3 plants under low nitrogen nutrition growth conditions provided in the embodiments of the present disclosure;

[0036] Figure 17 It is a comparison diagram of the plant phenotypes at the mature stage of the wild type WT and the Os3BGlu6 gene overexpressing OE1, OE2 and OE3 plants provided in the embodiments of the present disclosure;

[0037] Figure 18 It is a statistical graph of the tillering number of wild-type WT and OE1, OE2 and OE3 plants at maturity provided in the embodiments of the present disclosure. DETAILED DESCRIPTION

[0038] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.

[0039] Example

[0040] The present disclosure provides an application of rice Os3BGlu6 gene in improving root hairs, and the application comprises: overexpressing the Os3BGlu6 gene to promote root hair growth.

[0041] Specifically, the application also includes: overexpressing the Os3BGlu6 gene to increase the length, density and biomass of root hairs.

[0042] Specifically, the application also includes: overexpressing the Os3BGlu6 gene to improve the absorption capacity of nitrate nitrogen.

[0043] Specifically, the application also includes: overexpressing the Os3BGlu6 gene to improve the tillering ability of rice at maturity.

[0044] Furthermore, the application also includes:

[0045] Extraction of total RNA from rice materials;

[0046] The total RNA was reverse transcribed to obtain cDNA;

[0047] Using cDNA as a template, a forward primer and a reverse primer were used for amplification to obtain an amplification product, that is, the coding region of the Os3BGlu6 gene. The sequence of the amplification product is shown in SEQ ID NO: 1 in the sequence list, the sequence of the forward primer is shown in SEQ ID NO: 2 in the sequence list, and the reverse primer is shown in SEQ ID NO: 3 in the sequence list. The forward primer sequence is: TTAGGTACCATGGGGAGGATAAAGAGTAGTA. The reverse primer sequence is: TTAGGATCCTCAGGTCTTCAGGAGGGCCTT.

[0048] Specifically, the rice material is Zhonghua11.

[0049] In this example, the root system of Zhonghua 11 (provided by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences) grown for 5 days was taken as the test sample, and total RNA was extracted using the Trizol extraction kit of Invitrogen (for specific operation steps, see the instruction manual of the kit).

[0050] The total RNA was reverse transcribed to obtain cDNA.

[0051] Specifically, ① prepare mixed solution 1, which includes: 4 μg of total RNA, 2U of DNaseI, 1 μL of 10×DNaseI buffer, add DEPC (diethyl pyrocarbonate, a strong inhibitor of RNase) treated water to 10 μL, the treated water is DEPC with a concentration of 0.01%, mix the mixed solution 1, and place it at 37°C for 20 minutes to remove DNA; ② place the mixed solution 1 in a 65°C water bath for 10 minutes to remove the activity of DNAse I, and then place it on ice for 5 minutes; ③ add 1 μL of oligo(dT) with a concentration of 500 μg / mL to the ice-cooled mixed solution 1; ④ immediately place the ice-cooled mixed solution 1 in a 65°C water bath for 10 minutes to completely denature the RNA, and then place it on ice for 5 minutes; ⑤ prepare mixed solution 2, which includes: 10 μL of mixed solution 1, 4 μL of 5×First-Strand Buffer, 4 μL of 0.1M DTT (mercaptoethanol) 2μL, 10mM dNTP mixture 1.5μL, DEPC treated water 0.5μL, reverse transcriptase 2μL, mix the mixture 2 and place it in a 42℃ water bath for 1.5 hours; ⑥ After the reaction is completed, place the mixture 2 in a 90℃ dry bath for 10 minutes to obtain the final product; ⑦ Store the final product at -20℃. All reagents used in the reverse transcription process were purchased from Invitrogen.

[0052] Using cDNA as a template, forward primer and reverse primer were used for PCR (Polymerase Chain Reaction) amplification to obtain an amplified product. Each 25 μL amplification system includes: 0.5 μL cDNA, 12.5 μL 2×KOD-FXBuffer, 5 μL 2mM dNTP, 0.5 μL KOD enzyme, 0.2 μL forward primer with a concentration of 10 μm, 0.2 μL reverse primer with a concentration of 10 μm, and water was added to 25 μL. In this embodiment, 2×KOD-FX Buffer and KOD enzyme were purchased from Shanghai Toyobo Biotechnology Co., Ltd. Specifically, the amplification program includes: 98°C pre-denaturation for 2 minutes; then 32 amplification cycles, each cycle includes: 98°C denaturation for 15 seconds, 60°C annealing for 15 seconds, 60°C extension for 90 seconds; 68°C final extension for 5 minutes, and finally stored at 4°C.

[0053] After the amplification product was purified, an enzyme digestion reaction was performed. Specifically, a 20 μL enzyme digestion reaction system included: 10 μL of 100 ng / μL amplification product, 1 μL of Kpn1 endonuclease, 0.5 μL of BamHI endonuclease, 2 μL of 10×BamHI Buffer (Thermo Scientific), which was supplemented with water to 20 μL and subjected to enzyme digestion reaction at 37° C. for 6 hours.

[0054] The pU1301 vector was digested with enzymes, wherein the pU1301 vector map is as follows Figure 1 Specifically, the 20 μL pU1301 vector restriction enzyme reaction system includes: pU1301 (200 ng / μL) 10 ul, Kpn1 endonuclease 2 μL, BamHI endonuclease 1 μL, 10×BamHIBuffer (Thermo Scientific) 2 μL, add water to 20 μL, and perform restriction enzyme reaction at 37°C for 6 hours to construct Pu1301-Os3BGlu6.

[0055] The PCR amplification product after restriction digestion was connected with Pu1301-Os3BGlu6 after restriction digestion to construct DX-Os3BGlu6 (ligation product). Specifically, a 10 μL ligation reaction system includes: 7 μL of PCR amplification product after restriction digestion (20-70 ng / μL), 1 μL of pU1301 vector plasmid after restriction digestion (80 ng / μL), 1 μL of 10×NEB T4 DNAligase Buffer, 1 μL of NEB T4DNAligase, and ligation at 16°C for 5 hours to obtain a ligation product.

[0056] The amplified product after enzyme digestion is connected with the pU1301 vector after enzyme digestion to obtain a connection product; the connection product is transferred to Escherichia coli competent cells by electrotransformation method, and a single clone is obtained after cultivation; the single clone is introduced into a receptor material by Agrobacterium-mediated method to obtain a transgenic plant.

[0057] Specifically, the electrotransformation instrument used in the electrotransformation is a product of Eppendorf Company, the voltage used is 1800V, and the operation method is shown in the instrument manual. Specifically, the ligation product is transferred to the competent state of Escherichia coli DH10β (purchased from Promega Biotechnology Co., Ltd., i.e., Promega Company of the United States), and cultured on a LA (LA formula see J. Sambrook, EF Fritsch, T Maniadis, translated by Huang Peitang, Wang Jiaxi, etc., Molecular Cloning Experiment Guide (3rd Edition), Science Press, 2002 Edition) resistance medium containing 250ppm kanamycin (purchased from Roche Biological Company). Then, colony culture is carried out, specifically including: on a clean bench, a single colony grown on the LA resistance medium is inoculated into a sterilized 10mL centrifuge tube, 3mL of LB resistance medium containing 250ppm kanamycin is pre-added to the centrifuge tube, and then cultured on a 37°C shaker for 16 to 18 hours. After the culture was completed, the plasmid was extracted according to the method reported in "Molecular Cloning Experiment Guide" by J. Sambrook and DW Russell, translated by Huang Peitang et al., Science Press, 2002 edition, digested with the corresponding restriction endonuclease and detected by electrophoresis, and the clones with the correct size were selected for sequencing verification. The clones with the correct sequencing were electrotransformed into Agrobacterium, and the above-mentioned ligation product genetic transformation vector was introduced into the japonica rice recipient variety Zhonghua 11 (ZH11) using the Agrobacterium-mediated transgenic method (Wu et al., 2003. Development of enhancer trap lines for functional analysis of the rice genome. Plant J. 35: 418–427) to obtain the transgenic plant Pu1301-Os3BGlu6, see Figure 2 .

[0058] Identification of Pu1301-Os3BGlu6 transgenic positive plants. According to the coding region sequence of the Os3BGlu6 gene (SEQID NO: 1), primers were designed for PCR amplification. After amplification with the Os3BGlu6 genomic detection primers, transgenic positive plants were identified by electrophoresis. The amplification system was 20 μL, specifically including: 0.5 μL DNA template, 10 μL 10×PCR Mixture (purchased from Zhuangmeng Bio Co., Ltd.), 0.4 μL forward primer, 0.4 μL reverse primer, and water to 20 μL. Specifically, the amplification procedure included: pre-denaturation at 95°C for 5 minutes; then 32 amplification cycles, each cycle including: denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and annealing at 72°C for 60 seconds.

[0059] The forward primer sequence is: TTAGGTACCATGGGGAGGATAAAGAGTAGTA (as shown in SEQ ID NO: 2 in the sequence listing);

[0060] The reverse primer sequence is: TTAGGATCCTCAGGTCTTCAGGAGGGCCTT (as shown in SEQ ID NO: 3 in the sequence listing).

[0061] Analysis of the mRNA expression level of the Os3BGlu6 gene. The transgenic positive plants were subjected to quantitative PCR detection, and the PCR amplification system was 10 μL, and the specific method included: 2 μL of cDNA template, 5 μL of 2×SYBR Buffer (purchased from Bao Bio Dalian Co., Ltd.), 0.2 μL of the first forward primer, the first reverse primer, the second forward primer and the second reverse primer, and water was added to 10 μL. Specifically, the amplification program included: pre-denaturation at 95°C for 10 minutes; then 45 amplification cycles, each cycle included: denaturation at 95°C for 15 seconds, annealing at 60°C for 60 seconds.

[0062] The first forward primer qOs3BGlu6-F:GATGAGGAGCCTGATGAACTATG (as shown in SEQ ID NO: 4 in the sequence listing);

[0063] The first reverse primer qOs3BGlu6-R:GATGGAAATGAACGGGTTGTTG (as shown in SEQ ID NO: 5 in the sequence listing);

[0064] The second forward primer qUbiquitin1-F: AACCAGCTGAGGCCCAAGA (as shown in SEQ ID NO: 6 in the sequence listing);

[0065] The second reverse primer qUbiquitin1-R:ACGATTGATTTAACCAGTCCATGA (as shown in SEQ ID NO: 7 in the sequence listing);

[0066] The first forward primer, the first reverse primer, the second forward primer and the second reverse primer were all synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0067] Ubiquitin1 was used as the internal reference gene. ΔΔ The analysis results are as follows: Figures 3 to 6 As shown. Figure 3 As shown, in the root systems of Pu1301-Os3BGlu6 transgenic plants OE1, OE2 and OE3, the mRNA expression levels of Os3BGlu6 gene increased by 71.5 times, 704.3 times and 1337.6 times respectively compared with the control group. Overexpression plants OE1, OE2 and OE3 and wild type WT were planted in 1 / 2MS medium dishes (13cm×13cm) and cultured vertically in a 28℃ incubator (16h / 8h) for 4 days. The root hair phenotypes of OE1, OE2 and OE3 and the control group (wild type WT) were observed, as shown in the figure below. Figures 4 to 11 As shown in Figure 2, after comparison, it can be seen that the root hair length and root hair density of OE1, OE2, and OE3 plants are better than those of the control group. At the same time, the results of root hair length, density, and root hair biomass were analyzed. The results are shown in Figure 2. Figures 12 to 14 As shown. Figures 12 to 14 It can be seen that compared with the wild type WT, the root hair length, root hair density and root hair biomass of transgenic plants OE1, OE2 and OE3 were significantly increased. This result shows that increasing the mRNA expression level of the Os3BGlu6 gene can significantly promote the growth of rice root hairs.

[0068] Seven-day-old OE1, OE2, and OE3 plants were compared with wild-type WT plants in a low nitrogen (0.2 mM KNO 3 ) nutrient solution and normal nutrient solution were cultured for 15 days. Figure 15 and Figure 16 As shown, it was observed that the aboveground growth of OE1, OE2 and OE3 was significantly greater than that of the wild type WT under low-nitrogen nutrient solution, which indicates that after increasing the mRNA expression level of the Os3BGlu6 gene, the rice's nitrate nitrogen absorption function is enhanced, thereby improving the rice's low-nitrogen tolerance.

[0069] Phenotypic observation of mature plants, such as Figure 17 The phenotypes are statistically analyzed, as shown in Figure 18 As shown. Figure 18It can be seen that the tiller numbers of OE1, OE2 and OE3 plants are significantly greater than that of the wild type, which indicates that after increasing the mRNA expression level of the Os3BGlu6 gene, the water and nutrient utilization ability of rice is improved, thereby increasing the tiller number.

[0070] The above description is only an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. An application of rice Os3BGlu6 gene in plant growth, characterized in that: The application includes: overexpressing the Os3BGlu6 gene to promote plant growth.

2. The use according to claim 1, characterized in that: The application also includes: overexpressing the Os3BGlu6 gene to increase the length, density and biomass of root hairs.

3. The use according to claim 1, characterized in that: The application also includes: overexpressing the Os3BGlu6 gene to improve the ability of plants to utilize and absorb nitrogen under low nitrogen conditions.

4. The use according to claim 1, characterized in that: The application also includes: overexpressing the Os3BGlu6 gene to improve the tillering ability of mature plants.

5. The use according to any one of claims 1 to 4, characterized in that: The application also includes: Extraction of total RNA from rice materials; Reversely transcribing the total RNA to obtain cDNA; The cDNA is used as a template and a forward primer and a reverse primer are used for amplification to obtain an amplified product, that is, the coding region of the Os3BGlu6 gene. The sequence of the amplified product is shown in SEQ ID NO: 1 in the sequence listing, the sequence of the forward primer is shown in SEQ ID NO: 2 in the sequence listing, and the reverse primer is shown in SEQ ID NO: 3 in the sequence listing.

6. The use according to claim 5, characterized in that: The rice material is Zhonghua 11.

7. The use according to claim 5, characterized in that: Each 25 μL amplification system includes: 0.5 μL cDNA, 12.5 μL 2× KOD-FX Buffer, 5 μL 2 mM dNTP, 0.5 μL KOD enzyme, 0.2 μL 10 μM forward primer, 0.2 μL 10 μM reverse primer, and 6.1 μL water.

8. The use according to claim 5, characterized in that: The amplification procedure included: pre-denaturation at 98°C for 2 min; 32 amplification cycles, each cycle including: denaturation at 98°C for 15 sec, annealing at 60°C for 15 sec, extension at 60°C for 90 sec; and final extension at 68°C for 5 min.

9. The use according to claim 5, characterized in that: The application also includes: connecting the amplified product after enzyme digestion with the pU1301 vector after enzyme digestion to obtain a connection product; transferring the connection product into Escherichia coli competent cells by electrotransformation, and obtaining a single clone after cultivation; and introducing the single clone into a receptor material by Agrobacterium-mediated method to obtain a transgenic plant.

Images