Application of polymorphic site in improvement of rice root hair

Abstract

The invention provides application of a polymorphic site in improvement of rice root hair, and belongs to the technical field of plant genetic engineering. The invention relates to an application of a polymorphic site in improvement of rice root hair. The application comprises the following steps: mutating bases at the (+ 1051st) th nucleotide to the (+ 1053th) th nucleotide from an initiation codon in a rice Os3BGlu6 gene coding region, and synthesizing valine for promoting plant growth. According to the application, the valine is synthesized to promote plant growth after basic groups at the (+ 1051st) th nucleotide to the (+ 1053th) th nucleotide from an initiation codon in a rice Os3BGlu6 gene coding region are mutated, the valine is particularly used for improving the length, density and biomass of rice root hair, and the application effect is remarkable.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to an application of a polymorphic site in improving rice root hairs. Background Art

[0002] Rice (Oryza sativa L.) is an important food crop in the world, and more than half of the world's population relies on it as their staple food. In recent years, with the completion of rice genome sequencing, my country has timely launched rice functional genomics research, and rice molecular genetics and genomics research has made major breakthroughs. Rice functional genomics research has been at the forefront of the world. In today's context of implementing the concept of green development and developing a resource-saving and environmentally friendly agricultural production system, the discovery of important genetic resources for important agronomic traits of rice and their application in rice design breeding have greatly improved the purposefulness and pertinence of rice genetic improvement.

[0003] Scientific research in recent years has shown that the differences in rice plant shape, fertility, stress resistance and yield are closely related to the physiological state and growth vitality of its root system. Root hairs are a special structure formed by the protrusions of epidermal cells in the root elongation zone. They occupy 80% of the root surface area and play an important role in the crop's absorption of water and nutrients, anchoring to the soil and interaction with microorganisms. However, little is known about the genetic loci that can effectively increase the biomass of rice root hairs. Therefore, discovering excellent rice root hair genetic control loci and applying them to the molecular genetic improvement of rice roots will greatly improve the utilization rate of water and fertilizer by rice varieties themselves, reduce the waste of human and material resources, and environmental pollution caused by excessive fertilization. It is of great significance to improve the international competitiveness of my country's crop breeding and develop sustainable and efficient green agriculture.

[0004] Public Content

[0005] In order to solve the problems of the prior art, the present disclosure provides an application of a polymorphic site in improving rice root hairs. The technical solution is as follows:

[0006] The disclosed embodiment provides an application of a polymorphic site in improving rice root hairs, the application comprising: mutating the bases at the +1051th to +1053th nucleotides from the start codon of the rice Os3BGlu6 gene coding region to synthesize valine for promoting plant growth.

[0007] Specifically, the application includes: mutating the base at the +5348th nucleotide of the rice Os3BGlu6 gene to G to promote plant growth.

[0008] Specifically, the application includes: mutating the bases at the +1051th nucleotide to the +1053th nucleotide starting from the start codon in the coding region of the rice Os3BGlu6 gene to synthesize valine for increasing the length, density and biomass of root hairs.

[0009] Furthermore, the application includes:

[0010] Obtaining a promoter fragment of the rice variety to be improved;

[0011] Enzyme-cleaving the promoter fragment to obtain a promoter fragment after enzyme cleavage;

[0012] Obtain the Os3BGlu6 coding region fragment;

[0013] The pCambia2301 vector was digested with enzymes to obtain the pCambia2301 vector after digestion;

[0014] Connecting the promoter fragment after enzyme digestion, the Os3BGlu6 coding region fragment and the pCambia2301 vector after enzyme digestion to obtain a connection product;

[0015] Transforming the ligation product into competent E. coli cells to obtain a single clone;

[0016] The monoclonal Agrobacterium-mediated method is introduced into the rice variety to be improved to obtain improved rice.

[0017] The technical solution provided by the embodiment of the present disclosure brings the following beneficial effects: the embodiment of the present disclosure provides an application of a polymorphic site in improving rice root hairs, the application comprising: mutating the base at the +1051th nucleotide to the +1053th nucleotide of the coding region of the rice Os3BGlu6 gene from the start codon to synthesize valine for promoting plant growth, specifically, the base at the +5348th nucleotide of the rice LOC_Os03G11420 gene can be mutated to G, which is specifically used to increase the length, density and biomass of rice root hairs, and the application effect is significant. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 is the pCambia2301 vector map provided in the embodiments of the present disclosure;

[0020] Figure 2is a root hair phenotype diagram of a WT plant provided in an embodiment of the present disclosure, wherein scale bar = 1 mm;

[0021] Figure 3 The embodiment of the present disclosure provides Figure 2 A partial enlarged view of the invention, wherein the scale bar = 1 mm;

[0022] Figure 4 is a root hair phenotype diagram of a PC-CDS1 plant provided in an embodiment of the present disclosure;

[0023] Figure 5 The embodiment of the present disclosure provides Figure 4 A partial enlarged view of

[0024] Figure 6 is a root hair phenotype diagram of a PC-CDS2 plant provided in an embodiment of the present disclosure;

[0025] Figure 7 The embodiment of the present disclosure provides Figure 6 A partial enlarged view of

[0026] Figure 8 is a root hair phenotype diagram of a PC-CDS3 plant provided in an embodiment of the present disclosure;

[0027] Fig. 9 The embodiment of the present disclosure provides Figure 8 A partial enlarged view of

[0028] Fig.10 It is a statistical graph of root hair length of WT and PC-CDS1, PC-CDS2 and PC-CDS3 plants provided in the embodiments of the present disclosure, and double asterisks indicate extremely significant differences, P value <0.01, t test;

[0029] Fig.11 It is a statistical diagram of root hair density of WT and PC-CDS1, PC-CDS2 and PC-CDS3 plants provided in the embodiments of the present disclosure, and double asterisks indicate extremely significant differences, P value <0.01, t test;

[0030] Fig.12 It is a statistical graph of root hair biomass of WT and PC-CDS1, PC-CDS2 and PC-CDS3 plants provided in the embodiments of the present disclosure. Double asterisks indicate extremely significant differences, P value <0.01, t test. DETAILED DESCRIPTION

[0031] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.

[0032] Example

[0033] In this example, the promoter of the Os3BGlu6 gene of the rice variety "Zhonghua 11" was connected to the CDS of the Os3BGlu6 coding region (with "G" nucleotide at position 1051), inserted into the pCambia2301 vector, and transformed into the "Zhonghua 11" recipient rice variety (with "A" nucleotide at position 1051) to create transgenic plants.

[0034] The promoter fragment of the rice variety to be improved was obtained. Specifically, the nucleotide sequence 1-2501 shown in SEQ ID NO:3 (the nucleotide sequence was synthesized by Wuhan Qingke Biological Co., Ltd.) was used as the template sequence, and the forward primer and reverse primer with EcroR1 restriction site and KpnI restriction site added at both ends were used. The sample of the japonica rice variety "Zhonghua 11" with few root hairs was used as the template DNA, and the promoter fragment of the Os3BGlu6 gene was obtained by PCR amplification. The primers used were:

[0035] Forward primer Prom-F:TACGAATTCCGCGTGCATGAGTCGCCTACAA, as shown in SEQ ID NO: 1 in the sequence listing.

[0036] Reverse primer Prom-R: CATGGTACCCTCGCAGAGAGAAGGTACGGGA, as shown in SEQ ID NO: 2 in the sequence listing.

[0037] The PCR amplification system used was 25 μL, specifically including: 0.5 μL cDNA, 12.5 μL 2×KOD-FX Buffer (purchased from Toyobo Biotechnology Co., Ltd.), 5 μL 2 mM dNTP, 0.5 μL KOD enzyme, 0.2 μL each of forward primer F and reverse primer R, and water was added to a total system of 25 μL. The PCR amplification conditions were as follows: 94°C pre-denaturation for 2 min; then 31 amplification cycles, each cycle including: 98°C denaturation for 10 sec, 68°C annealing for 90 sec.

[0038] In other implementations, primers can be designed for different varieties according to the methods disclosed in the prior art to obtain promoter fragments of the rice variety to be improved for subsequent experiments.

[0039] The amplified promoter fragment is purified to obtain a purified promoter fragment.

[0040] The purified promoter fragment was subjected to restriction digestion reaction. Specifically, the 20 μL restriction digestion reaction system included: 10 μL of 100 ng / μL purified promoter fragment, 1 μL of EcroRI endonuclease, 1 μL of Kpn1 endonuclease, 2 μL of 10×BamHI Buffer (ThermoScientific), and the reaction system was supplemented to 20 μL with water. The restriction digestion reaction was carried out at 37°C for 6 hours to obtain the promoter fragment after restriction digestion.

[0041] The Os3BGlu6 coding region fragment was obtained, and the Os3BGlu6 coding region fragment was synthesized by Wuhan Qingke Biological Co., Ltd. Specifically, the Os3BGlu6 coding region fragment is shown in the sequence table SEQ ID NO: 4.

[0042] pCambia2301 vector was digested with enzymes, wherein the pCambia2301 vector map is as follows Figure 1 Specifically, the 20 μL pU1301 vector digestion reaction system includes: 10 μL pCambia2301 vector (200 ng / μL), 2 μL KpnI endonuclease, 1 μL BamHI endonuclease, 2 μL 10×BamHI Buffer (Thermo Scientific), and water is used to make up the digestion reaction to 20 μL. The digestion reaction is carried out at 37°C for 6 hours to obtain the digested pCambia2301 vector.

[0043] Ligation and transformation reaction. The promoter fragment after enzyme digestion, the Os3BGlu6 coding region fragment, and the pCambia2301 vector after enzyme digestion were purified and subjected to ligation reaction. Specifically, the 10μL ligation reaction system includes: 3.5μL of promoter fragment after enzyme digestion (20-70ng / μL), 3.5μL of Os3BGlu6 coding region fragment (20-70ng / μL), 1μL of pCambia2301 vector after enzyme digestion (80ng / μL), 1μL of 10×NEB T4 DNAligase Buffer, 1μL of NEB T4 DNAligase, and ligation was carried out overnight at 16°C to obtain a ligation product.

[0044] The ligation product is transferred into competent E. coli cells by electroporation, and a single clone is obtained after culture; the single clone is introduced into the recipient material (rice variety to be improved) by Agrobacterium-mediated method to obtain a transgenic plant (improved rice).

[0045] Specifically, the electrotransformation instrument used in the electrotransformation is a product of Eppendorf Company, the voltage used is 1800V, and the operation method is shown in the instrument manual. Specifically, the ligation product is transferred to the competent state of Escherichia coli DH10β (purchased from Promega Biotechnology Co., Ltd., i.e., Promega Company of the United States), and the LA (LA formula is shown in J. Sambrook, EF Fritsch, T Maniadis, translated by Huang Peitang, Wang Jiaxi, etc., Molecular Cloning Experiment Guide (3rd Edition), Science Press, 2002 Edition) resistance culture medium containing 250ppm kanamycin (purchased from Roche Biological Company) is plated and cultured, and then the colony culture is performed. The culture method specifically includes: on the clean bench, the single colony grown on the LA resistance culture medium is inoculated into a sterilized 10mL centrifuge tube, 3mL of LB resistance culture medium containing 250ppm kanamycin is pre-added to the centrifuge tube, and then cultured on a 37°C shaker for 16 to 18 hours. After the culture was completed, the plasmid was extracted according to the method reported in "Molecular Cloning Experiment Guide" by J. Sambrook and DW Russell, translated by Huang Peitang et al., Science Press, 2002 edition, and the extracted plasmid was digested with the corresponding restriction endonuclease and detected by electrophoresis, and the clones with the correct size were selected for sequencing verification. The clones with the correct sequencing were electrotransformed and introduced into the rice japonica rice recipient variety Zhonghua 11 (ZH11) using the Agrobacterium-mediated transgenic method (this method refers to Wu et al., 2003. Development of enhancertrap lines for functional analysis of the rice genome. Plant J. 35: 418-427) to obtain the transgenic plant PC-CDS.

[0046] In this example, the transgenic plants of the T1 generation PC-CDS1, PC-CDS2 and PC-CDS3 grown for 5 days were taken as samples to be tested.

[0047] Transgenic strains PC-CDS1, PC-CDS2, and PC-CDS3 were planted in 1 / 2MS medium dishes (13 cm × 13 cm) and cultured vertically in a 28°C incubator (16 h / 8 h light / dark alternation) for 4 days. The root hair phenotypes of transgenic strains PC-CDS1, PC-CDS2, and PC-CDS3 and wild-type WT plants were observed. Figures 2 to 9 As shown. Combined Fig.10 , the root hair length of transgenic lines PC-CDS1, PC-CDS2 and PC-CDS3 increased by 3.8, 2.8 and 3.5 times compared with the wild type WT. Fig.11As shown, the root hair density of transgenic lines PC-CDS1, PC-CDS2, and PC-CDS3 increased by 2.3-fold, 1.9-fold, and 2.1-fold compared to the wild type WT. As Fig.12 shown, the root hair biomass of transgenic lines PC-CDS1, PC-CDS2, and PC-CDS3 increased by 3.5-fold, 2.6-fold, and 1.8-fold compared to the wild type WT. It can be seen that by mutating the base at the 1051st nucleotide of the coding region of rice LOC_Os03G11420 gene to G, the root hair length, density, and biomass of rice can be significantly improved, promoting plant growth.

[0048] The above are only optional embodiments of the present disclosure and are not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure shall be included within the protection scope of the present disclosure.

Claims

1. Application of a polymorphic locus in improving rice root hairs, characterized in that: The application comprises: mutating the bases at the +1051th nucleotide to the +1053th nucleotide of the rice Os3BGlu6 gene coding region from the start codon to synthesize valine for promoting plant growth.

2. The use according to claim 1, characterized in that: The application comprises: mutating the base at the +5348th nucleotide of the rice Os3BGlu6 gene to G to promote plant growth.

3. The use according to claim 1, characterized in that: The application comprises: mutating the bases at the +1051th nucleotide to the +1053th nucleotide of the rice Os3BGlu6 gene coding region from the start codon to synthesize valine to increase the length, density and biomass of root hairs.

4. The use according to any one of claims 1 to 3, characterized in that: The applications include: Obtaining a promoter fragment of the rice variety to be improved; Enzyme-cleaving the promoter fragment to obtain a promoter fragment after enzyme cleavage; Obtain the Os3BGlu6 coding region fragment; The pCambia2301 vector was digested with enzymes to obtain the pCambia2301 vector after digestion; Connecting the promoter fragment after enzyme digestion, the Os3BGlu6 coding region fragment and the pCambia2301 vector after enzyme digestion to obtain a connection product; Transforming the ligation product into competent E. coli cells to obtain a single clone; The monoclonal Agrobacterium-mediated method is introduced into the rice variety to be improved to obtain improved rice.

Images