Use of rice endosperm storage material genes

Abstract

The application discloses a rice endosperm storage substance gene and application thereof, and belongs to the technical field of biotechnology. RSM The application discloses a rice endosperm storage substance gene and application thereof, and belongs to the technical field of biotechnology. RSM The application discloses a rice endosperm storage substance gene and application thereof, and belongs to the technical field of biotechnology.

Description

Technical Field

[0001] This disclosure relates to the field of biotechnology, and in particular to the application of a gene for storing rice endosperm. Background Technology

[0002] Rice is the staple food for more than half of the world's population. For a long time, breeders have focused on increasing rice yields to meet the growing food demand of the population. Advances in breeding technology in recent years, particularly dwarfing breeding and the utilization of hybrid vigor, have significantly increased grain production. However, with rising living standards, people's consumption habits have changed, shifting from simply eating enough to eating nutritious and healthy foods, placing higher demands on rice quality. Therefore, developing high-yielding and high-quality new rice varieties has become a primary focus for breeders.

[0003] Rice quality traits mainly include appearance, processing quality, cooking and eating taste, and nutritional quality. Starch and storage proteins are the main components of rice endosperm, with starch accounting for more than 80% of the dry weight of the endosperm. Starch in the endosperm includes amylose and amylopectin, and numerous studies have shown that the starch content, amylose content, and amylopectin content in the endosperm significantly affect rice quality. Protein is the second largest storage substance in rice endosperm after starch, accounting for approximately 5% to 10% of the dry weight of the endosperm. It can be roughly divided into four categories: glutenin, albumin, globulin, and prolamins. Their content and proportion can simultaneously affect the nutritional, processing, appearance, and eating quality of rice.

[0004] Currently, progress in high-quality rice breeding is relatively slow. This is because the mechanism of rice quality formation is unclear, and there are few cloned quality-related genes, especially those related to storage substances. Therefore, discovering new storage substance-related genes and constructing related mutants is of great significance for elucidating the mechanism of rice quality formation and for rice quality breeding.

[0005] Public content

[0006] To address the problems of existing technologies, this disclosure provides an application of a gene for storing rice endosperm storage materials. The technical solution is as follows:

[0007] This disclosure provides an application of a rice endosperm storage substance gene, characterized in that the application includes: using the RSM gene to regulate the content of rice endosperm storage substances.

[0008] Specifically, the application includes: knocking out, replacing, or altering the amino acid sequence of the RSM gene to reduce the amylose content and increase the amylopectin content of rice, while keeping the total starch content of the rice unchanged.

[0009] Specifically, the applications include knocking out, replacing, or altering the amino acid sequence of the RSM gene to increase total protein and gluten content, and decrease globulin, prolysin, and albumin content.

[0010] Specifically, the application includes: selecting RSM-T as a gene knockout target in the sequence of the RSM gene, wherein the sequence of RSM-T is shown as SEQ ID NO: 1 in the sequence listing;

[0011] An RSM gene knockout vector was constructed using the first forward primer, the first reverse primer, the second forward primer, and the second reverse primer according to the RSM-T. The sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence listing.

[0012] The RSM gene knockout vector was transformed into the recipient material to obtain a homozygous RSM gene knockout mutant.

[0013] Further, the application includes: using pYLsgRNA-OsU6a plasmid as a template, amplifying it by first PCR using the first forward primer and the first reverse primer to obtain a first amplification product containing the U6b promoter of RSM-T, and amplifying it by second PCR using the second forward primer and the second reverse primer to obtain a second amplification product containing the guide sgRNA fragment of RSM-T;

[0014] The first amplification product and the second amplification product are purified and recovered to obtain purified first amplification product and purified second amplification product.

[0015] The purified first amplification product and the purified second amplification product were ligated by overlap PCR to obtain the ligation product.

[0016] The ligation product was ligated into the pYLCRISPR / Cas9Pubi-H vector to obtain the RSM gene knockout vector.

[0017] Further, each 50 μL of the first PCR amplification reaction system includes: 5 μL of 10×PCR Buffer; 5 μL of 2.5 mM dNTP; 3 μL of 25 mM MgSO4; 1.5 μL of the first forward primer at a concentration of 10 μM; 1.5 μL of the first reverse primer at a concentration of 10 μM; 1 μL of template DNA at a concentration of 50–100 ng / μL; 1 μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 1 U / μL; and 2 μL of ddH2O3.

[0018] Further, each 50 μL reaction system for the second PCR amplification includes: 5 μL of 10×PCR Buffer; 5 μL of 2.5 mM dNTP; 3 μL of 25 mM MgSO4; 1.5 μL of a 10 μM second forward primer; 1.5 μL of a 10 μM second reverse primer; 1 μL of 50–100 ng / μL template DNA; 1 μL of 1 U / μL KOD-Plus-Neo high-fidelity polymerase; and 2 μL of ddH2O3.

[0019] Further, each 50 μL of the overlap PCR reaction system comprises: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 50 ng of the promoter U6a; 50 ng of the guide fragment sgRNA; 0.25 μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 5 U / μL; and ddH2O added to a total volume of 50 μL.

[0020] Further, each 15 μL of the ligation reaction system comprises: 1.5 μL of 10×CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 200 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 50 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U / μL BsaI-HF endonuclease; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.

[0021] The beneficial effects of the technical solution provided in this disclosure are as follows: This invention provides an application of a rice endosperm storage substance gene, which uses the RSM gene to regulate the content of rice endosperm storage substances, and the effect is significant. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This is a graph showing the statistical results of the total starch content in the endosperm of the control group Nip and the RSM-KO-9 group and the RSM-KO-10 group provided in the embodiments of this disclosure.

[0024] Figure 2 The results show the statistical results of amylose content in the endosperm of the control group Nip and RSM-KO-9 group and the RSM-KO-10 group provided in the embodiments of this disclosure. The asterisk indicates that there is a significant difference compared with the control group (p value calculated by one-way ANOVA, *p < 0.05, **p < 0.01).

[0025] Figure 3 The results show the statistical results of amylopectin content in the endosperm of the control group Nip and RSM-KO-9 and the RSM-KO-10 group provided in this embodiment of the present disclosure. The asterisk indicates that there is a significant difference compared with the control group (p value calculated by one-way ANOVA, *p < 0.05, **p < 0.01).

[0026] Figure 4 The total protein content in the endosperm of the control group Nip and RSM-KO-9 and the RSM-KO-10 group provided in this embodiment of the present disclosure is statistically significant compared with the control group (p value calculated by one-way ANOVA, *p < 0.05, **p < 0.01).

[0027] Figure 5 The results show the statistical results of albumin content in the endosperm of the control group Nip and RSM-KO-9 and the RSM-KO-10 group provided in this embodiment of the present disclosure. The asterisk indicates that there is a significant difference compared with the control group (p value calculated by one-way ANOVA, **p < 0.01).

[0028] Figure 6 The results show the statistical results of globulin content in the endosperm of the control group Nip and RSM-KO-9 and the RSM-KO-10 group provided in this embodiment of the present disclosure. The asterisk indicates that there is a significant difference compared with the control group (p value calculated by one-way ANOVA, **p < 0.01).

[0029] Figure 7The results show the statistical results of the content of prolactin in the endosperm of the control group Nip and RSM-KO-9 group and the RSM-KO-10 group provided in the embodiments of this disclosure. The asterisk indicates that there is a significant difference compared with the control group (p value calculated by one-way ANOVA, **p < 0.01).

[0030] Figure 8 The results show the statistical results of glutenin content in the endosperm of the control group Nip and RSM-KO-9 and the RSM-KO-10 group provided in this embodiment of the present disclosure. The asterisk indicates that there is a significant difference compared with the control group (p value calculated by one-way ANOVA, **p < 0.01). Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below with reference to the accompanying drawings.

[0032] Example

[0033] This disclosure provides an application of a rice endosperm storage substance gene, the application of which includes: using the RSM gene to regulate the content of rice endosperm storage substances.

[0034] Specifically, applications include knocking out, replacing, or altering the amino acid sequence of the RSM gene (LOC_Os03g08850) to reduce the amylose content and increase the amylopectin content in rice, while keeping the total starch content of rice unchanged.

[0035] Specifically, applications include: knocking out, substituting, or altering the amino acid sequence of the RSM gene to increase total protein and gluten content, and decreasing globulin, prolysin, and albumin content.

[0036] In this embodiment, the sequence of the RSM gene can be obtained from the Rice Genome Annotation Project (uga.edu) website, and the coding sequence is shown as SEQ ID NO: 6 in the sequence listing.

[0037] Specifically, the application includes: selecting RSM-T as the gene knockout target in the RSM gene sequence. The RSM-T sequence is shown as SEQ ID NO: 1 in the sequence listing, specifically: GTCCAGGTCGTCGTCGGTGACGG; In this embodiment, based on the obtained RSM coding sequence, the RSM gene knockout target is designed using the CRISPR-P 2.0 tool to obtain RSM-T.

[0038] Construct an RSM gene knockout vector based on RSM-T;

[0039] The RSM gene knockout vector was transformed into the recipient material to obtain the homozygous knockout mutant of the SM gene, which is a mutant in which the RSM gene loses function.

[0040] Further, the application includes: using the pYLsgRNA-OsU6a plasmid (given by Academician Liu Yaoguang's team and prepared using existing technology) as a template, amplification is performed using the first forward primer and the first reverse primer via first PCR to obtain a first amplification product containing the U6b promoter of RSM-T; amplification is performed using the second forward primer and the second reverse primer via second PCR to obtain a second amplification product containing the guide sgRNA fragment of RSM-T. The sequence of the first forward primer (UF) is shown in SEQ ID NO: 2 in the sequence listing, specifically: CTCCGTTTTACCTGTGGAATCG; the first reverse primer (RSM-U6aT) is shown in SEQ ID NO: 3 in the sequence listing, specifically: TCACCGACGACGACCTGGACGGCAGCCAAGCCAGCA; the sequence of the second forward primer (RSM-gT) is shown in SEQ ID NO: 4 in the sequence listing, specifically: TCCAGGTCGTCGTCGGTGAGTTTTAGAGCTAGAAAT; and the sequence of the second reverse primer (gR-R) is shown in SEQ ID NO: 4 in the sequence listing. NO:5, specifically: CGGAGGAAAATTCCATCCAC, yields an amplification product containing the U6b promoter of RSM-T and a guide sgRNA fragment containing RSM-T;

[0041] The first amplification product and the second amplification product were purified and recovered to obtain purified first amplification product and purified second amplification product.

[0042] The purified first amplification product and the purified second amplification product were ligated by overlap PCR to obtain the ligation product;

[0043] The ligation product was ligated into the pYLCRISPR / Cas9Pubi-H vector to obtain the RSM gene knockout vector.

[0044] Furthermore, each 50 μL reaction system for the first PCR amplification includes: 5 μL of 10×PCR Buffer; 5 μL of 2.5 mM dNTP; 3 μL of 25 mM MgSO4; 1.5 μL of the first forward primer at a concentration of 10 μM; 1.5 μL of the first reverse primer at a concentration of 10 μM; 1 μL of template DNA at a concentration of 50–100 ng / μL; 1 μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 1 U / μL; and 2 μL of ddH2O, for a total volume of 50 μL.

[0045] Furthermore, the first PCR amplification procedure is as follows:

[0046]

[0047] Furthermore, each 50 μL reaction system for the second PCR amplification includes: 5 μL of 10×PCR Buffer; 5 μL of 2.5 mM dNTP; 3 μL of 25 mM MgSO4; 1.5 μL of 10 μM second forward primer; 1.5 μL of 10 μM second reverse primer; 1 μL of 50–100 ng / μL template DNA; 1 μL of 1 U / μL KOD-Plus-Neo high-fidelity polymerase; and 2 μL of ddH2O, for a total volume of 50 μL.

[0048] Furthermore, the second PCR amplification procedure is as follows:

[0049]

[0050] Further, each 50 μL overlap PCR reaction system includes: 5 μL 10×PCR Buffer; 5 μL 2 mM dNTP; 3 μL 25 mM MgSO4; 1.5 μL 10 μM first forward primer (UF); 1.5 μL 10 μM second reverse primer (gR-R); 0.5 μL 50–100 ng / μL promoter U6a; 0.5 μL 50–100 ng / μL guide fragment sgRNA; 1 μL 1 U / μL KOD-Plus-Neo high-fidelity polymerase; and 32 μL ddH2O, bringing the total volume to 50 μL.

[0051] Furthermore, the overlap PCR amplification procedure is as follows:

[0052]

[0053] After the overlap PCR amplification reaction was completed, the amplification product was recovered using a 1% agarose gel. The target amplified product was approximately 700 bp in length, which was the sgRNA expression cassette. Then, the sgRNA expression cassette was ligated into the pYLCRISPR / Cas9Pubi-H vector using the Golden Gate ligation method.

[0054] The ligation reaction system consisted of: 1.5 μL of 10×CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 200 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 50 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U BsaI-HF restriction enzyme; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O, bringing the total volume to 15 μL.

[0055] The connection reaction procedure is as follows:

[0056]

[0057] After the ligation reaction is complete, the ligation product is obtained. Once the sequence of the ligation product is verified to be correct by sequencing, the construction of the RSM gene knockout vector is complete.

[0058] The RSM gene knockout vector was transformed into Agrobacterium EHa105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) via electroporation. The specific steps are as follows:

[0059] 1. Take one vial of EHA105 Agrobacterium competent cells (100 μL) stored at -80℃ and thaw it on ice;

[0060] 2. Add 1 μg of RSM gene knockout vector to the melted EHA105 Agrobacterium competent cells and mix well by tapping the bottom of the tube with your hand;

[0061] 3. Place EHA105 Agrobacterium competent cells on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes in sequence;

[0062] 4. Add 700 μL of antibiotic-free liquid LB medium to EHA105 Agrobacterium competent cells and incubate at 150 rpm for 2-3 hours in a constant temperature shaking incubator at 28℃.

[0063] 5. Centrifuge at 6000 rpm for 1 minute, discard the supernatant, collect the precipitate (bacterial cells), add 100 μL of antibiotic-free LB liquid medium to the bacterial cells, mix by pipetting, resuspend the bacterial cells, and then spread the bacterial cell resuspension onto LB solid medium containing 50 μg / mL kanamycin and 10 μg / mL rifampin, and incubate at 28℃ in the dark for 3 days.

[0064] 6. Select single colonies and use primers UF and gR-R to detect positive strains, and then expand the culture.

[0065] Then, the RSM gene knockout vector was transformed into the recipient material Nipponbare using Agrobacterium-mediated genetic transformation. The specific steps are as follows:

[0066] 1. Callus induction:

[0067] Select 300 mature and plump Nipponbare seeds, remove the outer husk using a small threshing machine, and then place them in 50mL centrifuge tubes. Wash the seeds three times each with tap water and distilled water, then sterilize them with a 75% alcohol solution for 5 minutes, followed by washing them three times with sterile water. Finally, add 30mL of a 1% sodium hypochlorite (NaClO) solution to a laminar flow hood and sterilize for 18 minutes. After sterilization, pour out the NaClO solution on the laminar flow hood, wash the seeds five times with sterile water, then spread the seeds evenly on sterile filter paper and dry them on the laminar flow hood. Finally, transfer the dried seeds to N6 solid induction medium and culture them at a constant temperature of 28℃ in the dark for about 4 weeks to obtain callus tissue.

[0068] 2. Succession:

[0069] Select callus that is growing well, yellow in color, and dense, and transfer it to a new N6 solid medium for continued incubation at 28°C in the dark for about two weeks.

[0070] 3. Culture and suspension of Agrobacterium:

[0071] The EHA105 strain containing the RSM gene knockout vector was collected by centrifugation at 6000 rpm and the bacterial concentration was adjusted to about 0.8 with 1 / 2N6 liquid medium to obtain a suspension.

[0072] 4. Infection:

[0073] Fresh, well-grown callus tissue was transferred to the above suspension and cultured for 15-20 minutes. After culture, the suspension was poured off, and the callus tissue was transferred to sterile filter paper and dried on a laminar flow hood for 1-2 hours. Then, it was transferred to 1 / 2 N6 solid medium containing 150 μM AS and cultured at 20°C in the dark for 1-2 days to obtain Agrobacterium-infected callus tissue.

[0074] 5. Removal of Agrobacterium

[0075] Wash the infected callus with sterile water until the liquid is clear. Then continue sterilization with N6 liquid culture medium containing 500 mg / L cephalosporin, repeating 3 times. After sterilization, place the callus in a laminar flow hood until dry.

[0076] 6. Screening of callus tissue

[0077] The dried callus tissue was transferred to N6 solid medium containing 250 mg / L cephalosporin and 50 mg / L hygromycin, and cultured at 28°C in the dark for 30 days for callus screening.

[0078] 7. Differentiation

[0079] Select well-grown callus and transfer it to MS solid medium. Incubate it under light at 8°C for 4 weeks, and green shoots of about 1-2 cm will grow.

[0080] 8. Rooting

[0081] Transfer the callus with green shoots to 1 / 2 MS rooting medium and culture at 28°C under light for about two weeks until the seedlings develop roots.

[0082] 9. Hardening off seedlings and transplanting

[0083] Remove the seedlings that have sprouted roots from the 1 / 2 MS medium, wash off the medium, trim any lateral roots and dead roots, and place them in tap water. Change the water every other day, and they can be transplanted into the soil after one week. At this point, the seedlings are T0 generation plants. After two generations of self-pollination, T2 generation lines can be obtained for subsequent experiments.

[0084] The phenotypes of RSM gene homozygous knockout mutants were observed. Specifically, in this embodiment, two RSM gene homozygous knockout mutants, RSM-KO-9 and RSM-KO-10, were selected as experimental groups, while the recipient material Nipponbare was used as the control group Nip.

[0085] Seeds from the control group, RSM-KO-9 group, and RSM-KO-10 group were raised as seedlings normally. At 4 weeks of age, they were transplanted to the field at a plant spacing of 16.7 cm and a row spacing of 26.7 cm, with 5 rows of 12 seedlings per row, for a total of 60 seedlings. Normal field water and fertilizer management was implemented. Mature seeds were harvested, and the seed husks were removed using a rice milling machine. The seeds were then milled into polished rice, and finally ground into rice flour using a grinder to measure the content of stored substances in the endosperm.

[0086] The total starch content in the endosperm was measured and statistically analyzed using a plant starch content kit (Shanghai Qiyi Biotechnology Co., Ltd., QYS-234027). The results are as follows: Figure 1 As shown. By Figure 1 It was found that there was no significant difference in total starch content in the endosperm of the Nip and RSM-KO-9 groups and the RSM-KO-10 group. The amylose content in the endosperm was measured using an amylose content kit (Shanghai Qiyi Biotechnology Co., Ltd., QYS-234044), and the results are as follows: Figure 2 As shown, the amylose content in the endosperm of both the RSM-KO-9 and RSM-KO-10 groups was significantly lower than that in the Nip endosperm. The amylopectin content in the endosperm was measured using a mylopectin content kit (Shanghai Qiyi Biotechnology Co., Ltd., QYS-234046), and the results are as follows. Figure 3 As shown, the amylopectin content in the endosperm of both the RSM-KO-9 and RSM-KO-10 groups was significantly higher than that in the Nip endosperm.

[0087] The total protein content in the endosperm was measured using a BCA protein assay kit (Shanghai Qiyi Biotechnology Co., Ltd., QYS-237013). The results are as follows: Figure 4 As shown, the total protein content in the endosperm of the RSM-KO-9 and RSM-KO-10 groups was significantly higher than that in the Nip endosperm. 0.1 g of rice flour was weighed into a 1.5 mL centrifuge tube, 1 mL of distilled water was added, and the mixture was extracted by shaking on a shaker for 2 h, followed by centrifugation at 10000 r / min for 10 min. The supernatant was poured into a 10 mL graduated test tube, and the extraction was repeated three times. The extracts were combined, and 1 mL of 0.1% Coomassie Brilliant Blue-G250 colorimetric solution was added, bringing the volume to 10 mL. The absorbance was then measured at 595 nm using a UV-754 spectrophotometer. A working curve was also constructed using bovine serum albumin standard solution, and the albumin content was calculated based on the working curve. The results are shown below. Figure 5 As shown, the albumin content in the endosperm of both the RSM-KO-9 and RSM-KO-10 groups was significantly lower than that in the Nip endosperm. 1 mL of 5% NaCl solution was added to the rice flour precipitate from which albumin was extracted to extract globulins. The extraction process was the same as the albumin content measurement method, and the results are as follows. Figure 6 As shown, the globulin content in the endosperm of both the RSM-KO-9 and RSM-KO-10 groups was significantly lower than that in the Nip endosperm. In the rice flour precipitate from which globulin had been extracted, 1 mL of 70% ethanol solution was added to extract alcohol-soluble proteins. The extraction process was the same as the method for measuring albumin content, and the results are as follows. Figure 7 As shown, the content of gliadin in the endosperm of RSM-KO-9 and RSM-KO-10 groups was significantly lower than that in the Nip endosperm. 1 mL of 0.2% NaOH solution was added to the rice flour precipitate from which gliadin was extracted, and the mixture was shaken for 2 hours. Then, it was centrifuged at 12000 r / min for 10 min to obtain the supernatant. The supernatant was poured into a 50 mL volumetric flask, and the extraction was repeated three times. The extracts were combined and diluted to 50 mL. 3 mL of the diluted solution was transferred to a 10 mL graduated tube, and 1 mL of 0.1% Coomassie Brilliant Blue-G250 colorimetric solution was added and diluted to 10 mL. The absorbance was measured at 595 nm using a UV-754 spectrophotometer. The gliadin content was calculated based on the working curve. The results are shown below. Figure 8 As shown, the gluten content in the endosperm of the RSM-KO-9 and RSM-KO-10 groups was significantly higher than that in the endosperm of the Nip group.

[0088] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. The application of a gene for storing rice endosperm storage substances, characterized in that, The applications include: knockout RSM The amino acid sequence of the gene is used to increase total protein and gluten content, and decrease globulin, prolysin, and albumin content. RSM The gene sequence is shown in SEQ ID NO: 6 in the sequence listing.

2. The application according to claim 1, characterized in that, The applications include: In the RSM RSM-T was selected as the target site for gene knockout from the gene sequence, and the sequence of RSM-T is shown in SEQ ID NO: 1 in the sequence listing; Constructed using the first forward primer, the first reverse primer, the second forward primer, and the second reverse primer according to the RSM-T. RSM The gene knockout vector has the sequence of the first forward primer as shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer as shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer as shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer as shown in SEQ ID NO: 5 in the sequence listing. The RSM Gene knockout vectors were transformed into recipient materials to obtain RSM Homozygous knockout mutant.

3. The application according to claim 2, characterized in that, The application includes: using pYLsgRNA-OsU6a plasmid as a template, amplifying it by first PCR using the first forward primer and the first reverse primer to obtain a first amplification product containing the U6b promoter of RSM-T, and amplifying it by second PCR using the second forward primer and the second reverse primer to obtain a second amplification product containing the guide sgRNA fragment of RSM-T. The first amplification product and the second amplification product are purified and recovered to obtain purified first amplification product and purified second amplification product. The purified first amplification product and the purified second amplification product were ligated by overlap PCR to obtain the ligation product. The ligation product was ligated to the pYLCRISPR / Cas9Pubi-H vector to obtain the... RSM Gene knockout vector.

4. The application according to claim 3, characterized in that, Each 50 μL of the first PCR amplification reaction system includes: 5 μL of 10×PCR Buffer; 5 μL of 2 mM dNTP; 1.5 μL of the first forward primer at a concentration of 10 μM; 1.5 μL of the first reverse primer at a concentration of 10 μM; 1 μL of template DNA; 1 μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 5 U / μL; and 35 μL of ddH2O.

5. The application according to claim 3, characterized in that, Each 50 μL reaction system for the second PCR amplification includes: 5 μL of 10×PCR Buffer; 5 μL of 2 mM dNTP; 1.5 μL of the second forward primer at a concentration of 10 μM; 1.5 μL of the second reverse primer at a concentration of 10 μM; 1 μL of template DNA; 1 μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 5 U / μL; and 35 μL of ddH2O.

6. The application according to claim 3, characterized in that, Each 50 μL of the overlap PCR reaction system comprises: 5 μL of 10×PCR Buffer; 5 μL of 2 mM dNTP; 1.5 μL of the first forward primer at a concentration of 10 μM; 1.5 μL of the second reverse primer at a concentration of 10 μM; 0.5 μL of the promoter U6a; 0.5 μL of the guide fragment sgRNA; 1 μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 1 U / μL; and 35 μL of ddH2O.

7. The application according to claim 3, characterized in that, Each 15 μL ligation reaction system comprises: 1.5 μL of 10×CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 200 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 50 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U / μL BsaI-HF restriction enzyme; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.

Images