Primer pairs and methods for identifying monosexual lines of whiteflies based on the mtCOXI gene.

Abstract

This invention discloses primer pairs and methods for identifying monosexual whitefly strains based on the mtCOXI gene, belonging to the field of agricultural biodetection technology. The primer pair sequences for identifying monosexual whitefly strains based on the mtCOXI gene are shown in SEQ ID NO.1 and SEQ ID NO.2. Based on the differential bases in the mitochondrial mtCOXI gene of C- and C+ strains of whiteflies, this invention developed primer pairs containing these differential base sequences, and subsequently developed a PCR-RFLP-based method for identifying monosexual whitefly strains. This method can rapidly, accurately, and intuitively identify different strains of whiteflies, laying the foundation for the identification of heat-resistant monosexual whitefly strains, the identification of whitefly population dynamics, and research on the biology and invasion mechanisms of whiteflies.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biological detection technology, specifically involving primer pairs for identifying mono-female whiteflies based on the mtCOXI gene and methods for identifying mono-female whiteflies. Background Technology

[0002] Heat tolerance refers to the ability of insects or other animals to adapt to temperature, or their ability to maintain normal physiological activities under high temperatures. It is also known as heat resistance. With the continuous rise in global temperatures, climate change has become a major challenge affecting the survival of some species. Most insects are poikilothermic (cold-blooded), so temperature changes have a significant impact on their survival. During global warming heat waves, many agricultural pests have experienced shortened life cycles. Sustained high temperatures cause some larvae to suffer from water imbalances, preventing them from feeding normally, thus restricting their growth and development, and ultimately leading to death.

[0003] The tobacco whitefly, *Bemisia tabaci* (Gennadius), belonging to the family Aleyrodidae in the order Hemiptera, is a highly destructive agricultural insect. This pest is considered a species complex containing at least 44 cryptospecies, which differ in many biological characteristics. Among them, the MEAM1 and MED cryptospecies have become globally invasive crop pests. One of the key factors contributing to the tobacco whitefly's rapid global spread and its status as a major pest is its strong resistance to temperature changes.

[0004] Therefore, the rapid and accurate identification of different strains of whiteflies, especially heat-resistant strains, is of great significance for monitoring whitefly population dynamics, conducting biological research, and studying invasion mechanisms. Summary of the Invention

[0005] To address the problems existing in the prior art, the purpose of this invention is to provide primer pairs and methods for identifying monosexual whiteflies based on the mtCOXI gene.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] Primer pairs for identifying mono-female whiteflies based on the mtCOXI gene are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0008] The application of the above primer pairs in the identification of mono-female whitefly strains, based on the PCR-RFLP method, was used to identify mono-female whitefly strains of C- and C+ varieties.

[0009] A method for identifying monosexual whiteflies involves extracting genomic DNA from the whitefly to be tested as a template, performing PCR amplification using the primer pair described above, digesting the PCR amplification product with a restriction endonuclease, and detecting the fragment length and number of bands by agarose gel electrophoresis of the digested product; wherein the restriction endonuclease is Earl.

[0010] Based on the above scheme, the method is used to identify mono-female whitefly strains of C- and C+ varieties.

[0011] Based on the above scheme, the agarose gel electrophoresis pattern showed a band with a length of 474 bp, indicating that the tested whitefly was strain C-; the agarose gel electrophoresis pattern showed two bands of 411 bp and 66 bp, indicating that the tested whitefly was strain C+.

[0012] Based on the above scheme, the PCR amplification system is as follows: 2 μL genomic DNA solution, 1 μL each of 10 μM positive and negative primers, 12.5 μL Premix Taq, and DEPC water to bring the total to 25 μL.

[0013] Based on the above scheme, the PCR amplification reaction conditions are as follows: 95℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 60 seconds, for 35 cycles; 72℃ extension for 2 minutes.

[0014] Based on the above scheme, the restriction endonuclease digestion conditions are: 37℃, 60 minutes.

[0015] Advantages of the technical solution of this invention

[0016] Based on the differential bases in the mitochondrial mtCOXI gene of the C- and C+ strains of whiteflies, this invention developed primer pairs for amplifying sequences containing these differential bases. Using the genomic DNA of the whitefly to be tested as a template, PCR amplification was performed using these primer pairs. The amplified products were digested with restriction endonucleases, and the length and number of bands of the digested fragments were detected by agarose gel electrophoresis. This invention aims to identify mono-female lines of C- and C+ strains of whiteflies.

[0017] This invention provides a PCR-RFLP-based method for identifying mono-female strains of whiteflies, which can rapidly, accurately, and intuitively identify different strains of whiteflies. This lays the foundation for the identification of heat-resistant mono-female strains of whiteflies, the identification of whitefly population dynamics, and the study of their biology and invasion mechanisms. Attached Figure Description

[0018] Figure 1These are agarose gel electrophoresis images of the PCR products before and after Earl digestion in Example 3 (where M: Marker 2000, from top to bottom: 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp).

[0019] Figure 2 This is an agarose gel electrophoresis image of the PCR products digested with Earl enzyme in Example 4 (where wells 1-5 are the C- strain of whitefly from Shouguang, Shandong Province, and wells 6-10 are the C+ strain of whitefly from Shouguang, Shandong Province).

[0020] Figure 3 This is an agarose gel electrophoresis image of the PCR products digested with Earl enzyme in Example 5 (where wells 1-5 are the C- strain of whitefly from Lingshui area, Hainan Province, and wells 6-10 are the C+ strain of whitefly from Lingshui area, Hainan Province). Detailed Implementation

[0021] The terminology used in this invention, unless otherwise specified, generally has the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments and data. The following embodiments are merely illustrative and are not intended to limit the scope of the invention in any way.

[0022] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the experimental materials, reagents, and chemicals used in the following embodiments can be obtained through general channels.

[0023] In the following examples, the Earl endonuclease (also known as Eam1104l, Bst6l, or Ksp632I) was purchased from Yugong Biotechnology Co., Ltd., the Premix Taq (Ex Taq) was purchased from Takara Bio Inc., the autoclaved STE (TNE) buffer (pH 8.0) was purchased from Solarbio, the Proteinase K was purchased from Aikerui Biotechnology Co., Ltd., and other reagents and consumables were all commercially available products.

[0024] The whiteflies in the following examples are Q-type whiteflies (MED cryptozoan species).

[0025] Example 1

[0026] Obtaining differential loci of the mtCOXI gene in different strains (C- and C+) of whiteflies

[0027] (1) Whiteflies were collected from Shouguang (SG), Shandong Province and Lingshui (LS), Hainan Province, respectively. [Li H, Wei X, Ding T, Chu D. Genome-Wide Profiling of Cardinium-Responsive MicroRNAs in the Exotic Whitefly, Bemisia tabaci (Gennadius) Biotype Q. Front Physiol. 2018 Nov.] The above-mentioned whiteflies were tested using the methods described in 12;9:1580.doi:10.3389 / fphys.2018.01580.PMID:30483149;PMCID:PMC6241202.] and divided into whitefly C- strain and C+ strain. Based on the methods described therein, single female lines C+ and C- with the same genetic background were constructed from whiteflies collected in Shouguang (SG) of Shandong Province and Lingshui (LS) of Hainan Province. These two strains have significant differences in biological characteristics, such as heat resistance.

[0028] (2) Based on the above method, the mitochondrial genomes of two strains (C- and C+) of whiteflies were established. The mitochondrial genome sequences of the two strains were compared using the molecular software SnapGene 5.2. It was found that the mtCOXI gene sequences of the two strains differed by only one base. Moreover, the difference in the C+ strain was the recognition site of the restriction endonuclease Earl (5'-CTCTTCN^-3'; 3'-GAGAAGNNNN^-5').

[0029] Example 2

[0030] The primer pair for identifying monosexual lines of whiteflies based on the mtCOXI gene is as follows:

[0031] Foreground primer: 5'-ATGAAAGTTTGAGCTTTTTCGACT-3' (SEQ ID NO.1);

[0032] Antisense primer: 5'-ACCTAGAATTGATGAAACACCTGC-3' (SEQ ID NO.2).

[0033] Example 3

[0034] The method for identifying mono-female whiteflies based on PCR-RFLP is as follows:

[0035] (1) Extraction of whitefly genomic DNA

[0036] A single female whitefly was placed in a 0.2 mL centrifuge tube containing 30 μL of alkaline lysis buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). The mixture was thoroughly homogenized using a pipette tip and then placed in a PCR instrument at 65°C for 15 min and 95°C for 10 min to obtain the whitefly genomic DNA solution.

[0037] (2) PCR amplification of a partial fragment of the mtCOXI gene from the whitefly

[0038] Genomic DNA solutions of whiteflies from Hainan Lingshui C- strain (LSC-), Shandong Shouguang C- strain (SGC-), Hainan Lingshui C+ strain (LSC+), and Shandong Shouguang C+ strain (SGC+) were used as templates for PCR amplification to obtain PCR amplification products.

[0039] Foreground primer: 5'-ATGAAAGTTTGAGCTTTTTCGACT-3' (SEQ ID NO.1);

[0040] Antisense primer: 5'-ACCTAGAATTGATGAAACACCTGC-3' (SEQ ID NO.2).

[0041] The PCR amplification system was as follows: 2 μL genomic DNA solution, 1 μL each of 10 μM positive and negative primers, 12.5 μL Premix Taq (Ex Taq), and DEPC water to a final volume of 25 μL.

[0042] PCR amplification conditions: 95℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 60 seconds, for 35 cycles; 72℃ extension for 2 minutes; 4℃, ∞.

[0043] (3) The PCR amplification products obtained in step (2) were detected by agarose gel electrophoresis (e.g., Figure 1 (As shown in lanes 1-4).

[0044] The PCR amplification products were sequenced to obtain the PCR amplification product sequences of Hainan Lingshui C- strain and Shandong Shouguang C- strain as shown in SEQ ID NO.3, and the PCR amplification product sequences of Hainan Lingshui C+ strain and Shandong Shouguang C+ strain as shown in SEQ ID NO.4.

[0045] SEQ ID NO.3 (5'→3')

[0046] ATGAAAGTTTGAGCTTTTTCGACTAACCATAAAGATATTGGTGTTTTATATTTTATTTTTGGTGTTTGGAGAGGATTAATTGGAACTTCTTTTAGTATAATTATTCGCTCTGAGCTTATAAATGTTGGGTCTTTTATATCAAATGAGCATTTATATAATGTTGTTGTAACTTCTCATGCTTTTATTATGATTTTTTTTATAACAATGCCACTAGTTATTGGTGGTTTTGGTAATTGGCTTATCCCTCTGATAATTGGTGCTCCTGACATAGCTTTTCCTCGTATGAACAACTTGAGGTTTTGACTTTTAGTTCCTTCATTAATTTTTATGTTGGTAAGAATGATTGTTAGGACAGGAGCTGGTACTGGCTGGACTGTTTATCCTCCCCTGTCTTTAAGATTAACTCATAGAGGCTTATCAGTTGATTTATTAATTTTTTCTTTGCACATTGCAGGTGTTTCATCAATTCTAGGT

[0047] SEQ ID NO.4(5’→3’)

[0048] ATGAAAGTTTGAGCTTTTTCGACTAACCATAAAAGATATTGGTGTTTTATATTTTATTTTTGGTGTTTGAAGAGGATTAATTGGAACTTCTTTAGTATAATTCGCTCTGAGCTTATAAATGTTGGGTCTTTTATATCAAATGAGCATTTATATAATGTTGTTGTAACTTCTCATGCTTTTATTATGATTTTTTTTATAACAATGCCACTAGTTATTGGTGGTTTTGGTAATTGG CTTATCCCTCTGATAATTGGTGCTCCTGACATAGCTTTTCCTCGTATGAACAACTTGAGGTTTTGACTTTTAGTTCCTTCATTAATTTTTATGTTGGTAAGAATGATTGTTAGGACAGGAGCTGGTACTGGCTGGACTGTTTATCCTCCCCTGTCTTTAAGATTAACTCATAGAGGCTTATCAGTTGATTTATTAATTTTTTCTTTGCACATTGCAGGTGTTTCATCAATTCTAGGT

[0049] (4) The PCR amplification product obtained in step (3) is digested with the restriction endonuclease Earl to obtain the digested product.

[0050] Enzyme digestion system: 2 μL of 10×CutOne Buffer, 5 μL of PCR amplification product, 1 μL of Earl restriction enzyme, and DEPC water to bring the total to 20 μL.

[0051] Reaction conditions: Place in a PCR instrument at 37°C for 60 minutes.

[0052] (5) Separate the enzyme digestion products obtained in step (4) by agarose gel electrophoresis, and image them on a UV gel imager to observe their polymorphism.

[0053] The results showed that the restriction endonuclease Earl digestion results showed a 474bp band on the imaging films of the Hainan Lingshui C- strain (LSC-) and the Shandong Shouguang C- strain (SGC-). The electrophoresis patterns of the Hainan Lingshui C+ strain (LSC+) and the Shandong Shouguang C+ strain (SGC+) showed two bands of 411bp and 66bp (including sticky terminal bases) in the tested samples (e.g., Figure 1 (As shown in lanes 6-9).

[0054] Example 4

[0055] The method for identifying mono-female whiteflies based on PCR-RFLP is as follows:

[0056] (1) Extraction of whitefly genomic DNA

[0057] Five female whiteflies were randomly selected from two single-female lines, C- and C+, established in the laboratory in Shouguang, Shandong Province. They were placed in 0.2 mL centrifuge tubes containing 30 μL of alkaline lysis buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). After thorough homogenization with a pipette tip, the mixture was placed in a PCR instrument at 65℃ for 15 min and then at 95℃ for 10 min to obtain whitefly genomic DNA solution.

[0058] (2) PCR amplification of a partial fragment of the mtCOXI gene from the whitefly

[0059] PCR amplification was performed using genomic DNA solutions of the Shandong Shouguang C- strain (SGC-) and the Shandong Shouguang C+ strain (SGC+) as templates to obtain PCR amplification products.

[0060] Foreground primer: 5'-ATGAAAGTTTGAGCTTTTTCGACT-3' (SEQ ID NO.1);

[0061] Antisense primer: 5'-ACCTAGAATTGATGAAACACCTGC-3' (SEQ ID NO.2).

[0062] The PCR amplification system was as follows: 2 μL genomic DNA solution, 1 μL each of 10 μM positive and negative primers, 12.5 μL Premix Taq (Ex Taq), and DEPC water to a final volume of 25 μL.

[0063] PCR amplification conditions: 95℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 60 seconds, for 35 cycles; 72℃ extension for 2 minutes; 4℃, ∞.

[0064] (3) The PCR amplification product obtained in step (2) is digested with the restriction endonuclease Earl to obtain the digested product;

[0065] Enzyme digestion system: 2 μL of 10×CutOne Buffer, 5 μL of PCR amplification product, 1 μL of Earl restriction enzyme, and DEPC water to bring the total to 20 μL.

[0066] Reaction conditions: Place in a PCR instrument at 37°C for 60 minutes.

[0067] (4) Separate the enzyme digestion products obtained in step (3) by agarose gel electrophoresis, and image them on a UV gel imager to observe their polymorphism.

[0068] The results showed that the imaging films of the Shandong Shouguang C- strain in wells 1-5 contained a band with a length of 474 bp; the electrophoretic patterns of the Shandong Shouguang C+ strain in wells 6-10 showed two bands, 411 bp and 66 bp (including sticky terminal bases), in the tested samples (e.g. Figure 2 ).

[0069] Example 5

[0070] The method for identifying mono-female whiteflies based on PCR-RFLP is as follows:

[0071] Genomic DNA was extracted from two single female lines, C- and C+, established in the laboratory in Lingshui, Hainan; the detection method was the same as in Example 4.

[0072] Imaging the agarose gel electrophoresis results on a UV gel imager showed that the imaging films of samples from wells 1-5 (Hainan Lingshui C- strain) contained a band with a length of 474 bp; the electrophoresis patterns of samples from wells 6-10 (Hainan Lingshui C+ strain) showed two bands, 411 bp and 66 bp (including sticky terminal bases), in the tested samples (e.g., Figure 3 )

[0073] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. The application of primer pairs in identifying mono-female whiteflies, characterized in that, The PCR-RFLP method was used to identify single female whitefly lines of C- and C+ strains; the primer pairs are shown in SEQ ID NO.1 and SEQ ID NO.

2. Genomic DNA was extracted from the whitefly to be tested and used as a template. PCR amplification was performed using primer pairs. The PCR amplification products were digested with restriction endonucleases. The digested products were then analyzed by agarose gel electrophoresis to detect the fragment length and number of bands. The restriction endonuclease used was Earl. The agarose gel electrophoresis pattern showed a band with a length of 474 bp, indicating that the tested whitefly was strain C-; the agarose gel electrophoresis pattern showed two bands of 411 bp and 66 bp, indicating that the tested whitefly was strain C+. The whitefly in question is the Q-type whitefly.

2. A method for identifying mono-female whiteflies, characterized in that, Genomic DNA was extracted from the whitefly to be tested and used as a template. PCR amplification was performed using primer pairs. The PCR amplification products were digested with restriction endonucleases. The digested products were then analyzed by agarose gel electrophoresis to detect the fragment length and number of bands. The restriction endonuclease used was Earl. The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; The method is used to identify mono-female whitefly strains of C- and C+ varieties; The agarose gel electrophoresis pattern showed a band with a length of 474 bp, indicating that the tested whitefly was strain C-; the agarose gel electrophoresis pattern showed two bands of 411 bp and 66 bp, indicating that the tested whitefly was strain C+. The whitefly in question is the Q-type whitefly.

3. The method for identifying mono-female whiteflies according to claim 2, characterized in that, The PCR amplification system consisted of 2 µL of genomic DNA solution, 1 µL each of 10 µM positive and negative primers, 12.5 µL of Premix Taq, and DEPC water to a final volume of 25 µL.

4. The method for identifying mono-female whiteflies according to claim 3, characterized in that, The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 60 seconds, for 35 cycles; 72℃ extension for 2 minutes.

5. The method for identifying mono-female whiteflies according to claim 2, characterized in that, The restriction endonuclease digestion conditions are: 37°C, 60 minutes.

Images