Application of plant extract tribuloside in preparation of medicine for resisting canine coronavirus

Abstract

The application discloses application of a plant extract, tribuloside, in preparation of a medicine for resisting canine coronavirus, and relates to the technical field of biological medicine.The application finds that the plant extract, tribuloside, has the activity of resisting canine coronavirus.The plant extract in the application is derived from a natural plant, and has the advantages of low toxicity and good biocompatibility, as compared with chemical medicines.The application provides technical support for development of novel, effective, safe and side-effect-free medicine preparations for preventing and treating canine coronavirus.

Description

TECHNICAL FIELD

[0001] The application relates to the field of biological medicine, in particular to application of plant extract trigozogenin in preparation of a medicine for resisting canine coronavirus. BACKGROUND

[0002] Due to the vigorous development of the pet market in China and the sharp increase in the number of pet dogs, the canine coronavirus infection of various types of dogs such as pet dogs, working dogs and experimental dogs is gradually increasing. The canine coronavirus infection is mostly not fatal, but the symptoms such as dehydration, vomiting and diarrhea when the disease occurs will still cause losses to the sick dogs, the families of the sick dogs and the dog breeding industry. In clinical treatment, the prevention and treatment of canine coronavirus mainly relies on vaccine immunization, and there are also biological preparations such as triple serum, pentad serum, immunoglobulin and monoclonal antibody. However, because there are many brands on the market, the prevention and treatment effects are different, the curative effects of serum and monoclonal antibody biological preparations are gradually weakened, and the vaccines and antibodies have certain limitations, in addition, various preparations as auxiliary therapies have caused drug resistance in different degrees, so it has become the latest development goal to develop novel, effective, safe and side-effect-free drug preparations for preventing and treating canine coronavirus.

[0003] Generally, compared with chemical drugs, plant secondary metabolites derived from nature have lower toxicity and stronger affinity to biological macromolecules, and natural compounds often have the characteristics of multi-target and multi-physiology. Due to the increasingly serious drug resistance of antiviral drugs, and the prohibition of antiviral drugs in veterinary clinics, it has gradually become a hot spot in the field of antiviral research to find antiviral active substances from natural products.

[0004] Plant extracts have been widely used in various fields, and have significant pharmacological effects in antibacterial, anti-inflammatory, antioxidant, antitumor and immunomodulatory aspects. However, there is currently a lack of systematic research reports on the antiviral effect of plant extracts, and the related application of plant extracts in companion animal and small animal diseases is still lacking, and the efficacy and specific mechanism are not clear.

[0005] Therefore, the application plans to take canine coronavirus as the object to explore the specific mechanism of the antiviral effect of plant extracts, identify the key signal pathways affected by plant extracts, so as to provide a new idea for preventing and treating small animal diseases by using plant extracts. SUMMARY

[0006] The application aims to provide application of plant extract trigozogenin in preparation of a medicine for resisting canine coronavirus, so as to solve the problems in the prior art. The application researches and finds that the plant extract trigozogenin has the activity of resisting canine coronavirus, and therefore can be applied to preparation of a medicine for resisting canine coronavirus.

[0007] To achieve the above object, the present application provides the following scheme:

[0008] The present application provides an application of a plant extract in preparing a medicine for resisting canine coronavirus, wherein the plant extract is a tribuloside.

[0009] Further, the medicine comprises a pharmaceutically acceptable excipient.

[0010] Further, the excipient comprises a solubilizer, a binder, a disintegrant, a filler, a stabilizer, a preservative, a coating material and / or a fragrance.

[0011] Further, the dosage form of the medicine is a granule, a tablet, a capsule, a powder, a pill, an injection or an oral liquid.

[0012] The present application discloses the following technical effects:

[0013] The present application discloses that a plant extract tribuloside has an activity of resisting canine coronavirus. BRIEF DESCRIPTION OF DRAWINGS

[0014] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments will be briefly introduced below, and obviously, the drawings in the following description are only some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0015] Figure 1 A result graph of CCK-8 method for detecting the cytotoxicity of chlorogenic acid on CRFK;

[0016] Figure 2 A result graph of CCK-8 method for detecting the cytotoxicity of theoglycoside on CRFK;

[0017] Figure 3 A result graph of CCK-8 method for detecting the cytotoxicity of shikimic acid on CRFK;

[0018] Figure 4 A result graph of CCK-8 method for detecting the cytotoxicity of phloretin on CRFK;

[0019] Figure 5 A result graph of CCK-8 method for detecting the cytotoxicity of caffeic acid on CRFK;

[0020] Figure 6Figure for CCK-8 method to detect the cytotoxicity of apple polyphenols on CRFK;

[0021] Figure 7 Figure for CCK-8 method to detect the cytotoxicity of echinacoside on CRFK;

[0022] Figure 8 Figure for CCK-8 method to detect the cytotoxicity of neomethylhesperidin-dihydrochalcone on CRFK;

[0023] Figure 9 Figure for CCK-8 method to detect the cytotoxicity of marigold flavonoids on CRFK;

[0024] Figure 10 Figure for CCK-8 method to detect the cytotoxicity of berberine hydrochloride on CRFK;

[0025] Figure 11 Figure for standard curve of fluorescent quantitative PCR;

[0026] Figure 12 Figure for virus load statistics of preliminary screening experiment of inhibition effect of plant extracts on CCoV;

[0027] Figure 13 Figure for CCK-8 method to detect the inhibition rate of phloretin on CCoV-induced CRFK cell lesions at different concentrations;

[0028] Figure 14 Figure for growth curve of CCoV in CRFK at different phloretin concentrations;

[0029] Figure 15 Figure for virus load statistics of CCoV in CRFK at the 4th hour at different phloretin concentrations;

[0030] Figure 16 Figure for virus load statistics of CCoV in CRFK at the 8th hour at different phloretin concentrations;

[0031] Figure 17 Figure for virus load statistics of CCoV in CRFK at the 12th hour at different phloretin concentrations;

[0032] Figure 18 Figure for virus load statistics of CCoV in CRFK at the 18th hour at different phloretin concentrations;

[0033] Figure 19 Figure for virus load statistics of CCoV in CRFK at the 24th hour at different phloretin concentrations;

[0034] Figure 20A graph of viral load at 36h in CRFK for CCoV under different phloretin concentrations;

[0035] Figure 21 A graph of viral load at 48h in CRFK for CCoV under different phloretin concentrations;

[0036] Figure 22 A graph of results for the direct killing of virus experiment;

[0037] Figure 23 A graph of results for the inhibition of virus adsorption experiment;

[0038] Figure 24 A graph of results for the inhibition of virus growth experiment. DETAILED DESCRIPTION

[0039] Various illustrative embodiments of the present application are described in detail below. This detailed description is not intended to be a limitation on the application, but rather an exemplification of the present application and some of its aspects and features. Thus, the application is not intended to be limited to the variations of the specific embodiments described, and it is intended to cover any and all modifications of the application within the scope of the present application along with any and all equivalents of the application.

[0040] It should be understood that the terms used herein are for the purpose of describing particular embodiments and are not intended to limit the application. Additionally, for a range of values of a parameter, unless otherwise stated, each intervening value by each intervening value, as well as any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these intervening values can independently be included or excluded in the range, and each smaller range that falls within the ambit of the recited, larger range is also encompassed. All ranges and parameters, these smaller ranges – whether mobile or stationary, and any other stated or intervening value in the stated ranges, are approximate values. Accordingly, the application described herein includes all such ranges and parameters.

[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the present specification will control.

[0042] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0043] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.

[0044] Glossary of Terms:

[0045] Phloretin, also known as trihydroxyphenol propenone 2,4,6-trihydroxy-3-(4- hydroxyphenyl)propanone, belongs to flavonoids, mainly distributed in the peel and root bark of juicy fruits such as apples and pears, and its molecular formula is C 15 H 14 O5, CAS No. 60-82-2, and its structural formula is as follows:

[0046]

[0047] Shikimic acid, molecular formula C7H 10 O5, CAS No. 138-59-0, and its structural formula is as follows:

[0048]

[0049] Caffeic acid, molecular formula C9H8O4, CAS No. 331-39-5, and its structural formula is as follows:

[0050]

[0051] Tripterygium wilfordii saponin, molecular formula C 30 H 26 O 13 , CAS No. 22153-44-2, and its structural formula is as follows:

[0052]

[0053] Berberine hydrochloride, molecular formula C 20 H 18 NO4Cl, CAS No. 633-65-8, and its structural formula is as follows:

[0054]

[0055] Apple polyphenol is a polyphenol extracted from apples, and its CAS No. is 85251-63-4.

[0056] Example 1

[0057] 1 Test material

[0058] 1.1 Cells and viruses

[0059] Primary cat kidney cells (CRFK); canine coronavirus (CCoV).

[0060] 1.2 Main reagents (see Table 1)

[0061] Table 1 Main reagents

[0062]

[0063] 1.3 Main instruments and equipment (see Table 2)

[0064] Table 2 Main instruments and equipment

[0065]

[0066]

[0067] 1.4 Primer sequence

[0068] The primer sequence involved in the present application is shown in Table 3.

[0069] Table 3 Primer sequence

[0070] Primer name Nucleotide sequence (5’-3’) CCoV24-F CCCATTGTTTTGGCTCT CCoV24-R CCATCCTGTTGCACTACTT CCoVII-F CCTGAGACTAATGCAATTC CCoVII-R CCCTGAAAGCAATGTTAA Probe ACACCAGTTGGCACACCTTCTA

[0071] 2. Test method

[0072] 2.1 Cell culture

[0073] 2.1.1 Cell recovery

[0074] The CRFK cell cryopreservation tube was quickly taken out from liquid nitrogen and immediately placed in a 37°C water bath, and the cell cryopreservation solution was quickly melted by shaking. The cryopreservation tube was wiped with 75% alcohol cotton, the tube cap was opened in the biological safety cabinet, and the cell suspension was aspirated and centrifuged at 1000 rpm for 5 min. The cryopreservation solution was aspirated. The cell culture was prepared.

[0075] 2.1.2 Cell culture

[0076] The centrifuged cells were resuspended with 10% fetal bovine serum (FBS) DMEM medium, inoculated into a T25cm 2 cell bottle, and the cell bottle was placed in a cell culture incubator (37°C, 5% CO2). The growth state of the cells was observed on the second day, and the cells were passaged when they were basically covered with a single layer.

[0077] When passaging, the old cell liquid was poured out and washed once with PBS. Then 1 mL of trypsin was added to immerse the cell monolayer, and placed in a cell culture incubator for 1 min. When the cell layer was observed to be like sand, the trypsin and cells were collected using a pipette gun, centrifuged at 1000 rpm for 5 min, and the trypsin was aspirated after centrifugation. 10% FBS DMEM medium was added to terminate digestion, and the cells were repeatedly blown and beaten with a graduated pipette until the cells were completely dispersed and resuspended. The cells were inoculated into new cell bottles at a ratio of one to two and placed in a culture incubator (37°C, 5% CO2) for culture.

[0078] 2.2 Virus culture:

[0079] When the single layer of cells reached 80%, the culture medium was discarded and the cells were washed once with PBS. The CCoV strain was taken out from the -80 °C refrigerator, melted on ice, and 100 μL was inoculated into the cell bottle. The cell bottle was then placed in a cell culture incubator for 1 h for virus adsorption. After 1 h, 10% FBS DMEM medium was added, and the cell bottle was placed in a cell culture incubator for continuous observation for 72 h to observe the cytopathic state.

[0080] 2.3 Determination of the median tissue culture infective dose (TCID 50 ) of the virus

[0081] CRFK cells were inoculated in a 96-well plate, and when they reached 80%, the cell culture medium was discarded and the cells were washed once with PBS. The CCoV stock solution was serially diluted 10-fold with serum-free DMEM medium to obtain a virus dilution of 10 -1 -10 -9 . Each dilution of the virus solution was added to each well, 100 μL per well, with 8 replicate wells for each dilution. After that, the 96-well plate was placed in a 37 °C, 5% CO2 cell culture incubator for 72 h, and the cytopathic effect was observed. The median tissue culture infective dose (TCID 50 ) of the virus was calculated according to the Reed-Muench formula.

[0082] 2.4 Detection of plant extract toxicity to CRFK cells by CCK-8 method

[0083] Each plant extract was dissolved in DMSO and filtered through a 0.22 μm filter to prepare a 200 mg / L stock solution. Each plant extract solution was serially diluted 2-fold with 2% FBS DMEM cell culture medium to obtain a final concentration of 200, 100, 50, 25, 12.5, 6.25, 3.13, and 1.56 mg / L of drug solution. 10 6 mL of CRFK cell suspension was inoculated in a 96-well plate, and after the cells reached a single layer, the culture medium was discarded and plant extract solutions with different concentrations were added, 100 μL per well, with 3 replicates for each concentration. The 96-well plate with the added drug solution was placed in a 37 °C, 5% CO2 incubator for 48 h. After that, the culture medium was discarded and the cells were washed once with PBS. Then 10 μL of CCK-8 reagent was added to each well, and the plate was returned to the incubator for 1 h. After that, the absorbance of each well at OD 450nm was detected using a microplate reader, and the toxicity of plant extracts at different concentrations to CRFK cells was calculated.

[0084] 2.5 Real-time fluorescent quantitative PCR to detect the effect of plant extracts on CCoV M gene expression

[0085] 2.5.1 Establishment of absolute fluorescent quantitative method for CCoV

[0086] (1) Primer design

[0087] According to the sequence of the M gene of canine coronavirus published in NCBI GenBank, a pair of primers CCoV24-F / R (see Table 3) were designed by using Premier 6.0 software, synthesized by Beijing Ruibokexing Gene Technology Co., Ltd., and the expected length of the PCR amplification product was 420 bp.

[0088] (2) Extraction of CCoV viral gene and synthesis of cDNA

[0089] The diseased cells were harvested according to the previous steps of culturing the virus, and after repeated freeze-thawing, the viral RNA was extracted according to the operation steps of the kit. The concentration was detected by using a nucleic acid protein instrument, and then immediately placed at -80°C for standby; at the same time, a part of the RNA was immediately reverse transcribed according to the operation steps of the kit, and the obtained cDNA was placed at -20°C for standby.

[0090] The reverse transcription reaction system and conditions are as follows:

[0091] Reverse transcription reaction system: 5x FastKing-RT SuperMix 4 μL, RNA 50 ng-2 μg, RNase free H2O to 20 μL.

[0092] The reverse transcription reaction conditions were set as follows: 42°C for 15 min, 98°C for enzyme inactivation for 3 min.

[0093] (3) Establishment of gene plasmid standard positive template:

[0094] The cDNA obtained by reverse transcription was used as a template, and amplification was performed according to the general PCR reaction system and reaction conditions. The PCR amplification reaction system and reaction conditions are as follows:

[0095] PCR amplification reaction system: Prime Star Mix (10x) 10 μL, upstream primer 1 μL, downstream primer 1 μL, cDNA 1 μL, and RNase free H2O 7 μL.

[0096] The PCR amplification reaction conditions were set as follows: 98°C for 3 min of pre-denaturation; 98°C for 15 s, 55°C for 30 s of annealing, 72°C for 30 s of extension, 30 cycles; 72°C for 5 min of extension.

[0097] After amplification, 5 μL of the reaction solution was taken for 1% agarose gel electrophoresis detection, and a gel recovery kit was used to recover the target DNA fragment. The recovered target DNA fragment was linked with pTOPO vector (purchased from Beijing Aidley Biotechnology Co., Ltd.) and transformed into DH5a competent cells, which were cultured overnight on LB agar containing ampicillin. After single colony picking and PCR identification, the positive plasmid with correct sequencing was sent to Beijing Qikang Biotechnology Co., Ltd. for sequencing, and the positive plasmid with correct sequencing was used for later experiments.

[0098] (4) qRT-PCR primer and probe design

[0099] The sequence obtained by sequencing was introduced into NCBI for BLAST comparison, and the primer pair CCoV II-F / R and the probe Probe (see Table 3) were designed according to the CCoV sequence published in NCBI GenBank using Beacon Designer 8.14 software. The reaction system was confirmed, and Beijing Ruibo Kexing Gene Technology Co., Ltd. was entrusted with synthesis. The expected length of the PCR amplification product was 102 bp.

[0100] The qRT-PCR reaction system and reaction conditions are as follows:

[0101] qRT-PCR reaction system: Premix EX Taq (Probe qRT-PCR) (2x) 10 μL, upstream primer 0.4 μL, downstream primer 0.4 μL, probe 0.8 μL, ROX Reference Dye II (50x) 0.2 μL, cDNA 2 μL and RNase free H2O 6.2 μL.

[0102] Applied Biosystems 7500 Real-Time PCR System was used for the experiment, and the reaction condition was two-step amplification standard program, set as 98℃ pre-denaturation for 30 sec; 95℃ for 5 s, 60℃ for 34 s, 40 cycles.

[0103] (5) Preparation of standard curve

[0104] The obtained positive plasmid was diluted by 10-fold gradient, and 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 , 10 -10 , 10 -11Seven continuous gradient dilutions were used as reaction templates for qRT-PCR, with ddH2O as a negative control; the logarithm of the template standard copy number was used as the abscissa, and the Ct value of the amplification curve was used as the ordinate to establish a standard curve. The standard curve equation and curve correlation coefficient R were calculated 2 , the amplification efficiency E.

[0105] 2.6 Evaluation of the effect of plant extracts on the inhibition of CCoV

[0106] Select 12.5 mg / L as the initial screening concentration. Inoculate CRFK cells in a 6-well cell culture plate, and when the cell density reaches 80%, discard the culture medium, wash 3 times, and then inoculate 100 μL of 100 TCID 50 of CCoV virus solution, incubate in a 5% CO2, 37°C cell incubator for 1 h, and then add 12.5 mg / L of plant extract solution, with three replicates per group.

[0107] Place the above cell culture plates in a 5% CO2, 37°C cell incubator for culture, discard the supernatant after 48 h, collect the cells, extract RNA, and perform reverse transcription. Perform qRT-PCR on each group of samples to detect the CCoV M gene in each group of samples, and calculate the CCoV copy number in each sample according to the standard curve formula.

[0108] 2.7 EC of phloretin on CCoV 50 detection

[0109] Add 50 μL of 100 TCID 50 of CCoV virus solution to a 96-well plate with a monolayer of CRFK cells, and add different concentrations of phloretin, so that the final concentration of phloretin in each culture well is 12.5 mg / L, 6.25 mg / L, 3.125 mg / L, 1.563 mg / L, 0.781 mg / L, 0.391 mg / L, 0.195 mg / L, and 0.098 mg / L. Place the treated cell culture plates in a 37°C, 5% CO2 cell incubator for culture for 48 h, observe the cytopathic effect (CPE), take photos, and calculate the median effective concentration of the drug according to the Reed-Muench formula. The calculation formula is as follows:

[0110] EC 50 = C x 2 -S ;

[0111] S = N - 1 + (H - R) / (H - L);

[0112] In the formula, N represents the drug concentration number higher than 50% inhibition; H represents the inhibition rate higher than 50%; L represents the inhibition rate lower than 50%; R is 50%; and C represents the drug concentration of the experimental group with a serial number of 1.

[0113] 2.8 Effect of Phloretin on the Growth Curve of CCoV in CRFK

[0114] CRFK cells were inoculated in 6-well cell culture plates, and when the cell density reached 80%, the culture medium was discarded and the cells were washed 3 times. Then 100 μL of 100 TCID 50 of CCoV virus solution was added, and the plates were incubated in a cell incubator for 1 h. Then different concentrations of phloretin solution were added, and the final concentrations of the drug solution were 12.5 mg / L, 6.25 mg / L and 3.125 mg / L, respectively. A virus control group without the drug was also set up, and each group was repeated three times.

[0115] The cell culture plates in each group were placed in a cell incubator at 37°C with 5% CO2, and the supernatant was discarded at 4 h, 8 h, 12 h, 18 h, 24 h, 36 h and 48 h to collect the cells and extract RNA for reverse transcription. The cDNA samples obtained from each group were subjected to qRT-PCR to detect the CCoV M gene in each sample, and the copy number of CCoV in each sample was calculated according to the standard curve formula to draw the virus growth curve under the influence of phloretin.

[0116] 2.9 Determination of the mode of action of phloretin in inhibiting CCoV

[0117] (1) Direct inactivation of the virus

[0118] 100 μL of 100 TCID 50 of CCoV virus solution was mixed with 12.5 mg / L of drug solution, and 100 TCID 50 of virus solution without the drug was set up as a control. Both were incubated in a 37°C incubator for 1 h, then inoculated into 6-well cell culture plates with a single layer of CRFK cells, and incubated at 37°C with 5% CO2 for 1 h. The supernatant was then discarded, the cell culture plates were washed 3 times, and 2% cell maintenance solution was added for 48 h. The RNA of each sample was collected, and the copy number of virus was detected by qRT-PCR.

[0119] (2) Inhibition of virus adsorption process:

[0120] 100 μL of 100 TCID 50 of CCoV virus solution was inoculated into 6-well cell culture plates with a single layer of CRFK cells, and 12.5 mg / L of drug solution was added. A control group without the drug was set up, and both were incubated at 37°C with 5% CO2 for 1 h. The supernatant was then discarded, the cell culture plates were washed 3 times, and 2% cell maintenance solution was added for 48 h. The RNA of each sample was collected, and the copy number of virus was detected by qRT-PCR.

[0121] (3) Inhibition of virus growth and reproduction:

[0122] 100 μL 100 TCID 50 of CCoV virus solution was added into 6-well cell culture plates with single layer of CRFK cells, and then incubated at 37℃ with 5% CO2 for 1 h. The supernatant was discarded, and the cell culture plates were washed 3 times. Then, 12.5 mg / L of each drug solution and culture medium without drug were added as a control group, and incubated at 37℃ with 5% CO2 for 48 h. The RNA of each sample was collected, and the viral copy number was detected by qRT-PCR.

[0123] 3 Test results

[0124] 3.1 Determination results of viral median tissue culture infective dose (TCID 50 ) of CCoV

[0125] Different dilution multiples of CCoV virus solution were added into cell culture plates with single layer of CRFK cells, and then incubated at 37℃ with 5% CO2 for 72 h. The cytopathic effect (CPE) was observed and recorded. The results are shown in Table 4. The TCID 50 value of 10 5.903 / 100 μL was calculated according to the Reed-Muench formula.

[0126] Table 4 Determination results of viral TCID 50 of CCoV

[0127]

[0128] 3.2 Results of CCK-8 method for detecting cytotoxicity of drugs on CRFK

[0129] The CCK-8 method was used to detect the effect of different concentrations of plant extracts on the activity of CRFK cells. The results are shown in Table 5. The results showed that the plant extracts had relatively light cytotoxicity on the cells at a concentration of 12.5 mg / L or below. Figures 1-10

[0130] 3.3 Real-time fluorescent quantitative PCR for detecting the effect of plant extracts on viral expression

[0131] (1) Construction of CCoV recombinant positive plasmid:

[0132] The CCoV gene fragment was amplified by a general PCR reaction system. The size of the amplified CCoV gene fragment was about 420 bp, which was consistent with the expected product size, indicating that the target gene fragment was correctly amplified. The amplified product was gel recovered and connected with the pTOPO-TA vector. The positive plasmid with correct sequencing was named pTOPO-CCoV. The extracted plasmid was determined by a nucleic acid protein detector, and the concentration was 199.5 ng / μL, OD 260 / OD 280 ​The value is 1.98, which meets the purity requirements. Converted to a copy number using the formula, it is 4.3 × 10⁻⁶. 11 copies / μL.

[0133] (2) Preparation of the absolute fluorescence quantitative standard curve for CCoV:

[0134] Select 10 positive standards -5 10 -6 10 -7 10 -8 10 -9 10 -10 10 -11 Seven dilutions were used as reaction templates, with ddH2O as a negative control. A standard curve was constructed by plotting the logarithm of the template standard copy number on the x-axis and the Ct value of the amplification curve on the y-axis. The results are shown in [Figure number missing]. Figure 11 .

[0135] The results showed that in 10 -5 -10 -9 Within the dilution range, a good linear relationship is observed.

[0136] The standard curve and regression equation are Y = -3.4794X + 0.2896, and the correlation coefficient R0 is... 2 =0.998, amplification efficiency E=93.8%, which meets the requirements and can be used for quantitative detection of CCoV.

[0137] 3.4 Evaluation of the inhibitory effect of plant extracts on cCoV

[0138] Based on the results of cytotoxicity tests, this invention provides a preliminary screening of the antiviral effects of various plant extracts. The viral load detection results for each treatment group are shown below. Figure 12 The results showed that shikimic acid, phlorizin, caffeic acid, tribulus saponins, berberine hydrochloride, and apple polyphenols had anti-canine coronavirus effects (P < 0.0001), among which phlorizin had the most significant effect. Therefore, phlorizin was selected for the next step of the experiment.

[0139] 3.5 Phloretin acts on cCoV EC 50

[0140] To verify the antiviral effect of phlorizin, this invention selected cCoV as the test virus. cCoV and phlorizin solution were inoculated onto CRFK cells, and ECMO was performed. 50 The calculations and test results are shown in Tables 5 and 6. Figure 13 By observing the cytotoxic effects of phlorizin at different concentrations on CCoV-induced CRFK cell cytopathic effects, and combining this with the CCK-8 assay to detect the inhibitory effect of phlorizin on CCoV-induced EC50, the EC50 of phlorizin on CCoV was finally calculated. 500.616 mg / L.

[0141] Table 5 Inhibitory effect of different concentrations of phloretin on CCoV

[0142]

[0143] Table 6 Mean CCK-8 absorbance under different phloretin concentrations

[0144]

[0145] 3.6 Effect of phloretin on the growth curve of CCoV in CRFK

[0146] Cells in different phloretin concentration treatment groups and virus infection groups were collected at 4h, 8h, 12h, 18h, 24h, 36h and 48h, RNA was extracted using RN27 virus RNA rapid extraction kit, and immediately reverse transcribed into cDNA. The purity was detected by nucleic acid protein detector, and the copy number of CCoV in each sample was detected by the absolute fluorescent quantitative PCR detection method established in the previous text, the growth curve was drawn, and the comparison results of the total trend and each time point are shown in Figures 14-21 .

[0147] In the virus control group, the copy number of CCoV gradually increased after the virus infected CRFK cells for 4-24h, reached a peak during 24-36h, and gradually decreased during 36-48h, which may be due to the large number of cell death caused by the large number of virus particles at this stage, affecting the further proliferation of the virus; After adding phloretin treatment, the proliferation of CCoV in CRFK cells was significantly inhibited.

[0148] 3.7 Determination results of phloretin inhibiting CCoV

[0149] Phloretin was dissolved in the culture medium to prepare a solution with a concentration of 12.5 mg / L, and was co-cultured with CCoV in CRFK cells at different stages, and a pure virus control was set up; After harvesting the cells, nucleic acids were extracted, and the load of canine coronavirus under the action of phloretin was detected by the fluorescent quantitative PCR method determined in the previous text, and the results are shown in Figures 22-24 .

[0150] According to Figures 22-24 It can be seen that phloretin has antiviral activity in direct killing, inhibiting virus adsorption and inhibiting virus growth, among which the effect of inhibiting virus growth is the most significant.

[0151] The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application.

Claims

1. Use of a plant extract for the preparation of a medicament against canine coronavirus, characterized in that, The plant extract is tribuloside; The CAS number of the tribuloside is 22153-44-2.

2. Use according to claim 1, characterized in that, The medicine includes a pharmaceutically acceptable excipient.

3. Use according to claim 2, characterized in that, The excipient includes a cosolvent, a binder, a disintegrant, a filler, a stabilizer, a preservative, a coating material, and / or a fragrance.

4. Use according to claim 2, characterized in that, The dosage form of the medicine is a granule, a tablet, a capsule, a powder, a pill, an injection, or an oral liquid.

Images