Application of circSATB1 in preparation of medicine for improving sheep fecundity

Abstract

The invention discloses application of circSATB1 in preparation of a medicine for improving sheep fecundity, and belongs to the technical field of biological medicine. The nucleotide sequence of the circSATB1 is as shown in SEQ ID NO. 1. The circRNA expression profile of the sheep seminal plasma extracellular vesicles is analyzed for the first time, the expression quantity of circSATB1 in the seminal plasma extracellular vesicles is high, proliferation and migration of endometrial epithelial cells can be remarkably promoted through overexpression of circSATB1, and apoptosis of the endometrial epithelial cells is remarkably inhibited. If circSATB1 is interfered, proliferation and migration of endometrial epithelial cells can be extremely remarkably inhibited, and apoptosis of the endometrial epithelial cells can be extremely remarkably promoted. All the results prove that circSATB1 has important significance in endometrial receptivity formation, and a new thought is provided for improving the implantation rate of female livestock embryos.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to the application of circSATB1 in the preparation of drugs for improving the fertility of sheep. Background Art

[0002] During the normal physiological cycle of mammals, the endometrium can only accept embryo implantation within a very short period of time, which is called the "window period", and is a necessary condition for embryo positioning, adhesion and implantation. The endometrium has the greatest receptivity within the "window period", which means that the formation of endometrial receptivity is the key to the success of embryo implantation. When the endometrial environment is not suitable for embryo implantation, pregnancy failure will occur (Hu et al., 2023). Recently, more and more studies have confirmed that paternal factors such as seminal plasma regulate biological processes such as embryo development, endometrial receptivity formation, and embryo implantation by interacting with the female reproductive tract during the reproductive process (Ahmadi et al., 2022).

[0003] Extracellular vesicles (EVs) are membrane-bound vesicles widely present in biological fluids. They play an important regulatory role in cell-to-cell communication by selectively transferring small molecule substances such as proteins, circRNAs, miRNAs, and mRNAs carried by them to target cells (Kalluri and LeBleu, 2020). In 2022, Gholipour et al. first found that seminal plasma EVs in patients with unexplained infertility inhibit the formation of endometrial receptivity, leading to a decrease in the expression level of endometrial receptivity marker mRNAs (Gholipour et al., 2022). The above research preliminarily confirmed that seminal plasma EVs can regulate reproductive-related biological processes such as endometrial receptivity formation and embryo implantation, but the underlying molecular mechanism and regulatory network have not been analyzed, and there are few studies in the field of livestock reproduction.

[0004] circRNAs are one of the important regulatory factors carried by EVs, and they mainly function through five pathways: promoting the initiation and elongation of RNAPⅡ-transcribed genes in cells, negatively regulating the expression of linear homologous mRNAs, disrupting the functions of protein complexes related to translation and ribosome biogenesis, translating into functional peptide chains, and acting as competing endogenous RNAs (ceRNAs) to regulate the stability of mRNAs by binding to miRNAs (Chen, 2020). Since the ceRNA network involves multiple RNA molecules such as non-coding RNAs and mRNAs and can more comprehensively and deeply explain some biological phenomena, it has become a research hotspot in recent years for analyzing the formation of endometrial receptivity and the mechanism of embryo implantation (Zhang et al., 2024). However, up to now, there have been no studies reporting the regulatory effects of circRNAs derived from seminal plasma EVs on the formation of endometrial receptivity and embryo implantation, as well as the underlying molecular mechanisms and regulatory networks. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of circSATB1 in the preparation of drugs for improving the fertility of sheep, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above purpose, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is the application of circSATB1 in the preparation of drugs for improving the fertility of sheep, and the nucleotide sequence of circSATB1 is shown in SEQ ID NO.1.

[0008] Another technical solution of the present invention is the application of a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the circSATB1 gene in the preparation of drugs for improving the fertility of sheep.

[0009] A further technical solution of the present invention is the application of a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the circSATB1 gene in the cultivation of high-fertility sheep strains.

[0010] A fourth technical solution of the present invention is a drug for improving the fertility of sheep, which includes substances that promote the expression of the circSATB1 gene.

[0011] A fifth technical solution of the present invention is a method for cultivating high-fertility sheep strains, which includes a method for promoting the expression of the circSATB1 gene by using a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the circSATB1 gene.

[0012] Based on the above technical solutions, the present invention has the following technical effects:

[0013] The present invention first analyzed the circRNA expression profile of sheep seminal plasma extracellular vesicles. Among them, circSATB1 was highly expressed in seminal plasma extracellular vesicles. Overexpression of circSATB1 could extremely significantly promote the proliferation and migration of endometrial epithelial cells and significantly inhibit the apoptosis of endometrial epithelial cells. Interference with circSATB1 would extremely significantly inhibit the proliferation and migration of endometrial epithelial cells and extremely significantly promote the apoptosis of endometrial epithelial cells. The above results all demonstrated the important significance of circSATB1 in the formation of endometrial receptivity and provided new ideas for improving the embryo implantation rate of female livestock. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Among them, A shows the morphological characteristics of sheep seminal plasma extracellular vesicles under transmission electron microscopy; B shows the particle size of sheep seminal plasma extracellular vesicles; C shows the expression of extracellular vesicle marker proteins (Alix, HSP70, TSG101, CD63) and endoplasmic reticulum cell marker protein (CANX) in sheep seminal plasma extracellular vesicles.

[0015] Figure 2 Among them, A shows the top ten circRNAs with the highest expression levels in sheep seminal plasma extracellular vesicles; B shows the verification of the expression levels of different circRNAs in sheep seminal plasma extracellular vesicles by RT-qPCR.

[0016] Figure 3 It shows the circular biological characteristics of sheep seminal plasma extracellular vesicle circRNAs identified by agarose gel electrophoresis and Sanger sequencing. Among them, the lanes from left to right are the amplification results of testicular tissue cDNA and gDNA samples using divergent and convergent primers respectively; the reverse splicing sites of circRNAs are identified by Sanger sequencing.

[0017] Figure 4 It shows the possible circRNA-miRNA interaction network regulated by the top ten circRNAs with the highest expression levels in sheep seminal plasma extracellular vesicles.

[0018] Figure 5 It shows the GO functional enrichment analysis of circSATB1 downstream mRNAs.

[0019] Figure 6 It shows the KEGG pathway enrichment analysis of circSATB1 downstream mRNAs.

[0020] Figure 7 Among them, A shows the verification of the tolerance of circSATB1 to RNase R by RT-qPCR; B shows the verification that endometrial epithelial cells can uptake sheep seminal plasma extracellular vesicles using DiI dye; C shows the verification that circSATB1 is transported from sheep seminal plasma extracellular vesicles into endometrial epithelial cells by RT-qPCR.

[0021] Figure 8 Among them, A shows the changes in the expression levels of circSATB1 and its host gene SATB1 in endometrial epithelial cells after overexpressing circSATB1 detected by RT-qPCR; B shows the effect of overexpressing circSATB1 on the proliferation viability of endometrial epithelial cells at different time points detected by the CCK-8 method; C shows the effect of overexpressing circSATB1 on the proliferation number of endometrial epithelial cells detected by Edu, and the scale bar is 50 μm; D shows the effect of overexpressing circSATB1 on the migration of endometrial epithelial cells detected by the scratch assay, and the scale bar is 200 μm; E shows the effect of overexpressing circSATB1 on the apoptosis of endometrial cells detected by flow cytometry.

[0022] Figure 9 Among them, A shows the changes in the expression levels of circSATB1 and its host gene SATB1 in endometrial epithelial cells after interfering with circSATB1 detected by RT-qPCR; B shows the effect of interfering with circSATB1 on the proliferation viability of endometrial epithelial cells at different time points detected by the CCK-8 method; C shows the effect of interfering with circSATB1 on the proliferation number of endometrial epithelial cells detected by Edu, and the scale bar is 50 μm; D shows the effect of interfering with circSATB1 on the migration of endometrial epithelial cells detected by the scratch assay, and the scale bar is 200 μm; E shows the effect of interfering with circSATB1 on the apoptosis of endometrial cells detected by flow cytometry. Detailed implementation manners

[0023] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0024] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0025] The technical solutions of the present invention, unless otherwise specified, are all conventional solutions in the art. The reagents or raw materials used, unless otherwise specified, are all purchased from commercial channels or are publicly available.

[0026] The embodiments of the present invention provide the application of circSATB1 in the preparation of a drug for improving the fertility of sheep. The nucleotide sequence of circSATB1 is shown as SEQ ID NO.1.

[0027] In some specific implementation schemes, overexpressing the circSATB1 gene promotes the proliferation and migration abilities of sheep endometrial epithelial cells, inhibits the apoptosis of endometrial epithelial cells, and promotes the formation of endometrial receptivity.

[0028] In some specific embodiments, the sheep are sheep.

[0029] The embodiments of the present invention also provide the use of a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the circSATB1 gene in the preparation of a drug for improving the fertility of sheep.

[0030] The embodiments of the present invention also provide the use of a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the circSATB1 gene in cultivating a high-fertility strain of sheep.

[0031] The embodiments of the present invention also provide a drug for improving the fertility of sheep, comprising a substance that promotes the expression of the circSATB1 gene.

[0032] In some specific embodiments, the substance that promotes the expression of the circSATB1 gene includes a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the circSATB1 gene.

[0033] In some specific embodiments, the substance that promotes the expression of the circSATB1 gene includes the overexpression vector pCD5-circSATB1.

[0034] The embodiments of the present invention also provide a method for cultivating a high-fertility strain of sheep, including a method for promoting the expression of the circSATB1 gene using a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the circSATB1 gene.

[0035] Example 1

[0036] 1 Isolation of extracellular vesicles from sheep seminal plasma by density gradient centrifugation

[0037] (1) Select 3 healthy rams with moderate body size and normal fertility. Collect semen by the artificial vagina method and place it in a thermos flask at 37°C. Bring it back to the laboratory within 30 minutes. Quickly check sperm motility and density under a microscope. Sperm motility above 0.75 and density above 10×10 8 / mL can be used;

[0038] (2) Centrifuge the collected semen at 12,000×g for 20 minutes at room temperature first, and then at 12,000×g at 4°C for 20 minutes. Collect the precipitate and supernatant;

[0039] (3) Pass the supernatant obtained in step (2) through 0.45μm and 0.22μm cell filters in sequence, and centrifuge at 100,000×g at 4°C for 1 hour. Collect the supernatant and resuspend the precipitated seminal plasma EVs in DPBS;

[0040] (4) Centrifuge the EVs solution obtained in step (3) at 100,000×g for 1 h at 4°C, and resuspend the precipitated seminal plasma EVs in 1 mL of DPBS;

[0041] (5) Prepare 40%, 20%, 10%, and 5% iodixanol solutions with a buffer containing 0.25 M sucrose and 10 mM Tris (pH 7.5), and sequentially add them into an ultracentrifuge tube to prepare a buffer with a discontinuous density gradient (3 mL for each gradient);

[0042] (6) Add the seminal plasma EVs solution obtained in step (5) to the top layer of the discontinuous density gradient buffer, and centrifuge at 103,000×g for 16 h at 4°C. After centrifugation, remove the top 1 mL of the eluate, and divide the density gradient buffer into 12 equal volumes according to the corresponding concentrations (3 portions for each concentration), and dilute them with DPBS respectively;

[0043] (7) Centrifuge the seminal plasma EVs solution obtained in step (6) at 100,000×g for 2 h at 4°C, resuspend the precipitated seminal plasma EVs in DPBS, and store them at -80°C for subsequent experiments.

[0044] 2 Transmission electron microscopy observation of the morphological characteristics of sheep seminal plasma extracellular vesicles

[0045] Take 5 μL of the prepared seminal plasma EVs sample and drop it onto a copper grid, and let it stand at room temperature for 1 min to allow the seminal plasma EVs to settle. Then, use filter paper to absorb the excess liquid, wash the sample twice with double-distilled water, drop 2% uranyl acetate to negatively stain the EVs sample for 1 min, and air-dry it naturally. Finally, perform on-machine detection, and use a transmission electron microscope (Talos 120 kV) to observe the morphology of the seminal plasma EVs.

[0046] 3 Nanoparticle tracking analysis of the particle size of sheep seminal plasma extracellular vesicles

[0047] Dilute the seminal plasma EVs 50-fold with DPBS, and use a nanoparticle size and Zeta potential analyzer (Zetasizer NanoZS90) to analyze the particle size. For each group of analyses, at least three independent replicate experiments are performed.

[0048] 4 Extraction of sheep seminal plasma extracellular vesicles and sperm proteins

[0049] (1) Mix the protein lysate (RIPA lysate:PMSF = 99:1) with the seminal plasma EVs solution (or sperm), and incubate on an ice shaker at 120 rpm for 30 min;

[0050] (2) Centrifuge the lysed sample at 12,000×g for 4 min at 4°C, and collect the supernatant (protein) for subsequent experiments.

[0051] 5 Determination of protein concentration

[0052] (1) Prepare a BCA protein standard curve according to Table 1;

[0053] Table 1 BCA protein standard curve configuration

[0054]

[0055] (2) Mix BCA reagent and Cu reagent in a ratio of 1:50 (v:v) to prepare BCA working solution;

[0056] (3) Take 20 μL of BCA standard and the sample to be tested into a 96-well plate, and add 200 μL of BCA working solution to each well. Mix thoroughly and incubate at 37°C for 30 min.

[0057] (4) The absorbance was measured at a wavelength of 562 nm on an ELISA reader, and a standard curve was drawn based on the absorbance of the BCA standard to calculate the concentration of each sample to be tested for subsequent experiments.

[0058] 6 Western blot detection of sheep seminal plasma extracellular vesicle marker proteins

[0059] (1) Assemble the mold for preparing gel and fill it with pure water to check for water leakage to ensure that there is no water leakage during the gel preparation process;

[0060] (2) Prepare SDS-PAGE separation gel according to the following table;

[0061] Table 2 Preparation of SDS-PAGE separation gel

[0062]

[0063] (3) Absorb the pure water in the mold, add the mixed separation gel liquid to 1.5 cm from the top of the glass plate, and add anhydrous ethanol to cover the separation gel. Let it stand at room temperature for 20-30 minutes until the separation gel solidifies;

[0064] (4) Prepare SDS-PAGE stacking gel according to the following table;

[0065] Table 3 Preparation of SDS-PAGE stacking gel

[0066]

[0067] (5) Absorb the anhydrous ethanol on the surface of the separation gel, add the mixed concentrated gel liquid to the top of the short glass plate, insert the comb for preparing the gel, and let it stand at room temperature for 20-30 minutes for subsequent experiments;

[0068] (6) Prepare the protein denaturation system according to the table below, mix well and incubate at 99°C for 10 min to denature the protein;

[0069] Table 4 Protein denaturation reaction conditions

[0070]

[0071]

[0072] (7) Weigh 18.8 g of glycine, 3 g of Tris, and 1 g of sodium dodecyl sulfate, dissolve them in 1 L of deionized water, stir and mix well to prepare the electrophoresis solution;

[0073] (8) Place the SDS-PAGE gel into the electrophoresis tank, pour in the electrophoresis solution, and sequentially add the protein color prestained Marker and the denatured protein. The loading amount of the Marker is 5 μL;

[0074] (9) After aligning the electrodes, perform electrophoresis at 200 V for 5 min, then adjust the voltage to 120 V and continue electrophoresis until the bromophenol blue reaches the bottom of the gel;

[0075] (10) Weigh 2.9 g of glycine and 5.8 g of Tris, dissolve them in 800 mL of deionized water, stir and mix well, and add 200 mL of anhydrous methanol precooled to -20 °C 20 min before transferring the membrane to prepare the transfer solution;

[0076] (11) According to the size of the target band and the Marker label, cut it out from the gel, cut a polyvinylidene difluoride (PVDF) membrane of the same size as the gel, and soak the membrane in anhydrous methanol for activation for 10 min;

[0077] (12) Stack the gauze, 2 pieces of filter paper, gel, PVDF membrane, 2 pieces of filter paper, and gauze in sequence from the negative electrode (black) to the positive electrode (white) of the small transfer sandwich clip, and avoid generating air bubbles during the stacking process;

[0078] (13) Transfer the small transfer sandwich clip into the transfer tank, pour in the transfer solution, place ice cubes outside the transfer tank, and select the transfer time according to the band size at 200 mA;

[0079] (14) Dissolve the TBS powder in 2 L of deionized water, add 2 mL of Tween 20, and stir evenly to prepare TBST;

[0080] (15) Wash the transferred PVDF membrane 3 times in TBST, 5 min each time, then transfer the membrane into the TBST solution containing 5% (v / v) skim milk powder and block for 2 h;

[0081] (16) Wash the sealed membrane three times in TBST for 5 minutes each time, and then transfer the membrane into 5% (v / v) non-fat milk TBST solution containing the corresponding antibody and incubate overnight at 4°C;

[0082] (17) Wash the PVDF membrane after incubation with the primary antibody three times in TBST for 5 minutes each time, and then transfer the membrane into 5% (v / v) non-fat milk TBST solution containing the corresponding secondary antibody and incubate at room temperature for 2 hours;

[0083] (18) Wash the PVDF membrane after incubation with the secondary antibody three times in TBST for 5 minutes each time, add ECL chemiluminescence solution for incubation, and detect the expression of the target protein with a chemiluminescence imager.

[0084] Results

[0085] Sheep seminal plasma EVs samples showed cup-shaped vesicles with a double-layer membrane structure ( Figure 1 in A), the particle size was concentrated in 50 - 200 nm ( Figure 1 in B), the marker proteins of EVs, Alix, HSP70, TSG101, and CD63 were positive, and the marker protein of the endoplasmic reticulum, CANX, was negative ( Figure 1 in C). The above results indicated that the extracted samples were EVs, with high purity and no cytoplasmic contamination.

[0086] Example 2

[0087] Analysis of the circRNA Expression Profile of Sheep Seminal Plasma Extracellular Vesicles

[0088] 1 Extraction of Total RNA from Sheep Seminal Plasma Extracellular Vesicles

[0089] (1) Add 1 mL of TRIzol to the seminal plasma EVs solution and incubate at -80°C overnight;

[0090] (2) After thawing, vortex and mix the EVs and TRIzol thoroughly, and incubate at room temperature for 5 minutes to fully lyse the nucleic acid-protein complexes;

[0091] (3) Add 200 μL of chloroform (pre-cooled at 4°C), vortex and mix thoroughly, and let it stand on ice for 3 minutes;

[0092] (4) Centrifuge the solution obtained in step (3) at 12,000 × g for 15 minutes at 4°C. After centrifugation, the sample is divided into a colorless aqueous upper layer containing RNA, a white middle layer, and a red organic lower layer. Pipette the upper aqueous phase and transfer it to a new centrifuge tube, add 500 μL of isopropanol (pre-cooled at 4°C) and 1 μL of glycogen, mix well by inverting up and down, and incubate at -20°C for 1 hour;

[0093] (5) Centrifuge the solution obtained in step (4) at 12,000×g for 10 min at 4°C, discard the supernatant, add 1 mL of 75% (v / v) ethanol-DEPC water (pre-cooled at 4°C) solution, and invert the tube up and down to float the precipitate;

[0094] (6) Centrifuge the solution obtained in step (5) at 12,000×g for 5 min at 4°C, discard the supernatant, and air-dry for 5 min in the ice;

[0095] (7) Add 20 μL of DEPC water to the precipitate to dissolve the RNA, measure the concentration with a spectrophotometer, and store it at -80°C for subsequent experiments.

[0096] 2 Library construction and sequencing data filtering

[0097] (1) Use Nanodrop and Agilent 2200 Bioanalyzer to detect the purity and integrity of RNA respectively. After passing the quality inspection, use Ribo zero rRNA removal kit and RNase R to remove ribosomal RNA and linear RNA respectively. The enriched RNA is reverse-transcribed, end-repaired, ligated with sequencing adapters, and amplified by PCR to obtain a cDNA library. After library inspection, the library is sequenced on the Illumina Hiseq platform, and the obtained raw image data file is converted into sequence data (raw reads) through base recognition analysis;

[0098] (2) The obtained raw reads are first removed of adapter sequences and low-quality reads to obtain high-quality data (clean reads), and then compared with the RNAcentral ribosome database to remove ribosomal RNA sequences to obtain effective reads.

[0099] 3 Alignment of sequencing data and calculation of circRNA expression level

[0100] (1) Use the bwa mem software to align the effective reads to the reference genome (GCF_016772045.2_ARS-UI_Ramb_v3.0), and then use CIRI2 to process the obtained sam file twice. First, detect junction reads through staggered alignment signals. Use paired-end alignment and GT-AG sequence features for preliminary filtering to obtain candidate circRNAs. Second, detect additional junction reads again and further filter out false-positive candidate circRNAs;

[0101] (2) Align the effective reads to the reference genome (GCF_016772045.2_ARS-UI_Ramb_v3.0) using Tophat-Fusion software. Subsequently, use CIRCexplorer2 to filter out the reads that cannot be mapped by Tophat, and then map these reads to the genome using Tophat-Fusion. Then, realign the non-linear candidate reads in the Tophat-Fusion alignment results to the genome, and combine with the gene annotation file to obtain more accurate junction sites;

[0102] (3) Take the intersection of the results of CIRI2 and CIRCexplorer2 software to obtain the final candidate circRNAs;

[0103] (4) Measure the expression value of circular RNAs using the junction reads at the circRNA junction positions in the CIRCexplorer2 output results, and correct the data using the RPM value. The calculation formula of RPM is as follows:

[0104]

[0105] Note: Junction reads and Total circRNAs reads are the values in the CIRCexplorer2 software output results, and each part is the CIRCexplorer2 software output result.

[0106] 4 Validation of sequencing data

[0107] (1) Randomly select 3 healthy rams with normal body constitution, moderate body size, and normal fertility that have not participated in sequencing. Collect semen by the artificial vagina method, isolate seminal plasma EVs, and extract RNA;

[0108] (2) Use a reverse transcription kit to remove gDNA from the RNA. The system is shown in Table 5;

[0109] Table 5 System for removing gDNA

[0110]

[0111]

[0112] (3) Gently pipette and mix the above system, incubate at 42 °C for 2 min, and use a reverse transcription kit (TAKARA, RR047a) to reverse transcribe the RNA into cDNA. The system is shown in Table 6.

[0113] Table 6 Reverse transcription system

[0114]

[0115] (4) Gently pipette and mix the above system, incubate at 37 °C for 15 min, heat at 85 °C for 5 s. Determine the concentration of the synthesized cDNA using a spectrophotometer, and store it at -20 °C for subsequent experiments;

[0116] (5) Randomly select 6 circRNAs identified by sequencing. Design divergent primers according to the back-splicing sites (see Table 8), use ACTB as an internal reference (ACTB primers are shown in Table 9), and perform RT-qPCR using SYBR Green Master Mix reagent (RT-qPCR system is shown in Table 7, reaction program is shown in Table 10), and analyze the relative expression levels of circRNAs using the 2 -ΔΔCt method.

[0117] Table 7 RT-qPCR system

[0118]

[0119] Table 8 circRNA divergent primers

[0120]

[0121]

[0122] Table 9 ACTB primers

[0123]

[0124] Table 10 RT-qPCR program

[0125]

[0126] 5 Verification of circRNA circular structures

[0127] (1) Use a tissue gDNA extraction kit to extract sheep testis gDNA. Take 50 mg of testis tissue and grind it into a powder in liquid nitrogen. Add 200 μL of buffer GA and 4 μL of RNase A (100 mg / mL), vortex for 15 s, and let it stand at room temperature for 5 min;

[0128] (2) Add 20 μL of Proteinase K solution, vortex, and incubate at 56 °C until the tissue is completely dissolved;

[0129] (3) Add 200 μL of buffer GB, mix thoroughly by inverting, incubate at 70 °C for 10 min, and briefly centrifuge to remove the water droplets on the inner wall of the tube lid;

[0130] (4) Add 200 μL of absolute ethanol, vortex for 15 s, and briefly centrifuge to remove the water droplets on the inner wall of the tube cap.

[0131] (5) Add the solution and the flocculent precipitate obtained in step (4) to adsorption column CB3 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and place adsorption column CB3 back into the collection tube.

[0132] (6) Add 500 μL of buffer GD (pre-added with absolute ethanol) to adsorption column CB3, centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and place adsorption column CB3 back into the collection tube.

[0133] (7) Add 600 μL of wash buffer PW (pre-added with absolute ethanol) to adsorption column CB3, centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and place adsorption column CB3 back into the collection tube.

[0134] (8) Repeat step (7).

[0135] (9) Centrifuge adsorption column CB3 at 12,000 rpm for 2 min, discard the waste liquid, and let it stand at room temperature for 5 min.

[0136] (10) Transfer adsorption column CB3 to a clean centrifuge tube, add 100 μL of elution buffer TE dropwise to the middle part of the adsorption column membrane, let it stand at room temperature for 5 min, centrifuge at 12,000 rpm for 2 min, and store the obtained gDNA solution at 4 °C for subsequent experiments.

[0137] (11) Take 50 mg of testicular tissue, grind it into powder in liquid nitrogen, add 1 mL of Trizol to extract RNA and reverse transcribe it into cDNA.

[0138] (12) Design convergent primers according to the sequences of 6 randomly selected circRNAs (Table 12), and perform PCR amplification of testicular cDNA / gDNA using GloriaNova HS2X Master Mix with Dye reagent (the PCR amplification system is shown in Table 11, and the amplification program is shown in Table 13).

[0139] Table 11 PCR system

[0140]

[0141] Table 12 circRNA convergent primers

[0142]

[0143]

[0144] Table 13 PCR program

[0145]

[0146] (13) The amplified products were subjected to 1% agarose gel electrophoresis at 120 V for 30 min to verify the circular structure of circRNAs. The qualified products detected by agarose gel electrophoresis were sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing to detect the back-splicing sites of circRNAs.

[0147] 6 circRNA-miRNA-mRNA interaction analysis

[0148] (1) For the top ten circRNAs expressed in sheep seminal plasma EVs, miRanda, RNAhybrid, and TargetScan software were used to predict the recognition regions of circRNA-miRNA. The results of the three software were intersected, and Cytoscape was used to construct the circRNA-miRNA interaction network.

[0149] (2) For the circRNA that may regulate the most miRNAs, miRanda, RNAhybrid, and TargetScan software were used to predict the recognition regions of its downstream miRNA-mRNA. The results of the three software were intersected.

[0150] (3) According to the miRNA-mRNA interaction network obtained in (2), clusterprofiler was used for GO functional enrichment analysis and KEGG pathway enrichment analysis.

[0151] Results

[0152] A total of 504 circRNAs were detected in sheep seminal plasma EVs. Among them, circEEFSEC, circSATB1, circELF1, circSMARCA5, circKDM4C, circACOXL, circSSBP2, circRERE, circZNF532, and circLRIG1 were the top ten circRNAs with the highest expression levels ( Figure 2 in A). To verify the reliability of the sequencing data, 6 circRNAs were randomly selected, and specific divergent primers were designed according to the back-splicing sites. RT-qPCR was used to verify the relative expression levels of these 6 circRNAs in seminal plasma EVs. Figure 2In B). To further confirm the circular structure of circRNAs, the present invention designed convergent primers for 6 circRNAs as controls, and used testicular tissue cDNA and gDNA as templates respectively for PCR amplification with divergent primers and convergent primers. The results showed that the divergent primers could amplify the target fragments in the cDNA template, but no bands were shown in the gDNA template. In addition, Sanger sequencing found that all 6 circRNAs could undergo back-splicing, rather than genomic structural rearrangement ( Figure 3 ), and the above results proved that the sequencing data was accurate and reliable.

[0153] Among the top 10 circRNAs with the highest expression levels in sheep seminal plasma EVs, circSATB1 has the most 21 potential downstream miRNAs ( Figure 4 ). The results of GO functional enrichment analysis showed that the ceRNA network regulated by circSATB1 participated in biological processes such as cell development, cell differentiation, cell localization, intracellular protein transport, and intracellular transport ( Figure 5 ). The results of KEGG pathway enrichment analysis showed that the ceRNA network regulated by circSATB1 participated in embryo implantation-related signaling pathways such as the vascular endothelial growth factor (VEGF) signaling pathway, oxytocin signaling pathway, gonadotropin-releasing hormone signaling pathway, hedgehog signaling pathway, folate biosynthesis, ovarian steroid biosynthesis, and focal adhesion ( Figure 6 ), and the above results further revealed that circSATB1 might play an important regulatory role in the formation of sheep endometrial receptivity.

[0154] The nucleotide sequence of the circSATB1 gene is shown in SEQ ID NO.1:

[0155]

[0156] The primer sequences for amplifying the circSATB1 gene are as follows:

[0157] SEQ ID NO.2: CGTGCTAAAGTTTCCCAAGCTC;

[0158] SEQ ID NO.3: ATGTTCTTTCCCCTGAGTTGC.

[0159] Example 3

[0160] Overexpression of circSATB1 promotes the proliferation and migration of sheep endometrial epithelial cells and inhibits the apoptosis of sheep endometrial epithelial cells

[0161] 1 Detection of the tolerance of circSATB1 to RNase R

[0162] (1) Extract RNA from sheep testicular tissue using the "verification of circRNA circular structure" method in Example 2;

[0163] (2) Mix sheep testicular RNA with RNase R and incubate at 37 °C for 20 min. After reverse transcription of the RNA digestion product, detect the changes in the expression levels of circSATB1, SATB1, and ACTB by RT-qPCR.

[0164] Table 14 RNase R reaction system

[0165]

[0166] Table 15 SATB1 primers

[0167]

[0168] 2 Detection of the uptake ability of sheep endometrial epithelial cells to seminal plasma extracellular vesicles

[0169] (1) Isolate sheep seminal plasma EVs using the "isolation of sheep seminal plasma extracellular vesicles by density gradient centrifugation" method in Example 1. Take 50 μg of the prepared EVs sample and incubate it with 20 μM DiI dye in the dark at room temperature for 15 min;

[0170] (2) Add an equal volume of 5% BSA to terminate the staining. Dilute it with DPBS and centrifuge at 120,000 × g at 4 °C for 90 min. Resuspend the precipitated DiI-labeled seminal plasma EVs in DPBS and store them at -80 °C for subsequent experiments;

[0171] (3) The endometrial epithelial cells were cultured in DMEM / F12 medium containing 12% fetal bovine serum, penicillin (100 U / mL), streptomycin (100 μg / mL), and 0.01% insulin;

[0172] (4) The Dil-labeled seminal plasma EVs and endometrial epithelial cells were incubated for 0 h, 2 h, 4 h, 6 h, and 12 h respectively. After the incubation, the medium was removed, and the cells were washed 3 times with pre-cooled DPBS and fixed with 4% paraformaldehyde at room temperature in the dark for 15 min;

[0173] (5) The 4% paraformaldehyde was removed, pre-cooled DPBS was added, and the cells were washed 3 times on a shaker at 100 rpm for 4 min each time. Subsequently, 0.4% Tritonx-100 was added and incubated at room temperature in the dark for 15 min;

[0174] (6) The 0.4% Tritonx-100 was removed, pre-cooled DPBS was added, and the cells were washed 3 times on a shaker at 100 rpm for 4 min each time. Subsequently, 200 nM FITC-phalloidin was added and incubated at room temperature in the dark for 30 min;

[0175] (7) The 200 nM FITC-phalloidin was removed, pre-cooled DPBS was added, and the cells were washed 3 times on a shaker at 100 rpm for 4 min each time. Subsequently, Hoechst 33342 solution was added and incubated at room temperature in the dark for 10 min;

[0176] (8) The Hoechst 33342 solution was removed, pre-cooled DPBS was added, and the cells were washed 2 times on a shaker at 100 rpm for 4 min each time. Subsequently, images were observed and collected under a fluorescence inverted microscope.

[0177] 3 Detection of the effect of sheep seminal plasma extracellular vesicles on the expression level of circSATB1 in endometrial epithelial cells

[0178] (1) The sheep seminal plasma EVs were separated using the method of "Isolation of sheep seminal plasma extracellular vesicles by density gradient centrifugation" in Example 1. 80 μg of seminal plasma EVs were added to each well of a 6-well plate with normally cultured endometrial epithelial cells;

[0179] (2) After co-incubation for 48 h, the medium was removed, and the cells were washed 3 times with pre-cooled DPBS. 1 mL of Trizol was added to each well, and the RNA of sheep endometrial epithelial cells was extracted using the method of "Verification of sequencing data" in Example 2 to detect the change in the expression level of circSATB1.

[0180] 4 Construction of an endometrial epithelial cell model overexpressing circSATB1

[0181] (1) When the cells in the 6-well plate grew to 70 - 80%, Lipofectamine was usedTM Transfection was carried out at 3000 rpm, and the transfection system is shown in Table 16;

[0182] Table 16 Overexpression transfection system

[0183]

[0184] (2) After the transfection system was mixed evenly, it was left standing at room temperature for 15 min, and then added to a 6-well plate for culturing normal endometrial epithelial cells, with 250 μL of the mixed solution added to each well. The medium was changed 10 h after transfection;

[0185] (3) 48 h after transfection, the medium was removed, and the cells were washed 3 times with pre-cooled DPBS. 1 mL of Trizol was added to each well, and the "Verification of sequencing data" method in Example 2 was used to extract RNA from sheep endometrial epithelial cells, and the changes in the expression levels of circSATB1 and SATB1 were detected.

[0186] 5 Cell proliferation detection

[0187] (1) Cells in the logarithmic phase were collected, the cell suspension concentration was adjusted, 100 μL was added to each well of a 96-well plate, and the density of the cells to be tested was adjusted to 10,000 cells / well, and transfection was carried out 24 h after culturing;

[0188] (2) 12 h, 24 h, 48 h, and 72 h after transfection respectively, the medium was removed, and the medium containing 10% CCK-8 solution was added, 100 μL to each well, and the OD value of sheep endometrial epithelial cells at a wavelength of 450 nm was detected after continued culturing for 1 h;

[0189] (3) 48 h after transfection, the medium was removed, and the medium containing 10 μM Edu was added, and culturing was continued for 2 h;

[0190] (4) After the cells were labeled with Edu, the medium was removed, the cells were washed 3 times with pre-cooled DPBS, and 4% paraformaldehyde was added for fixation at room temperature in the dark for 15 min;

[0191] (5) The 4% paraformaldehyde was removed, pre-cooled DPBS was added, and the cells were washed 3 times on a shaker at 100 rpm for 4 min each time. Then 0.4% Tritonx-100 was added and incubated at room temperature in the dark for 15 min;

[0192] (6) The 0.4% Tritonx-100 was removed, pre-cooled DPBS was added, and the cells were washed 3 times on a shaker at 100 rpm for 4 min each time. Then the Click reaction solution was added and incubated at room temperature in the dark for 30 min. The Click reaction solution system is shown in Table 17;

[0193] Table 17 Click reaction solution system

[0194]

[0195] (7) Remove the Click reaction solution, add pre-cooled DPBS, wash 3 times on a shaker at 100 rpm for 4 min each time, then add Hoechst 33342 solution and incubate in the dark at room temperature for 10 min;

[0196] (8) Remove the Hoechst 33342 solution, add pre-cooled DPBS, wash 2 times on a shaker at 100 rpm for 4 min each time, then observe and collect images under a fluorescence inverted microscope.

[0197] 6 Cell migration detection

[0198] (1) Draw a straight line at the bottom of a 6-well plate, divide the wells into multiple regions, each line is 1 cm wide, then evenly plate the cells, and when the cells grow to 70 - 80%, use Lipofectamine TM Transfect at 3000 rpm;

[0199] (2) 48 h after transfection, use a 200 μL sterile pipette tip to make a scratch perpendicular to the surface of the monolayer cells smoothly. Wash the cells 3 times with DPBS containing penicillin (100 U / mL) and streptomycin (100 μg / mL) to remove floating cell clumps;

[0200] (3) Add DMEM / F12 medium containing 0.5% FBS, take a photo under an inverted microscope to record the original scratch, and mark 0 h;

[0201] (4) Continue to culture for 12 h, then take a photo and mark 12 h in the same field of view;

[0202] (5) Use Image J software to calculate the cell migration rate of each group.

[0203] 7 Cell apoptosis detection

[0204] (1) When the cells in a 12-well plate grow to 70 - 80%, use Lipofectamine TM Transfect at 3000 rpm;

[0205] (2) 48 h after transfection, collect the medium, wash the cells with DPBS containing penicillin (100 U / mL) and streptomycin (100 μg / mL) and collect the DPBS;

[0206] (3) Digest the cells with trypsin for 2 min, add the collected medium to terminate the digestion, collect the cells in a 2 mL centrifuge tube, and centrifuge at 500×g for 5 min;

[0207] (4) Discard the supernatant, wash twice with pre-cooled DPBS, and resuspend the precipitated cells in 100 μL of Binding Buffer;

[0208] (5) Add 5 μL of Annexin V-EGFP to each tube of cells, pipette to mix well, and incubate in the dark at room temperature for 5 min;

[0209] (6) Add 10 μL of Propidium Iodide and 400 μL of DPBS to each tube of cells, pipette to mix well, and collect 30,000 cells by flow cytometry to detect apoptosis.

[0210] Results

[0211] Compared with SATB1 digested by RNase R, circSATB1 was resistant to RNase R digestion ( Figure 7 in A), indicating that circSATB1 has the characteristic of being resistant to RNase R digestion, further confirming that circSATB1 has the characteristics of circRNA. Co-incubate DiI-labeled sheep seminal plasma EVs with endometrial epithelial cells. The results showed that compared with the 0 h control, after incubation for 2 h, 4 h, 6 h, and 12 h, red fluorescence appeared in endometrial epithelial cells, and the number of red fluorescence increased with the extension of the incubation time ( Figure 7 in B). RT-qPCR results showed that after co-incubation with sheep seminal plasma EVs, the expression level of circSATB1 in endometrial epithelial cells increased significantly ( Figure 7 in C). The above results indicate that circSATB1 is transported into endometrial epithelial cells by sheep seminal plasma EVs. Further, RT-qPCR results showed that after transfection with the overexpression vector pCD5-circSATB1, the expression level of circSATB1 in endometrial epithelial cells increased extremely significantly, while the expression level of the corresponding host gene STBA1 did not change significantly ( Figure 8 in A), proving that an endometrial epithelial cell model overexpressing circSATB1 has been successfully constructed.

[0212] The morphological changes during the formation of endometrial receptivity depend on the proliferation of endometrial epithelial cells. CCK-8 results showed that the viability of endometrial epithelial cells at 48 h and 72 h after overexpression of circSATB1 increased extremely significantly ( Figure 8 in B); in addition, Edu results showed that after overexpression of circSATB1, the number of proliferating endometrial epithelial cells increased extremely significantly ( Figure 8 in C). The above results all indicate that circSATB1 can promote the proliferation of endometrial epithelial cells.

[0213] Before the formation of endometrial receptivity, endometrial epithelial cells migrate to the embryo implantation area, providing a basis for the smooth implantation of the embryo. The results of the cell scratch assay showed that after overexpression of circSATB1, the migration ability of endometrial epithelial cells increased extremely significantly ( Figure 8 in D), indicating that circSATB1 can promote the migration of endometrial epithelial cells.

[0214] During the formation of endometrial receptivity, there is also an apoptotic process of endometrial epithelial cells. The occurrence of apoptosis is beneficial to the remodeling of the endometrial structure, but apoptosis beyond a certain degree will have an adverse impact on embryo implantation and development. The results of flow cytometry showed that after overexpression of circSATB1, the apoptosis rate of endometrial epithelial cells decreased significantly ( Figure 8 in E), indicating that circSATB1 can inhibit the apoptosis of endometrial epithelial cells. The above results revealed that circSATB1 has a promoting effect on the formation of endometrial receptivity.

[0215] Example 4

[0216] Interference with circSATB1 inhibits the proliferation and migration of sheep endometrial epithelial cells and promotes the apoptosis of sheep endometrial epithelial cells

[0217] 1 Construction of an endometrial epithelial cell model with interference of circSATB1

[0218] (1) When the cells in the 6-well plate grow to 70-80%, use Lipofectamine TM to transfect at 3000 rpm. The transfection system is shown in Table 18.

[0219] Table 18 Interference transfection system

[0220]

[0221] (2) After mixing the transfection system, let it stand at room temperature for 15 min, and then add it to the 6-well plate with endometrial epithelial cells cultured normally, 250 μL of the mixed solution per well. Replace the medium 10 h after transfection;

[0222] (3) 48 h after transfection, remove the medium, wash the cells 3 times with pre-cooled DPBS, add 1 mL of Trizol to each well, and use the "Verification of sequencing data" method in Example 2 to extract RNA from sheep endometrial epithelial cells and detect the changes in the expression levels of circSATB1 and SATB1.

[0223] 2 Cell proliferation detection

[0224] Use the "Cell proliferation detection" method in Example 3 to detect the effect of interfering with circSATB1 on the proliferation of endometrial epithelial cells.

[0225] 3 Cell migration detection

[0226] Using the "cell migration detection" method in Example 3, detect the effect of interfering with circSATB1 on the migration of endometrial epithelial cells.

[0227] 4 Cell apoptosis detection

[0228] Using the "cell apoptosis detection" method in Example 3, detect the effect of interfering with circSATB1 on the apoptosis of endometrial epithelial cells.

[0229] Results

[0230] RT-qPCR results showed that after transfection with siRNA of circSATB1, the expression level of circSATB1 in endometrial epithelial cells decreased significantly, while the expression level of the corresponding host gene STBA1 did not change significantly ( Figure 9 in A), proving that the endometrial epithelial cell model interfering with circSATB1 has been successfully constructed.

[0231] CCK-8 results showed that the viability of endometrial epithelial cells at 48 h and 72 h after interfering with circSATB1 decreased extremely significantly ( Figure 9 in B); in addition, Edu results showed that after interfering with circSATB1, the number of proliferating endometrial epithelial cells decreased extremely significantly ( Figure 9 in C). The above results all indicate that interfering with circSATB1 inhibits the proliferation of endometrial epithelial cells.

[0232] The results of the cell scratch assay showed that after interfering with circSATB1, the migration ability of endometrial epithelial cells decreased significantly ( Figure 9 in D), indicating that interfering with circSATB1 inhibits the migration of endometrial epithelial cells.

[0233] The results of flow cytometry showed that after interfering with circSATB1, the apoptosis rate of endometrial epithelial cells increased extremely significantly ( Figure 9 in E), indicating that interfering with circSATB1 promotes the apoptosis of endometrial epithelial cells. The above results further confirm that circSATB1 has a promoting effect on the formation of endometrial receptivity.

[0234] The above examples confirmed that circSATB1 was highly expressed in sheep EVs, and was carried into endometrial epithelial cells by seminal plasma EVs. By promoting the proliferation and migration of endometrial cells, inhibiting the apoptosis of endometrial epithelial cells, and promoting the formation of endometrial receptivity. The present invention provides an important promoting effect of circSATB1 in the formation of sheep endometrial receptivity and its application prospect in improving the sheep embryo implantation rate. At the same time, circSATB1 is also a promising marker for evaluating ram fertility, providing new ideas for improving sheep reproductive rate.

[0235] Obviously, the above examples of the present invention are only for clearly illustrating the examples made by the present invention, rather than limiting the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation manners here. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the claims of the present invention.

Claims

1. Application of circSATB1 in the preparation of a drug for improving sheep fertility, characterized in that: The nucleotide sequence of circSATB1 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: Overexpression of the circSATB1 gene promoted the proliferation and migration of sheep endometrial epithelial cells, inhibited the apoptosis of endometrial epithelial cells, and promoted the formation of endometrial receptivity.

3. Use of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the circSATB1 gene in the preparation of drugs for improving sheep fertility.

4. Application of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the circSATB1 gene in breeding high-fertility sheep strains.

5. A drug for improving sheep fertility, characterized in that: Including substances that promote the expression of circSATB1 gene.

6. The drug according to claim 5, characterized in that The substance promoting the expression of the circSATB1 gene includes a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the circSATB1 gene.

7. The drug according to claim 6, characterized in that The substance that promotes circSATB1 gene expression includes the overexpression vector pCD5-circSATB1.

8. A method for breeding a high fertility sheep strain, characterized in that: The invention comprises a method for promoting the expression of circSATB1 gene by using a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the circSATB1 gene.

Images