Kit for constructing TBX19 p.Thr187Ala point mutation mouse model as well as construction method and application thereof

Abstract

The invention relates to the technical field of gene engineering, in particular to a kit for constructing a TBX19 p.Thr187Ala point mutation mouse model as well as a construction method and application of the kit. The kit provided by the invention comprises gRNA (guide ribonucleic acid) of which the nucleotide sequence is shown as SEQ ID NO.1 and single-stranded Oligo donor DNA (deoxyribonucleic acid) of which the nucleotide sequence is shown as SEQ ID NO.3. The invention also provides a kit for detecting the gRNA. According to the kit provided by the invention, a TBX19 p.Thr187Ala point mutation mouse model can be constructed, and the mouse model can be used as an animal model for studying the occurrence and development course of a hypothalamus-pituitary-adrenal axis function weakening and acrenocorticotropin (ACTH) deficiency model, so as to study the molecular and cellular mechanism of the TBX19 gene influencing animal (mouse) behaviors. The animal model can also be used as an animal model for research and development of adrenocorticotropin deficiency drugs.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and particularly relates to a kit for constructing a TBX19 p.Thr187Ala point mutation mouse model, a construction method thereof, and an application thereof. Background Art

[0002] The T-box transcription factor 19 ( TBX19 ) gene is located at 1q24.2 of human beings and encodes a transcription factor with a T-box domain. TBX19 It is an important gene that regulates the hypothalamic-pituitary-adrenal axis (HPA axis). By binding to Pitx1, it initiates the POMC expression, and then causes changes in the levels of hormones related to the HPA axis. The HPA axis is the stress center of animals and regulates important biological activities such as the growth and development, neural activities, and stress responses of organisms. The TBX19 gene of mice is located on chromosome 1, with a full length of 22,919 bases, and the NCBI ID: 83993. This gene has 4 transcripts in the mouse genome.

[0003] rs80951600 is a mutation site located on the TBX19 gene of domestic pigs (Sscrofa11.1) on chromosome 4, located at chr4: 82,684,374, and mutated from T to C, belonging to a missense mutation, resulting in the TBX19 threonine (Thr or T) at the 189th position of the translated protein being changed to alanine (Ala or A). According to protein homology, the homologous site of this site in mice is the 187th amino acid, that is, mouse TBX19 Thr187Ala. Genomic research has found that this mutation may be related to the weakened function of the HPA axis in domestic pigs, and thus promotes the domestication of wild pigs into docile domestic pigs. Currently, little is known about the mechanism of action of TBX19 gene's T187A on mouse behavior, and there is also no mouse model with this site edited. Summary of the Invention

[0004] In order to solve the above problems, the present invention provides a kit for constructing a TBX19 p.Thr187Ala point mutation mouse model, a construction method thereof, and an application thereof. The kit provided by the present invention can construct a TBX19 p.Thr187Ala point mutation mouse model, and this mouse model can be used as an animal model for studying the pathogenesis of weakened hypothalamic-pituitary-adrenal axis function and adrenocorticotropic hormone (ACTH) deficiency syndrome.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a kit for constructing a TBX19 p.Thr187Ala point mutation mouse model, comprising gRNA and single-stranded Oligo donor DNA; the nucleotide sequence of the gRNA is as shown in SEQ ID NO.1, and the nucleotide sequence of the single-stranded Oligo donor DNA is as shown in SEQ ID NO.3.

[0006] Preferably, the kit further comprises Cas9 mRNA and Cas9 reaction buffer.

[0007] The present invention provides the application of the kit according to the above technical solution in constructing a TBX19 p.Thr187Ala point mutation mouse model.

[0008] The present invention provides a method for constructing a TBX19 p.Thr187Ala point mutation mouse model, comprising the following steps: Mix Cas9 mRNA, gRNA, single-stranded Oligo donor DNA and Cas9 reaction buffer to obtain a reaction mixture; the gRNA and single-stranded Oligo donor DNA are the gRNA and single-stranded Oligo donor DNA in the kit according to the above technical solution; After injecting the reaction mixture into mouse fertilized eggs, transplant the surviving fertilized eggs after injection into the body of a recipient female mouse to produce F0 generation mice; Determine the TBX19 genotype of the genes of the F0 generation mice to obtain mutant positive F0 generation mice; Mate the mutant positive F0 generation mice with wild-type mice to obtain F1 generation mice; Determine the TBX19 genotype of the genes of the F1 generation mice to obtain positive F1 generation mice; Hybridize the positive F1 generation mice to obtain F2 generation mice containing homozygous TBX19 p.Thr187Ala point mutation.

[0009] Preferably, the concentration of Cas9 mRNA in the reaction mixture is 5 ng / μl, the concentration of gRNA is 2 ng / μl, and the concentration of single-stranded Oligo donor DNA is 100 ng / μl.

[0010] Preferably, the primers used for the determination include: TBX19 amplification primers and sequencing primers for the genes.

[0011] Preferably, the TBX19The amplification primers for the gene consist of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.4; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.5.

[0012] Preferably, the nucleotide sequence of the sequencing primer is as shown in SEQ ID NO.4.

[0013] The present invention provides the application of the TBX19 p.Thr187Ala point mutant mouse model constructed by the method of the above technical solution in any one of 1) to 3): 1) As an animal model for observing the weakened function of the hypothalamic-pituitary-adrenal axis; 2) As an animal model for adrenocorticotropic hormone deficiency; 3) As an animal model for the research and development of drugs for adrenocorticotropic hormone deficiency.

[0014] Preferably, the animal model described in 2) is an animal model for the occurrence and / or development process of adrenocorticotropic hormone deficiency.

[0015] Beneficial effects: The present invention provides a kit for constructing a TBX19 p.Thr187Ala point mutant mouse model, including gRNA and single-stranded Oligo donor DNA; the nucleotide sequence of the gRNA is as shown in SEQ ID NO.1, and the nucleotide sequence of the single-stranded Oligo donor DNA is as shown in SEQ ID NO.3. The kit provided by the present invention can construct a TBX19 p.Thr187Ala point mutant mouse model, which can be used as an animal model for studying the weakened function of the hypothalamic-pituitary-adrenal axis and the occurrence and development process of adrenocorticotropic hormone (ACTH) deficiency model to study TBX19 the molecular and cellular mechanisms by which genes affect the behavior of animals (mice), and can also be used as an animal model for the research and development of drugs for adrenocorticotropic hormone deficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments.

[0017] Figure 1 It is a flow schematic diagram of the present invention; Figure 2 It is TBX19 a schematic diagram of the gene point mutation design strategy; Figure 3 It is the electrophoresis result of in vitro transcribed Cas9 and gRNA; Figure 4Schematic diagram of the identification strategy for F0 generation mice; Figure 5 Gel electrophoresis map of PCR for F0 generation mice; Figure 6 Peak shape map near the mutation site of wild-type mice; Figure 7 Peak shape map near the mutation site of heterozygous mutant mice; Figure 8 Peak shape map near the mutation site of homozygous mutant mice. Detailed implementation mode

[0018] The present invention provides a kit for constructing a TBX19 p.Thr187Ala point mutation mouse model, which includes gRNA and single-stranded Oligo donor DNA; the nucleotide sequence of the gRNA is shown in SEQ ID NO.1, and the nucleotide sequence of the single-stranded Oligo donor DNA is shown in SEQ ID NO.3, specifically as follows: 5'-CTGCATAAATATGAACCTCAGGTTCATATAGTCCGTGTTGGAGGCGCCCATCGAATGGTCATGAACTGCTCATTTCCTGAAGCTCAGTTCATCGCTGTGACTGCCTATCAGAATGAGGAG-3'.

[0019] In the single-stranded Oligo donor DNA of the present invention, the 82nd base G is the target mutation site, and the 75th base T is a synonymous mutation to prevent secondary cleavage by Cas9, which can prevent the single-stranded Oligo donor DNA from being recognized and cleaved by Cas9-sgRNA before and after insertion into the genome.

[0020] As an implementation mode, the kit further includes Cas9 mRNA and Cas9 reaction buffer.

[0021] As an implementation mode, the Cas9 mRNA and gRNA in the kit are obtained by in vitro transcription to obtain active gRNA and Cas9 mRNA, and the single-stranded Oligo donor DNA is obtained by synthesis.

[0022] The kit provided by the present invention can construct a TBX19 p.Thr187Ala point mutation mouse model, and this mouse model can be used as an animal model for studying the occurrence and development process of the hypothalamic-pituitary-adrenal axis function weakening and adrenocorticotropic hormone (ACTH) deficiency disorder model, in order to study TBX19The molecular and cellular mechanisms by which genes affect the behavior of animals (mice) can also be used as an animal model for the research and development of drugs for adrenocorticotropic hormone deficiency.

[0023] Based on the above advantages, the present invention provides the application of the kit described in the above technical solution in constructing a TBX19 p.Thr187Ala point mutation mouse model.

[0024] The present invention provides a method for constructing a TBX19 p.Thr187Ala point mutation mouse model, comprising the following steps: Mix Cas9 mRNA, gRNA, single-stranded Oligo donor DNA and Cas9 reaction buffer to obtain a reaction mixture; the gRNA and single-stranded Oligo donor DNA are the gRNA and single-stranded Oligo donor DNA in the kit described in the above technical solution; After injecting the reaction mixture into mouse fertilized eggs, transplant the surviving fertilized eggs after injection into the body of a recipient female mouse to produce F0 generation mice; Determine the TBX19 genotype of the gene of the F0 generation mice to obtain mutant positive F0 generation mice; Mate the mutant positive F0 generation mice with wild-type mice to obtain F1 generation mice; Determine the TBX19 genotype of the gene of the F1 generation mice to obtain positive F1 generation mice; Hybridize the positive F1 generation mice to obtain F2 generation mice containing homozygous TBX19 p.Thr187Ala point mutations.

[0025] As an implementation manner, the concentration of Cas9 mRNA in the reaction mixture is 5 ng / μl, the concentration of gRNA is 2 ng / μl, and the concentration of single-stranded Oligo donor DNA is 100 ng / μl.

[0026] As an implementation manner, the mouse fertilized eggs are obtained by mouse superovulation and in vitro fertilization culture.

[0027] As an implementation manner, the primers used for the determination include: TBX19 amplification primers and sequencing primers for the gene.

[0028] As an implementation manner, the TBX19 amplification primers for the gene consist of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.4; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.5.

[0029] As an implementation manner, the nucleotide sequence of the sequencing primer is as shown in SEQ ID NO.4.

[0030] Based on the gRNA described in the above technical solution, the present invention designs a construction method for a Txb19 p.Thr187Ala point mutation mouse model. Cas9 mRNA, gRNA, single-stranded oligo donor DNA and Cas9 reaction mixture are microinjected into mouse fertilized eggs. Through two-step screening and one hybridization, a Thr187Ala point mutation mouse model is obtained. By using the CRISPR / Cas9 system, after constructing the point mutation mouse, it can be flexibly combined with different tool mice to study the action mechanism of the target gene in different tissues and organs, even different cell types, providing effective model animals at home and abroad.

[0031] The present invention provides the application of the TBX19 p.Thr187Ala point mutation mouse model constructed by the method described in the above technical solution in any one of 1) to 3): 1) As an animal model for observing the weakened function of the hypothalamic-pituitary-adrenal axis; 2) As an animal model for adrenocorticotropic hormone deficiency; 3) As an animal model for the research and development of drugs for adrenocorticotropic hormone deficiency.

[0032] As an implementation manner, the animal model described in 2) is an animal model for the occurrence and / or development process of adrenocorticotropic hormone deficiency.

[0033] To further illustrate the present invention, the following will combine the drawings and examples to describe in detail the kit for constructing the TBX19 p.Thr187Ala point mutation mouse model provided by the present invention, its construction method and application, but they cannot be understood as limiting the protection scope of the present invention.

[0034] Example 1 A method for establishing a TBX19 Thr187Ala point mutation mouse model based on the CRISPR / Cas9 gene editing technology. The process schematic diagram is shown in Figure 1 , and the specific steps are as follows: I. TBX19 The basic information of the gene is as follows: 1) Name of the point mutation gene (Gene ID number): TBX19 (83993); 2) Name of the point mutation gene (Ensemble): TBX19 (ENSMUSG00000026572); 3) Transcript targeted by point mutation (Ensemble ID): Tbx19-201 (ENSMUST00000027859.12); 4) Exon targeted by point mutation: Exon 3.

[0035] II. Design and construction of Cas9 / gRNA: TBX19 Schematic diagram of the gene point mutation design strategy, as Figure 2 shown, gRNAs are designed near the target mutation of TBX19 exon 3 of the gene.

[0036] 1. The specific targeting strategy is as follows: Based on the sequence information, 1 gRNA was designed in the exon 3 sequence of the TBX19 gene, and the nucleotide sequence is shown in SEQ ID NO.1, specifically as follows: 5'-CAGCGATGAACTGAGTTTCAGGG-3'.

[0037] 2. With the mutation region as the center (5'-TCCTGAAGCTCAGTTCATCGCTG-3', SEQ ID NO.2), 74 bases were extended upstream and 23 bases were extended downstream to synthesize single-stranded oligo donor DNA (oligo donor DNA), with a total length of 120 bases. The nucleotide sequence is shown in SEQ ID NO.3, specifically as follows: 5'-CTGCATAAATATGAACCTCAGGTTCATATAGTCCGTGTTGGAGGCGCCCATCGAATGGTCATGAACTGCTCATTTCCTGAAGCTCAGTTCATCGCTGTGACTGCCTATCAGAATGAGGAG-3'.

[0038] 3. The gRNA and Cas9 plasmid (px330-T7-cas9 plasmid, independently constructed by Shanghai Model Organisms Center, Inc.) were in vitro transcribed using the MEGAshortscript T7 kit (LifeTechnologies) in vitro transcription kit to obtain Cas9 mRNA and active gRNA for microinjection, and were purified and recovered using the MEGAclear kit.

[0039] Process of Cas9 mRNA synthesis: 1) Restriction digestion experiment: The px330-T7-cas9 plasmid was digested with a single restriction enzyme. The restriction digestion system was as follows: 5 μg of px330-T7-cas9 plasmid, 10 μl of 10× Buffer, 5 μl of restriction enzyme XbaI, and ddH 2 O was added to make up to 100 μl. Enzyme reaction: Incubate in a metal bath or constant temperature water bath at 37 °C for 2 h; Enzyme inactivation: Incubate in a metal bath or constant temperature water bath at 65 °C for 20 min.

[0040] 2) Purification experiment: (1) After the restriction digestion reaction, 2 μl was taken for gel electrophoresis experiment to confirm whether the digestion was complete. The circular plasmid was used as a control.

[0041] (2) DNA purification and recovery experiment: ① Add 200 μl of absolute ethanol and slowly invert for 30 s until flocculent suspensions appear; ② Centrifuge the EP tube containing ethanol at 13000 rpm for 5 min; ③ After centrifugation, pour off the liquid, add 75% ethanol for washing (do not wash off the precipitate at the bottom of the tube), wash and pour off the ethanol, and repeat this step 2 times; ④ Dry the residual ethanol in the tube, add 50 μl of ddH 2 O, dissolve the DNA at 56 °C, and measure the concentration after complete dissolution.

[0042] 3) Transcription experiment: The experiment was carried out according to the instructions of the ThermoFisher mMESSAGE mMACHINE™ T7 ULTRA transcription kit (purchased from Thermo Fisher, catalog number AM1345).

[0043] 4) RNA purification and recovery experiment: The experiment was carried out according to the instructions of the ThermoFisher MEGAclear™ transcription purification kit (purchased from Thermo Fisher, catalog number AM1908).

[0044] Finally, the transcribed Cas9 mRNA was obtained, and gel electrophoresis experiment was carried out to observe the transcription quality and measure the concentration. The electrophoresis results are as Figure 3 shown.

[0045] III. Construction process of the mouse animal model of TBX19 Thr187Ala: 1) Inject the above-mentioned in vitro-transcribed active Cas9 mRNA, gRNA, and single-stranded Oligo donor DNA into mouse fertilized eggs according to the conventional injection doses in the art. The injection system is as follows: Cas9 mRNA 0.5 μg, gRNA 0.2 μg, single-stranded Oligo donor DNA 10 μg, and the buffer is made up to 100 μL; the buffer consists of 20 μL of 0.5 mol / L EDTA (pH = 8.0) and 1000 μL of 1 mol / L Tris-HCL (pH = 7.5).

[0046] Perform microinjection of the embryos according to the method in the "Mouse Embryo Manipulation Experimental Manual (Third Edition)". Take the surviving fertilized eggs after injection and transplant them into the body of recipient female mice (ICR mice). The resulting mice are F0 generation mice.

[0047] 2) Extract the genomic DNA from the tails of F0 generation mice, perform PCR amplification and sequence the products for identification to obtain positive F0 generation mice or suspected positive F0 generation mice; since the cleavage rate is very fast in the early stage of embryos, the obtained F0 mice are chimeras. Therefore, the F0 genotype identified using the tail DNA of F0 mice is for reference only and does not necessarily represent a heritable gene mutation. The heritable genotype needs to be determined after the genotype identification of F1 mice. The specific process of F0 generation mouse genotype identification is as follows: ① Design of identification primers: The primer design principle is as Figure 4 shown. The front and back ends of the two primers (primer Ⅰ and primer Ⅱ) are designed in intron 2 and intron 3 of the TBX19 gene respectively, and the edited complete sequence can be obtained through amplification.

[0048] ② The nucleotide sequences of the primers are as follows: TBX19-F (primer Ⅰ): 5'-CTGAACGTAGATGAATCCAGAA-3' (SEQ ID NO.4); TBX19-R (primer Ⅱ): 5'-TCCTCAAAACTCTAAATTCCGT-3' (SEQ ID NO.5); ③ The PCR amplification conditions are as follows: Reaction system: ddH 213.2 µl of O, 2 µl of PrimeStar GXL PCR Buffer (R050A, Takara), 2 µl of 2.5 mM dNTP, 0.5 µl of TBX19-F (10 pmol / µl), 0.5 µl of TBX19-R (10 pmol / µl), 0.8 µl of PrimeStar GXL DNA Polymerase* (TaKaRa, R050A), and 1 µl of genomic DNA.

[0049] Reaction conditions: pre-denaturation at 94°C for 3 min; denaturation at 98°C for 15 s, annealing at 58°C for 15 s, extension at 68°C for 20 s, for a total of 35 cycles; final extension at 68°C for 5 min.

[0050] ④ Genotype identification of the tails of F0 generation mice. First, gel electrophoresis was performed on the PCR amplification products, and the results were as Figure 5 shown. It can be seen from the results that the target fragment can be specifically obtained by PCR amplification. Sanger sequencing was performed on the PCR products to obtain the nucleotide sequence of the target fragment.

[0051] The nucleotide sequence of the sequencing primer is shown in SEQ ID NO.4.

[0052] Based on the PCR identification and sequencing results, the positive F0 generation mice with mutations were determined. A total of 16 mice were injected, and 11 wild-type mice and 5 positive mice with point mutations were obtained in the F0 generation.

[0053] 3) The above-mentioned positive F0 generation mice were mated with wild-type opposite-sex mice to obtain F1 generation mice; the tail DNA of F1 generation mice was extracted, PCR amplified, and the products were sequenced and identified to obtain positive F1 generation mice with stable genotypes. The positive F1 generation mice were hybridized to obtain F2 generation mice, and the homozygous genotypes of F2 generation mice were identified to obtain F2 generation mice with homozygous genotypes, which were TBX19 the animal model of gene Thr187Ala point mutation mice.

[0054] The genotype identification results of F2 generation mice include: homozygous wild-type mice as Figure 6 described, heterozygous mutant mice as Figure 7 described, and homozygous mutant mice as Figure 8 described.

[0055] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A kit for constructing a TBX19 p.Thr187Ala point mutation mouse model, characterized in that: It includes gRNA and single-stranded oligo donor DNA; the nucleotide sequence of the gRNA is shown as SEQ ID NO.1, and the nucleotide sequence of the single-stranded oligo donor DNA is shown as SEQ ID NO.

3.

2. The kit according to claim 1, characterized in that The kit also includes Cas9 mRNA and Cas9 reaction buffer.

3. Use of the kit according to claim 1 or 2 in constructing a TBX19 p.Thr187Ala point mutation mouse model.

4. A method for constructing a TBX19 p.Thr187Ala point mutation mouse model, characterized in that: The following steps are involved: Mixing Cas9 mRNA, gRNA, single-stranded oligo donor DNA and Cas9 reaction buffer to obtain a reaction mixture; the gRNA and single-stranded oligo donor DNA are the gRNA and single-stranded oligo donor DNA in the kit according to claim 1 or 2; After injecting the reaction mixture into mouse fertilized eggs, the fertilized eggs that survive the injection are transplanted into recipient mother mice to produce F0 generation mice; Determine the F0 generation of mice TBX19 The genotype of the gene was determined, and the mutant positive F0 generation mice were obtained; The mutant positive F0 generation mice are mated with wild-type mice to obtain F1 generation mice; Determine the F1 generation of mice TBX19 The genotype of the gene was determined, and positive F1 mice were obtained; The positive F1 generation mice were hybridized to obtain F2 generation mice containing homozygous TBX19 p.Thr187Ala point mutation.

5. The method according to claim 4, characterized in that The concentration of Cas9 mRNA in the reaction mixture was 5 ng / μl, the concentration of gRNA was 2 ng / μl, and the concentration of single-stranded oligo donor DNA was 100 ng / μl.

6. The method according to claim 4, characterized in that The primers used in the assay include: TBX19 Gene amplification primers and sequencing primers.

7. The method according to claim 6, characterized in that Said TBX19 The gene amplification primers consist of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

5.

8. The method according to claim 6 or 7, characterized in that: The nucleotide sequence of the sequencing primer is shown in SEQ ID NO.

4.

9. Use of the TBX19 p.Thr187Ala point mutation mouse model constructed by the method according to any one of claims 4 to 8 in any one of 1) to 3): 1) As an animal model for observing hypothalamic-pituitary-adrenal axis dysfunction; 2) As an animal model of adrenocorticotropic hormone deficiency; 3) As an animal model for the development of drugs for adrenocorticotropic hormone deficiency.

10. The use according to claim 9, characterized in that: 2) The animal model is an animal model for the occurrence and / or development of adrenocorticotropic hormone deficiency.

Images