Method and device for identifying Trachinotus anak and wild population and cultured population

Abstract

The present invention relates to a method for identifying Trachinotus anak and its wild and cultured populations, including the following steps: collecting the Trachinotus anak to be identified, conducting preliminary morphological identification, morphological measurement, DR imaging, and DNA extraction on the samples; preliminarily determining the species of the samples to be identified based on morphological characteristics using the retrieval table; amplifying the DNA to be identified using the primers; comparing the sequences of the amplification products with the COI sequences downloaded from the NCBI database, and constructing a phylogenetic tree to determine the species of the samples to be identified at the molecular level; comprehensively considering the morphological and molecular biological results to finally determine the species of the samples to be identified; through stepwise discriminant analysis of 22 standardized morphological measurement data of 108 Trachinotus anak (50 in the natural population and 58 in the cultured population), the present invention establishes a discriminant function equation, which can accurately, quickly, and in large quantities identify Trachinotus anak and its wild and cultured populations.

Description

Technical Field

[0001] The present invention relates to the technical field related to morphology and molecular marker identification, and in particular to a method and a device for identifying anaconda pomfret and its wild population and cultured population. Background Art

[0002] Golden pomfret belongs to the class Actinopterygii, order Perciformes, family Carangidae, and genus Trachinotus, and is one of the main marine farmed fish in Asia. The name "golden pomfret" is used to refer to different species, including T. ovatus, T. mookalee, T. anak, and T. blochii. The first three are collectively known as short-fin golden pomfret, while the latter is known as long-fin golden pomfret. The classification of these species has long been unclear, which is not conducive to the protection of golden pomfret germplasm resources and hinders the sustainable development of the aquaculture industry. In addition, it is difficult to distinguish between farmed and wild populations, resulting in the phenomenon of farmed fish posing as wild fish, which not only damages the legitimate rights and interests of consumers, but also disrupts the market competition order.

[0003] Currently, there is a lack of research on the classification of golden pomfret. Therefore, constructing a method that can accurately, simply and quickly identify the golden pomfret and determine the wild and farmed populations is of great significance for the protection of the germplasm resources of wild populations of the golden pomfret and the sustainable development of the aquaculture industry. Summary of the invention

[0004] The purpose of the present invention is to solve at least one of the deficiencies of the prior art and to provide a method for identifying the Ana pomfret and its wild population and cultured population.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] Specifically, a method for identifying the Ana pomfret and its wild and farmed populations is proposed, including the following:

[0007] Obtaining golden pomfret samples to be identified;

[0008] Performing morphological measurement on the golden pomfret sample to be identified to obtain its morphological measurement data, and performing DR imaging on the golden pomfret sample to be identified to obtain its DR imaging result;

[0009] Based on the morphological measurement data and the DR imaging results, combined with the pre-established retrieval table, it is determined whether the golden pomfret sample to be identified is the ana pomfret, and this determination result is recorded as the first determination result;

[0010] Extracting DNA from the golden pomfret sample to be identified to obtain its DNA;

[0011] Using the said DNA as a template, PCR amplification is carried out with primers to obtain an amplification product, and the amplification product is purified and sequenced to obtain a sequencing result;

[0012] The said sequencing result is compared with the COI sequence downloaded from the NCBI database, a phylogenetic tree is constructed, and it is judged whether the said golden pompano sample to be identified is Trachinotus anak, and this judgment result is recorded as the second judgment result;

[0013] If both the first judgment result and the second judgment result indicate that the said golden pompano sample to be identified is Trachinotus anak, then the said golden pompano sample to be identified is determined as Trachinotus anak;

[0014] The said morphological measurement data are standardized and then substituted into a pre-established discriminant function equation, and the category of the said golden pompano sample among Trachinotus anak is determined according to the calculation result of the discriminant function equation, where the category includes a cultured population and a wild population.

[0015] Furthermore, specifically, the said morphological measurement data include,

[0016] Fork length FL, distance from the tip of the snout to the origin of the first dorsal fin Sn-D1O, distance from the tip of the snout to the origin of the second dorsal fin Sn-D2O, distance from the tip of the snout to the origin of the pelvic fin Sn-P2O, distance from the tip of the snout to the origin of the anal fin Sn-A2O, distance from the origin of the first dorsal fin to the origin of the pelvic fin D1O-P2O, distance from the origin of the first dorsal fin to the origin of the anal fin D1O-A2O, distance from the origin of the second dorsal fin to the origin of the pelvic fin D2O-P2O, distance from the origin of the second dorsal fin to the origin of the anal fin D2O-A2O, body depth MBD, half body depth at the origin of the pectoral fin P1-D2I, length of the second dorsal fin HD2L, length of the anal fin HAL, length of the pectoral fin P1L, length of the pelvic fin P2L, base length of the second dorsal fin LDB, base length of the anal fin LAB, head length HL, length of the postorbital part of the head PoHL, eye diameter ED, snout length SnL, length of the maxilla UjL, height of the maxilla MaD.

[0017] Furthermore, specifically, the pre-established retrieval table is as follows:

[0018] 1(2) Body oval, body silvery white, with multiple oval dark spots on the body side, dorsal fin and anal fin white, tips black, caudal fin black, only the edge white Trachinotus ovatus Trachinotus ovatus (Eastern Atlantic);

[0019] 2(1) Body rhomboid, body golden yellow, dorsal region grayish yellow, or body silvery white, dorsal region grayish green, no spots on the side, dorsal fin and anal fin yellow, no black tips, caudal fin yellow;

[0020] 3(4) The first interspinal bone is oval-shaped. The anterior ray of the second dorsal fin is quite elongated, 1.5 to 2.0 times the length of the head. For individuals of 100 to 400 mm, it is 35 to 60% of the length of the fork. Trachinotus blochii (Indo-Pacific);

[0021] 4(3) The first interspinal bone is inverted "L" shape, the anterior fin rays of the second dorsal fin and anal fin are both short, and the length of the second dorsal fin is 24-30% of the length of the fork;

[0022] 5(6) The ventral ribs did not increase in size, and the preorbital and nasal bones did not increase in bone density. The supraoccipital bones of individuals with a fork length of more than 200 mm became wider and shaped like an oblong column, and this was more obvious in individuals with a fork length of more than 300 mm. Trachinotus mookalee (Indo-Pacific);

[0023] 6(5) The supracervical bone is thin and blade-shaped. The second or third ventral rib is enlarged, and the preorbital and nasal bones of individuals with a fork length of more than 300 mm show increased bone density. Ana Trachinotus anak (Western Pacific).

[0024] Further, specifically, the primers used for PCR amplification include,

[0025] FishF1 is shown in the sequence listing as SEQ ID 50: 5'-TCAACCAA CCACAAAGACATTGGCAC-3',

[0026] FishR1 is shown in the sequence ID 51 of the sequence listing: 3'-TAGACTTCTGGGTGGCCAAAC AATCA-5',

[0027] The amplification system was: DNA template 2 μL, TaqPCR Mix 12.5 μL, ddH2O 6.5 μL, MgCl2 2 μL, primer FishF1 1 μL, primer FishR1 1 μL.

[0028] The PCR amplification program is as follows: pre-denaturation at 95°C for 3 min, denaturation at 92°C for 45 s, annealing at 50°C for 45 s, extension at 72°C for 1 min, 35 cycles, and finally extension at 72°C for 10 min.

[0029] Further, specifically, the sequencing result is compared with the COI sequence downloaded from the NCBI database, a phylogenetic tree is constructed, and it is determined whether the golden pomfret sample to be identified is an ana pomfret, including:

[0030] The amplified product sequence in the sequencing result is compared with the COI sequence downloaded from the NCBI database to construct a phylogenetic tree; wherein the COI sequence downloaded from the NCBI database is shown as SEQ ID No.1-45, SEQ ID No.1-43 is the COI sequence of the genus Pomfret, and SEQ ID No.44-45 is the outgroup sequence required for constructing the phylogenetic tree. If in the phylogenetic tree, the amplified product sequence and the COI sequence corresponding to the Ana Pomfret are clustered into one branch, then the molecular marker identification technology indicates that the golden pomfret sample to be identified is Ana Pomfret.

[0031] Further, specifically, the morphometric data is standardized as follows,

[0032] The back-of-eye head length PoHL, eye diameter ED, snout length SnL, maxillary length UjL, and maxillary height MaD were divided by the head length, and the other measurements were divided by the fork length for standardization.

[0033] Further, specifically, the discriminant function equation is constructed based on the stepwise discriminant method, and the process includes:

[0034] The standardized morphometric data were used to construct a statistical model using the Wilk-Lambda method. F The type distribution value is used as a benchmark. F When the value is greater than 3.84, the corresponding variable is introduced into the model. F When the value was less than 2.71, the corresponding variables were removed, and finally five standardized morphological measurement data were selected: the distance from the snout to the starting point of the pelvic fin / fork length was recorded as X1, the half-body height at the starting point of the pectoral fin / fork length was recorded as X2, the base length of the anal fin / fork length was recorded as X3, the length of the head behind the eye / head length was recorded as X4, and the eye diameter / head length was recorded as X5;

[0035] The discriminant function equations established include the discriminant equations of wild populations and the discriminant equations of farmed populations.

[0036] The discriminant equation of the wild population is as follows:

[0037] F1=3504.230*X1-650.078*X2+2317.691*X3+1635.079*X4+1324.686*X5-1467.609;

[0038] The discriminant equation of the breeding population is as follows:

[0039] F2=3428.068*X1-596.227*X2+2251.891*X3+1661.023*X4+1373.527*X5-1462.008.

[0040] Further, specifically, determining the category of the golden pompano sample among Trachinotus anak in accordance with the calculation result of the discrimination function equation includes:

[0041] Calculating the values of F1 and F2 of the golden pompano sample respectively, and taking the category corresponding to the discrimination equation to which the relatively higher value of the F1 and F2 values belongs as the category of the golden pompano sample among Trachinotus anak.

[0042] The present invention also provides a device for identifying Trachinotus anak and its wild population and cultured population, including the following:

[0043] A sample acquisition module for acquiring a golden pompano sample to be identified;

[0044] A data acquisition module for performing morphological measurement on the golden pompano sample to be identified to obtain its morphological measurement data, and performing DR imaging on the golden pompano sample to be identified to obtain its DR imaging result;

[0045] A first judgment module for judging whether the golden pompano sample to be identified is Trachinotus anak based on the morphological measurement data and the DR imaging result in combination with a pre-established retrieval table, and recording this judgment result as the first judgment result;

[0046] A DNA extraction module for extracting DNA from the golden pompano sample to be identified;

[0047] A PCR amplification module for using the DNA as a template, performing PCR amplification with primers to obtain an amplification product, and purifying and sequencing the amplification product to obtain a sequencing result;

[0048] A second judgment module for comparing the sequencing result with the COI sequence downloaded from the NCBI database, constructing a phylogenetic tree, and judging whether the golden pompano sample to be identified is Trachinotus anak, and recording this judgment result as the second judgment result;

[0049] A species determination module for determining the golden pompano sample to be identified as Trachinotus anak when both the first judgment result and the second judgment result indicate that the golden pompano sample to be identified is Trachinotus anak;

[0050] A category determination module for standardizing the morphological measurement data and then substituting it into a pre-established discrimination function equation, and determining the category of the golden pompano sample among Trachinotus anak according to the calculation result of the discrimination function equation, where the category includes a cultured population and a wild population.

[0051] The present invention provides a method for identifying Trachinotus anak and differentiating between wild and farmed populations, provides the COI sequence for identifying Trachinotus anak, and establishes a discriminant equation for natural and farmed populations of Trachinotus anak. The method of the present invention is economical, simple, highly repeatable, and can identify a large number of Trachinotus anak at one time. It can determine the origin based on morphological data without harming Trachinotus anak, which is beneficial to the protection of the germplasm resources of the wild population of Trachinotus anak and the sustainable development of the aquaculture industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] By describing the embodiments shown in the accompanying drawings in detail, the above and other features of the present disclosure will become more apparent. The same reference numerals in the drawings of the present disclosure denote the same or similar elements. Obviously, the drawings in the following description are only some embodiments of the present disclosure. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts. In the drawings:

[0053] Figure 1 The figure shows a flowchart of the method for identifying Trachinotus anak and differentiating between wild and farmed populations according to the present invention;

[0054] Figure 2 The figure shows a schematic diagram of the morphological measurement of Trachinotus ovatus in the present invention;

[0055] Figure 3 The figure shows a DR diagram of Trachinotus anak, Trachinotus mookalee, and Trachinotus blochii;

[0056] Figure 4 The figure shows a schematic diagram of the phylogenetic tree of the genus Trachinotus. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0057] The following will clearly and completely describe the concept, specific structure, and technical effects of the present invention in combination with the embodiments and the drawings, so as to fully understand the purpose, solution, and effects of the present invention. It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments can be combined with each other. The same reference numerals used throughout the drawings denote the same or similar parts.

[0058] The present invention collected samples of Trachinotus anak from cultured and natural populations of different sizes. Through skeletal analysis, it was revealed that for fish with a fork length exceeding 300 mm, the preorbital bone and nasal bone showed an increase in bone density, and the second and third ventral ribs were enlarged and showed an increase in bone density. Compared with the type specimen, these samples were identified as Trachinotus anak. The phylogenetic tree constructed based on COI showed that all sequences clustered together with the sequences identified as Trachinotus anak. Based on the above results, it was generally found that the commonly found Trachinotus ovatus is actually Trachinotus anak, not Trachinotus blochii. The true Trachinotus blochii only exists in the eastern Atlantic. Traditionally, the presence of lingual teeth has been used to distinguish Trachinotus anak (toothless) from Trachinotus mookalee (toothed). However, the present invention found that most samples of Trachinotus anak also have lingual teeth, indicating that this feature is not a reliable distinguishing feature.

[0059] Based on the above analysis, in Example 1, referring to Figure 1 , the present invention proposes a method for identifying Trachinotus anak and its wild and cultured populations, including the following:

[0060] Obtain a Trachinotus ovatus sample to be identified;

[0061] Perform morphological measurements on the Trachinotus ovatus sample to be identified to obtain its morphological measurement data, and perform DR imaging on the Trachinotus ovatus sample to be identified to obtain its DR imaging results (refer to Figure 3 );

[0062] Based on the morphological measurement data and the DR imaging results, combined with a pre-established retrieval table (where the retrieval and comparison method can be manual comparison, or a relevant network model can be established to extract and classify the features of the retrieval table through the network model, automatically identify the input morphological measurement data and DR imaging results, and determine whether the Trachinotus ovatus sample to be identified is Trachinotus anak according to the category of the retrieval table to which the identification result belongs), determine whether the Trachinotus ovatus sample to be identified is Trachinotus anak, and record this judgment result as the first judgment result (where if the comparison is carried out manually, the manually input comparison result can be directly obtained, and if it is an intelligent identification through a relevant network model, the identification result can be directly obtained and the result can be checked and corrected manually);

[0063] Extract DNA from the Trachinotus ovatus sample to be identified to obtain its DNA;

[0064] Using the DNA as a template, perform PCR amplification with primers to obtain an amplification product, purify and sequence the amplification product to obtain a sequencing result;

[0065] Compare the sequencing result with the COI sequence downloaded from the NCBI database, construct a phylogenetic tree, determine whether the Trachinotus ovatus sample to be identified is Trachinotus anak, and record this judgment result as the second judgment result;

[0066] Among them, the COI sequences downloaded from the NCBI database are shown as SEQ ID No. 1-45. SEQ ID No. 1-43 are the COI sequences of Trachinotus, and SEQ ID No. 44-45 are the outgroup sequences required for constructing the phylogenetic tree.

[0067] If both the first judgment result and the second judgment result indicate that the golden pompano sample to be identified is Trachinotus anak, then the golden pompano sample to be identified is determined as Trachinotus anak.

[0068] Standardize the morphological measurement data and then substitute it into the pre-established discriminant function equation. Determine the category of the golden pompano sample in Trachinotus anak according to the calculation result of the discriminant function equation, where the category includes the cultured population and the wild population.

[0069] Refer to Figure 2 , as a preferred embodiment of the present invention, specifically, the morphological measurement data includes

[0070] Fork length FL, distance from the tip of the snout to the origin of the first dorsal fin Sn-D1O, distance from the tip of the snout to the origin of the second dorsal fin Sn-D2O, distance from the tip of the snout to the origin of the pelvic fin Sn-P2O, distance from the tip of the snout to the origin of the anal fin Sn-A2O, distance from the origin of the first dorsal fin to the origin of the pelvic fin D1O-P2O, distance from the origin of the first dorsal fin to the origin of the anal fin D1O-A2O, distance from the origin of the second dorsal fin to the origin of the pelvic fin D2O-P2O, distance from the origin of the second dorsal fin to the origin of the anal fin D2O-A2O, body height MBD, half body height at the origin of the pectoral fin P1-D2I, second dorsal fin length HD2L, anal fin length HAL, pectoral fin length P1L, pelvic fin length P2L, second dorsal fin base length LDB, anal fin base length LAB, head length HL, postorbital head length PoHL, eye diameter ED, snout length SnL, maxilla length UjL, maxilla height MaD.

[0071] As a preferred embodiment of the present invention, specifically, the pre-established key is as follows:

[0072] 1(2) Body oval, body silvery white, with multiple oval dark spots on the body side, dorsal fin and anal fin white, tips black, caudal fin black, only the edge white Trachinotus ovatus Trachinotus ovatus (East Atlantic);

[0073] Among them, this key adopts the continuous key format. The numbers at the beginning of the sentence represent the entry numbers, which are used to identify the current feature description; the numbers in parentheses represent the target entry to jump to if the features of the current entry are not met. Here, "1" is the number of this entry. If the morphological characteristics of entry 1 are met, it indicates that the species is Trachinotus ovatus; if the morphological characteristics of entry 1 are not met, jump to entry 2.

[0074] 2(1) Body rhombus-shaped, golden yellow with grayish yellow dorsal area, or silvery white with grayish green dorsal area, no spots on the sides, dorsal and anal fins yellow without black tip, caudal fin yellow;

[0075] Among them, "2" is the number of the item. If it meets the morphological characteristics of item 2, it will jump to item 3 to continue checking other morphological characteristics; if it does not meet the morphological characteristics of item 2, it will jump to item 1.

[0076] 3(4) The first interspinal bone is oval-shaped. The anterior ray of the second dorsal fin is quite elongated, 1.5 to 2.0 times the length of the head. For individuals of 100 to 400 mm, it is 35 to 60% of the length of the fork. Trachinotus blochii (Indo-Pacific);

[0077] Among them, "3" is the number of the entry. If the morphological characteristics of entry 3 are met, it indicates that the species is Brandt's pomfret; if the morphological characteristics of entry 3 are not met, jump to entry 4.

[0078] 4(3) The first interspinal bone is inverted "L" shape, the anterior fin rays of the second dorsal fin and anal fin are both short, and the length of the second dorsal fin is 24-30% of the length of the fork;

[0079] Among them, "4" is the number of the item. If it meets the morphological characteristics of item 4, jump to item 5 to continue checking other morphological characteristics; if it does not meet the morphological characteristics of item 4, jump to item 3.

[0080] 5(6) The ventral ribs did not increase in size, and the preorbital and nasal bones did not increase in bone density. The supraoccipital bones of individuals with a fork length of more than 200 mm became wider and shaped like an oblong column, and this was more obvious in individuals with a fork length of more than 300 mm. Trachinotus mookalee (Indo-Pacific);

[0081] Among them, "5" is the number of the entry. If the morphological characteristics of entry 5 are met, it indicates that the species is Mook pomfret; if the morphological characteristics of entry 5 are not met, jump to entry 6.

[0082] 6(5) The supracervical bone is thin and blade-shaped. The second or third ventral rib is enlarged, and the preorbital and nasal bones of individuals with a fork length of more than 300 mm show increased bone density. Ana Trachinotus anak (Western Pacific);

[0083] Among them, "6" is the number of the entry. If the morphological characteristics of entry 6 are met, it indicates that the species is the Ana pomfret; if the morphological characteristics of entry 6 are not met, jump to entry 5.

[0084] As a preferred embodiment of the present invention, specifically, the primers used for PCR amplification include:

[0085] FishF1 is as shown in SEQ ID NO: 50 of the sequence listing: 5’-TCAACCAACCACAAAGACATTGGCAC-3’;

[0086] FishR1 is as shown in SEQ ID NO: 51 of the sequence listing: 3’-TAGACTTCTGGGTGGCCAAACAATCA-5’;

[0087] The amplification system is: 2 μL of DNA template, 12.5 μL of TaqPCR Mix, 6.5 μL of ddH2O, 2 μL of MgCl2, 1 μL of primer FishF1, and 1 μL of primer FishR1.

[0088] The PCR amplification program is: pre-denaturation at 95 °C for 3 min, denaturation at 92 °C for 45 s, annealing at 50 °C for 45 s, extension at 72 °C for 1 min, 35 cycles, and finally extension at 72 °C for 10 min.

[0089] As a preferred embodiment of the present invention, specifically, the sequencing results are compared with the COI sequences downloaded from the NCBI database to determine whether the identified golden pompano sample is Trachinotus anak, including,

[0090] The amplified product sequence in the sequencing results is compared with the COI sequences downloaded from the NCBI database to construct a phylogenetic tree (refer to Figure 4 ); if in the phylogenetic tree, the amplified product sequence and the COI sequence corresponding to Trachinotus anak are clustered into one branch, the molecular marker identification technology indicates that the identified golden pompano sample is Trachinotus anak.

[0091] The COI sequences downloaded from the NCBI database are as shown in SEQ ID No. 5-49, SEQ ID No. 1-43 are the COI sequences of Trachinotus, and SEQ ID No. 44-45 are the outgroup sequences required for constructing the phylogenetic tree.

[0092] As a preferred embodiment of the present invention, specifically, the morphological measurement data is standardized as follows,

[0093] The postorbital head length PoHL, eye diameter ED, snout length SnL, maxilla length UjL, and maxilla height MaD are divided by the head length, and other measurement data are divided by the fork length for standardization.

[0094] As a preferred embodiment of the present invention, specifically, a discriminant function equation is constructed based on the stepwise discriminant method, and the process includes,

[0095] The standardized morphological measurement data is used to construct a statistical model by the Wilk-Lambda method, with FUsing the type distribution value as a benchmark, when F the value is greater than 3.84, the corresponding variable is introduced into the model. When F the value is less than 2.71, the corresponding variable is removed. By gradually introducing variables, 22 morphological measurement data are gradually introduced through 5 operation steps. According to the contribution rate of the variables to the model, the variables with small contribution rates are gradually eliminated. Finally, the distance from the tip of the snout to the origin of the pelvic fin / fork length is denoted as X1, the semi-body height at the origin of the pectoral fin / fork length is denoted as X2, the base length of the anal fin / fork length is denoted as X3, the postorbital head length / head length is denoted as X4, and the eye diameter / head length is denoted as X5. These 5 standardized morphological measurement data are selected;

[0096] The established discriminant function equations include the discriminant equation for the wild population and the discriminant equation for the cultured population.

[0097] Among them, the discriminant equation for the wild population is as follows:

[0098] F1 = 3504.230 * X1 - 650.078 * X2 + 2317.691 * X3 + 1635.079 * X4 + 1324.686 * X5 - 1467.609;

[0099] The discriminant equation for the cultured population is as follows:

[0100] F2 = 3428.068 * X1 - 596.227 * X2 + 2251.891 * X3 + 1661.023 * X4 + 1373.527 * X5 - 1462.008.

[0101] As a preferred embodiment of the present invention, specifically, the category of the golden pompano sample in Trachinotus anak is determined according to the calculation result of the discriminant function equation, including,

[0102] Calculate the values of F1 and F2 of the golden pompano sample respectively, and use the category corresponding to the discriminant equation to which the relatively higher value of F1 and F2 belongs as the category of the golden pompano sample in Trachinotus anak.

[0103] In this preferred embodiment set, the above discriminant function equation is proposed, and a significance test is performed on the discriminant function. The result shows that P < 0.01, indicating that the discriminant function reaches a significant level and can effectively distinguish the natural population and the cultured population.

[0104] Combining all the preferred embodiments proposed in the present invention, Example 2 includes the following steps.

[0105] 1) Collect the golden pompano samples to be identified.

[0106] 2) Conduct preliminary morphological identification, morphological measurement, DR imaging, and DNA extraction on the samples; weigh the body weight with an electronic balance, take pictures of the left side of the fish body using a camera, and then measure the fish body morphology with Mingmei to obtain the following data: fork length FL, distance from the tip of the snout to the origin of the first dorsal fin Sn-D1O, distance from the tip of the snout to the origin of the second dorsal fin Sn-D2O, distance from the tip of the snout to the origin of the pelvic fin Sn-P2O, distance from the tip of the snout to the origin of the anal fin Sn-A2O, distance from the origin of the first dorsal fin to the origin of the pelvic fin D1O-P2O, distance from the origin of the first dorsal fin to the origin of the anal fin D1O-A2O, distance from the origin of the second dorsal fin to the origin of the pelvic fin D2O-P2O, distance from the origin of the second dorsal fin to the origin of the anal fin D2O-A2O, body height MBD, half body height at the origin of the pectoral fin P1-D2I, length of the second dorsal fin HD2L, length of the anal fin HAL, length of the pectoral fin P1L, length of the pelvic fin P2L, base length of the second dorsal fin LDB, base length of the anal fin LAB, head length HL, length of the postorbital head PoHL, eye diameter ED, snout length SnL, length of the maxilla UjL, height of the maxilla MaD.

[0107] The Mingmei mentioned above is a powerful 2D image processing and analysis software with rich measurement functions.

[0108] There is no special limitation on the method for extracting the DNA of the sample to be identified. Any conventional method for extracting animal genomic DNA in the art can be used, and it is preferably extracted using a commercial kit.

[0109] 3) Based on the morphological measurement data (length of the second dorsal fin / fork length) and DR imaging results obtained in step 2), compare with the descriptions in the checklist to determine whether the sample to be identified is Trachinotus anak from a morphological perspective.

[0110] The DR imaging results mainly observe the shapes of the first interspinous bones and the supraoccipital bone, whether there is an increase in bone density in the preorbital bone and nasal bone, whether the ventral ribs are enlarged, and whether there is an increase in bone density.

[0111] The content of the checklist is as follows:

[0112] 1(2) Body oval. The body is silvery white with multiple oval dark spots on the body side. The dorsal fin and anal fin are white with black tips. The caudal fin is black with only the edge white Trachinotus ovatus Trachinotus ovatus (East Atlantic);

[0113] 2(1) Body rhomboid. The body is golden yellow with a grayish-yellow back region, or the body is silvery white with a grayish-green back region and no spots on the side. The dorsal fin and anal fin are yellow without black tips, and the caudal fin is yellow;

[0114] 3(4) The first interspinous bone of the myelospine is ellipsoidal. The anterior fin rays of the second dorsal fin are quite elongated, 1.5 - 2.0 times the head length, and for individuals of 100 - 400 mm, they are 35 - 60% of the fork length ···· Trachinotus blochii Trachinotus blochii (Indo - Pacific);

[0115] 4(3) The first interspinous bone of the myelospine is inverted "L" - shaped. The anterior fin rays of both the second dorsal fin and the anal fin are relatively short. The length of the second dorsal fin is 24 - 30% of the fork length;

[0116] 5(6) The ventral ribs are not enlarged. There is no increase in bone density in the preorbital bone and the nasal bone. In individuals with a fork length exceeding 200 mm, the supraoccipital bone becomes wider and is in the shape of a long elliptical cylinder, which is more obvious in individuals with a fork length exceeding 300 mm ········· Trachinotus mookalee Trachinotus mookalee (Indo - Pacific);

[0117] 6(5) The supraoccipital bone is thin and blade - shaped. The second or third ventral rib is enlarged. In individuals with a fork length exceeding 300 mm, there is an increase in bone density in the preorbital bone and the nasal bone ···· Trachinotus anak Trachinotus anak (Western Pacific);

[0118] 4) Using the DNA obtained in step 2) as a template, perform PCR amplification with primers to obtain an amplification product. Purify and sequence the amplification product, and compare the sequencing results.

[0119] The template DNA described is located on mitochondrial DNA (mtDNA) COI.

[0120] The primers for amplifying DNA include FishF1 and FishR1; the nucleotide sequence of FishF1 is as follows: FishF1: 5’ - TCAACCAA CCACAAAGACATTGGCAC - 3’; the nucleotide sequence of FishR1 is as follows, specifically: FishR1: 3’ - TAGACTTCTGGGTGGCCAAAC AATCA - 5’.

[0121] The amplification system of the amplification is calculated based on 25 μL and includes the following components: 2 μL of DNA template, 12.5 μL of TaqPCR Mix, 6.5 μL of ddH2O, 2 μL of MgCl2, 1 μL of primer FishF1, and 1 μL of primer FishR1.

[0122] The PCR amplification program is as follows: pre - denaturation at 95°C for 3 min, denaturation at 92°C for 45 s, annealing at 50°C for 45 s, extension at 72°C for 1 min, 35 cycles, and finally extension at 72°C for 10 min, and preservation at 4°C.

[0123] After the amplification, preferably, purification and sequencing of the amplification products are further included. The present invention does not have special limitations on the purification and sequencing methods, and preferably, it is entrusted to a biological sequencing company for processing.

[0124] 5) Align the amplified product sequence with the COI sequence downloaded from the NCBI database to construct a phylogenetic tree; if in the phylogenetic tree, the amplified product sequence clusters into a branch with Trachinotus anak, then the molecular marker identification technology indicates that the sample to be identified is Trachinotus anak.

[0125] The COI sequences used for constructing the phylogenetic tree are shown in SEQ ID No. 1-49, wherein SEQ ID No. 1-43 are the COI sequences of other fishes in the genus Trachinotus, SEQ ID No. 44-45 are the outgroup sequences required for constructing the phylogenetic tree, and SEQ ID No. 46-49 are the COI sequences of the measured Trachinotus anak.

[0126] 6) If the results of steps 3) and 5) are both Trachinotus anak, then the sample to be identified is determined to be Trachinotus anak.

[0127] 7) Standardize the postorbital head length (PoHL), eye diameter (ED), snout length (SnL), upper jaw length (UjL), and upper jaw height (MaD) by dividing them by the head length, and divide other measurement data by the fork length using the morphological measurement data obtained in step 2).

[0128] 8) Use the Wilk-Lambda method to construct a statistical model with the data in step 7). Taking the F-distribution value as the benchmark, when F the value is greater than 3.84, introduce the corresponding variable into the model; when F the value is less than 2.71, remove the corresponding variable. By gradually introducing variables, 22 morphological measurement data are gradually introduced through 5 operation steps. According to the contribution rate of the variables to the model, gradually eliminate the variables with small contribution rates, and screen out 5 variables: the distance from the snout tip to the origin of the ventral fin / fork length, the semi-body height at the origin of the pectoral fin / fork length, the base length of the anal fin / fork length, postorbital head length / head length, and eye diameter / head length. Conduct a collinearity analysis on the 5 variables, and the results show that the collinearity among the 5 variables is very low and there is no collinearity problem. Let X1, X2, X3, X4, and X5 represent the distance from the snout tip to the origin of the ventral fin / fork length, the semi-body height at the origin of the pectoral fin / fork length, the base length of the anal fin / fork length, postorbital head length / head length, and eye diameter / head length respectively, and establish the discriminant equation as follows:

[0129] Among them, the discriminant equation of the natural population is as follows:

[0130] F1 = 3504.230*X1 - 650.078*X2 + 2317.691*X3 + 1635.079*X4 + 1324.686*X5 - 1467.609;

[0131] The discriminant equation for the cultured population is as follows:

[0132] F2 = 3428.068*X1 - 596.227*X2 + 2251.891*X3 + 1661.023*X4 + 1373.527*X5 - 1462.008.

[0133] Perform a significance test on the discriminant function. The results show that P < 0.01, indicating that the discriminant function reaches a significant level and can effectively distinguish between the natural population and the cultured population.

[0134] 9) Substitute the individual morphological measurement data of each Trachinotus anak into the discriminant function equation. The category corresponding to the discriminant function with a larger function value is the category to which it belongs.

[0135] Specifically, when the present invention is applied, it includes the following steps.

[0136] 1. Collect a total of 108 samples of Trachinotus ovatus, including 58 samples from the cultured population and 50 samples from the natural population. Weigh the body weight with an electronic balance, take photos of the left side of the fish body with a camera, and take an appropriate amount of tissue for storage at -20°C. Measure the fish body morphology using Mingmei to obtain the following data:

[0137] Fork length FL, distance from the tip of the snout to the origin of the first dorsal fin Sn-D1O, distance from the tip of the snout to the origin of the second dorsal fin Sn-D2O, distance from the tip of the snout to the origin of the pelvic fin Sn-P2O, distance from the tip of the snout to the origin of the anal fin Sn-A2O, distance from the origin of the first dorsal fin to the origin of the pelvic fin D1O-P2O, distance from the origin of the first dorsal fin to the origin of the anal fin D1O-A2O, distance from the origin of the second dorsal fin to the origin of the pelvic fin D2O-P2O, distance from the origin of the second dorsal fin to the origin of the anal fin D2O-A2O, body height MBD, half body height at the origin of the pectoral fin P1-D2I, length of the second dorsal fin HD2L, length of the anal fin HAL, length of the pectoral fin P1L, length of the pelvic fin P2L, base length of the second dorsal fin LDB, base length of the anal fin LAB, head length HL, head length behind the eye PoHL, eye diameter ED, snout length SnL, length of the maxilla UjL, height of the maxilla MaD.

[0138] 2. The obtained morphological measurement data shows that: the ratio of the length of the second dorsal fin to the fork length is less than 30%; the DR imaging results show that: the first interspinous bone of the vertebra is in an inverted "L" shape, the occipital bone is blade-shaped, the second and third ventral ribs show enlargement, and there is an increase in bone density in the preorbital bone and nasal bone of individuals with a fork length exceeding 300 mm.

[0139] Comparing with the description in the retrieval table, the sample to be identified is Trachinotus anak.

[0140] 3. Extract the DNA of the sample to be identified, perform PCR amplification using the extracted DNA as a template, purify and sequence the amplification results, and compare the sequencing results. The primer sequences are:

[0141] FishF1 is as shown in SEQ ID NO: 50 in the sequence listing: 5’-TCAACCAACCACAAAGACATTGGCAC-3’;

[0142] FishR1 is as shown in SEQ ID NO: 51 in the sequence listing: 3’-TAGACTTCTGGGTGGCCAAACAATCA-5’.

[0143] Add successively to a 0.2 ml centrifuge tube: 12.5 μL of Taq PCR Mix, 6.5 μL of ddH2O, 2 μL of MgCl2, 2 μL of DNA template, and 1 μL each of primers FishF1 and FishR1. The PCR amplification program is as follows: pre-denaturation at 95 °C for 3 min, denaturation at 92 °C for 45 s, annealing at 50 °C for 45 s, extension at 72 °C for 1 min, 35 cycles, and finally extension at 72 °C for 10 min. Send the amplification product to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0144] 4. After the sequencing is completed, compare the sequencing results and construct a phylogenetic tree based on the sequencing results.

[0145] The results of the phylogenetic tree show that ( Figure 4 ), the sample to be identified clusters into one branch with Trachinotus anak.

[0146] 5. Combining the morphological analysis (step 2) and the sequencing results (step 5) indicates that the sample to be identified is Trachinotus anak.

[0147] 6. Substitute the 5 morphological measurement data of each Trachinotus anak to be identified into the discriminant function equation respectively, and the function with the larger calculated result is the category to which it belongs. The discrimination results show (see Table 1 below) that the discrimination accuracy rate of the natural population of Trachinotus anak is 80.0%, that of the cultured population is 86.2%, and the comprehensive discrimination accuracy rate is 83.3%.

[0148] Table 1 Discrimination accuracy rates of the natural population and cultured population of Trachinotus anak

[0149]

[0150] The present invention also proposes a device for identifying Trachinotus anak and its wild population and cultured population, including the following:

[0151] A sample acquisition module for acquiring the golden pompano samples to be identified;

[0152] A data acquisition module for performing morphological measurements on the golden pompano samples to be identified to obtain their morphological measurement data, and performing DR imaging on the golden pompano samples to be identified to obtain their DR imaging results;

[0153] The first judgment module is used to judge whether the to-be-identified golden pompano sample is Trachinotus anak based on the morphometric data and the DR imaging results, combined with a pre-established retrieval table, and record this judgment result as the first judgment result;

[0154] The DNA extraction module is used to extract DNA from the to-be-identified golden pompano sample to obtain its DNA;

[0155] The PCR amplification module is used to use the DNA as a template, perform PCR amplification with primers to obtain an amplification product, purify and sequence the amplification product to obtain a sequencing result;

[0156] The second judgment module is used to compare the sequencing result with the COI sequence downloaded from the NCBI database, construct a phylogenetic tree, judge whether the to-be-identified golden pompano sample is Trachinotus anak, and record this judgment result as the second judgment result;

[0157] The species determination module is used to determine the to-be-identified golden pompano sample as Trachinotus anak when both the first judgment result and the second judgment result indicate that the to-be-identified golden pompano sample is Trachinotus anak;

[0158] The category determination module is used to standardize the morphometric data and then substitute it into a pre-established discriminant function equation, and determine the category of the golden pompano sample among Trachinotus anak according to the calculation result of the discriminant function equation, where the category includes a cultured population and a wild population.

[0159] Although the description of the present invention has been quite detailed and several of the described embodiments have been described in particular, it is not intended to be limited to any of these details or embodiments or any particular embodiment, but rather should be regarded as providing a broad interpretation of these claims in light of the prior art by reference to the appended claims, so as to effectively cover the intended scope of the present invention. In addition, the present invention has been described above with embodiments foreseeable by the inventor for the purpose of providing a useful description, and non-substantive modifications to the present invention that are not currently foreseeable may still represent equivalent modifications of the present invention.

[0160] As described above, this is only a preferred embodiment of the present invention. The present invention is not limited to the above-described embodiments. As long as it achieves the technical effects of the present invention by the same means, it should fall within the protection scope of the present invention. Within the protection scope of the present invention, its technical solutions and / or embodiments can have various different modifications and changes.

Claims

1. A method for identifying wild and cultured populations of Ana pomfret, characterized in that: Includes the following: Obtaining golden pomfret samples to be identified; Performing morphological measurement on the golden pomfret sample to be identified to obtain its morphological measurement data, and performing DR imaging on the golden pomfret sample to be identified to obtain its DR imaging result; Based on the morphological measurement data and the DR imaging results, combined with the pre-established retrieval table, it is determined whether the golden pomfret sample to be identified is the ana pomfret, and this determination result is recorded as the first determination result; Extracting DNA from the golden pomfret sample to be identified to obtain its DNA; Using the DNA as a template and primers to perform PCR amplification to obtain an amplified product, purifying the amplified product and sequencing it to obtain a sequencing result; Compare the sequencing result with the COI sequence downloaded from the NCBI database, construct a phylogenetic tree, determine whether the golden pomfret sample to be identified is an ana pomfret, and record this determination result as the second determination result; If the first judgment result and the second judgment result both indicate that the golden pomfret sample to be identified is Ana pomfret, the golden pomfret sample to be identified is determined to be Ana pomfret; The morphological measurement data is standardized and then input into a pre-established discriminant function equation, and the category of the golden pomfret sample in the anaconda is determined according to the calculation result of the discriminant function equation, wherein the categories include farmed populations and wild populations.

2. The method for identifying the Ana pomfret and its wild population and cultured population according to claim 1, characterized in that: Specifically, the morphological measurement data includes: Fork length FL, distance from snout tip to starting point of first dorsal fin Sn-D1O, distance from snout tip to starting point of second dorsal fin Sn-D2O, distance from snout tip to starting point of pelvic fin Sn-P2O, distance from snout tip to starting point of anal fin Sn-A2O, distance from starting point of first dorsal fin to starting point of pelvic fin D1O-P2O, distance from starting point of first dorsal fin to starting point of anal fin D1O-A2O, distance from starting point of second dorsal fin to starting point of pelvic fin D2O-P2O, distance from starting point of second dorsal fin to starting point of anal fin D2O-A2O, body height MBD, half body height at starting point of pectoral fin P1-D2I, length of second dorsal fin HD2L, anal fin length HAL, pectoral fin length P1L, pelvic fin length P2L, length of base of second dorsal fin LDB, length of base of anal fin LAB, head length HL, length of head behind eye PoHL, eye diameter ED, snout length SnL, maxillary length UjL, maxillary height MaD.

3. The method for identifying the Ana pomfret and its wild population and cultured population according to claim 2, characterized in that: Specifically, the pre-established search table is as follows: 1(2) The body is oval, silvery white, with multiple oval dark spots on the sides, the dorsal and anal fins are white with black tips, and the caudal fin is black with only white edges; Among them, this key table adopts a continuous key table format. The number at the beginning of the sentence indicates the item number, which is used to identify the current feature description; the number in the bracket indicates the target item to jump to if the characteristics of the current item are not met. Here, 1 is the number of the item. If the morphological characteristics of item 1 are met, it indicates that the species is oval pomfret; if the morphological characteristics of item 1 are not met, jump to item 2; 2(1) Body rhombus-shaped, golden yellow with grayish yellow dorsal area, or silvery white with grayish green dorsal area, no spots on the sides, dorsal and anal fins yellow without black tip, caudal fin yellow; Wherein, 2 is the number of the item. If the morphological characteristics of item 2 are met, then jump to item 3 to continue checking other morphological characteristics; if the morphological characteristics of item 2 are not met, then jump to item 1; 3(4) The first interspinous bone is oval-shaped, and the anterior ray of the second dorsal fin is quite elongated, 1.5 to 2.0 times the length of the head, and 35 to 60% of the fork length for individuals 100 to 400 mm long; Among them, 3 is the number of the entry. If the morphological characteristics of entry 3 are met, it indicates that the species is the Brandt's pomfret; if the morphological characteristics of entry 3 are not met, jump to entry 4; 4(3) The first interspinal bone is inverted L-shaped, the anterior rays of the second dorsal and anal fins are short, and the length of the second dorsal fin is 24-30% of the length of the fork; Wherein, 4 is the number of the item. If the morphological characteristics of item 4 are met, then jump to item 5 to continue checking other morphological characteristics; if the morphological characteristics of item 4 are not met, then jump to item 3; 5(6) The ventral ribs did not increase in size, and the preorbital and nasal bones did not increase in bone density. The supraoccipital bones of individuals with a fork length of more than 200 mm became wider and shaped like an elongated ellipse, which was more obvious in individuals with a fork length of more than 300 mm. Among them, 5 is the number of the entry. If the morphological characteristics of entry 5 are met, it indicates that the species is Muke pomfret; if the morphological characteristics of entry 5 are not met, jump to entry 6; 6(5) The supraoccipital bone is thin and blade-shaped, the second or third ventral rib is enlarged, and individuals with a fork length of more than 300 mm have increased bone density in the preorbital and nasal bones; Among them, 6 is the number of the entry. If the morphological characteristics of entry 6 are met, it indicates that the species is the Ana pomfret; if the morphological characteristics of entry 6 are not met, jump to entry 5.

4. The method for identifying the Ana pomfret and its wild population and cultured population according to claim 1, characterized in that: Specifically, the primers used for PCR amplification include: FishF1 is shown in the sequence listing as SEQ ID 50: 5'-TCAACCAA CCACAAAGACATTGGCAC-3', FishR1 is shown in the sequence ID 51: 3'-TAGACTTCTGGGTGGCCAAAC AATCA-5', The amplification system was as follows: DNA template 2 μL, TaqPCR Mix 12.5 μL, ddH2O 6.5 μL, MgCl2 2 μL, primer FishF1 1 μL, primer FishR1 1 μL; The PCR amplification program is as follows: pre-denaturation at 95°C for 3 min, denaturation at 92°C for 45 s, annealing at 50°C for 45 s, extension at 72°C for 1 min, 35 cycles, and finally extension at 72°C for 10 min.

5. The method for identifying the Ana pomfret and its wild population and cultured population according to claim 1, characterized in that: Specifically, the sequencing result is compared with the COI sequence downloaded from the NCBI database, a phylogenetic tree is constructed, and it is determined whether the golden pomfret sample to be identified is an ana pomfret, including: Compare the amplified product sequence in the sequencing result with the COI sequence downloaded from the NCBI database to construct a phylogenetic tree; If in the phylogenetic tree, the amplified product sequence and the COI sequence corresponding to the ana pomfret are clustered into one branch, then the molecular marker identification technology indicates that the golden pomfret sample to be identified is the ana pomfret.

6. The method for identifying the Ana pomfret and its wild population and cultured population according to claim 2, characterized in that: Specifically, the morphometric data are standardized as follows: The back-of-eye head length PoHL, eye diameter ED, snout length SnL, maxillary length UjL, and maxillary height MaD were divided by the head length, and the other measurements were divided by the fork length for standardization.

7. The method for identifying the Ana pomfret and its wild population and cultured population according to claim 6, characterized in that: Specifically, the discriminant function equation is constructed based on the stepwise discriminant method, and the process includes: The standardized morphometric data were used to construct a statistical model using the Wilk-Lambda method. F The type distribution value is used as a benchmark. F When the value is greater than 3.84, the corresponding variable is introduced into the model. F When the value was less than 2.71, the corresponding variables were removed, and finally five standardized morphological measurement data were selected: the distance from the snout to the starting point of the pelvic fin / fork length was recorded as X1, the half-body height at the starting point of the pectoral fin / fork length was recorded as X2, the base length of the anal fin / fork length was recorded as X3, the length of the head behind the eye / head length was recorded as X4, and the eye diameter / head length was recorded as X5; The discriminant function equations established include the discriminant equations of wild populations and the discriminant equations of farmed populations. The discriminant equation of the wild population is as follows: F1=3504.230*X1-650.078*X2+2317.691*X3+1635.079*X4+1324.686*X5-1467.609; The discriminant equation of the breeding population is as follows: F2=3428.068*X1-596.227*X2+2251.891*X3+1661.023*X4+1373.527*X5-1462.

008.

8. The method for identifying the Ana pomfret and its wild population and cultured population according to claim 7, characterized in that: Specifically, determining the category of the golden pomfret sample in the anaconda according to the calculation result of the discriminant function equation includes: The F1 and F2 values ​​of the golden pomfret sample are calculated respectively, and the category corresponding to the discriminant equation to which the relatively higher value of the F1 and F2 values ​​belongs is taken as the category of the golden pomfret sample in the Ana pomfret.

9. A device for distinguishing wild and cultured populations of Ana pomfret, characterized in that: Includes the following: A sample acquisition module, used to obtain the golden pomfret sample to be identified; A data acquisition module, used for performing morphological measurement on the golden pomfret sample to be identified to obtain its morphological measurement data, and performing DR imaging on the golden pomfret sample to be identified to obtain its DR imaging result; A first judgment module is used to judge whether the golden pomfret sample to be identified is an ana pomfret based on the morphological measurement data and the DR imaging result in combination with a pre-established search table, and record the judgment result as a first judgment result; A DNA extraction module, used to extract DNA from the golden pomfret sample to be identified to obtain its DNA; A PCR amplification module is used to use the DNA as a template and primers to perform PCR amplification to obtain an amplified product, and to purify and sequence the amplified product to obtain a sequencing result; The second judgment module is used to compare the sequencing result with the COI sequence downloaded from the NCBI database, construct a phylogenetic tree, determine whether the golden pomfret sample to be identified is an ana pomfret, and record this judgment result as the second judgment result; a species determination module, for determining the golden pomfret sample to be identified as Ana pomfret when both the first judgment result and the second judgment result indicate that the golden pomfret sample to be identified is Ana pomfret; The category determination module is used to standardize the morphological measurement data and then input them into a pre-established discriminant function equation, and determine the category of the golden pomfret sample in the anaconda according to the calculation result of the discriminant function equation, wherein the category includes a cultured population and a wild population.

Images