A prognostic biomarker for hepatocellular carcinoma and its application
By using DBR1 expression level as a prognostic marker for hepatocellular carcinoma, the inaccuracy of existing assessment methods has been addressed, enabling more precise prognostic assessment and personalized treatment, and improving the long-term survival rate of hepatocellular carcinoma patients.
Patent Information
- Application Number
- CN202510126820.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-27
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2045-01-27
AI Technical Summary
Existing prognostic assessment methods for hepatocellular carcinoma lack accuracy in predicting overall survival, recurrence risk, and metastasis trends. Traditional biomarkers such as AFP are easily affected by interference. Current treatment regimens are not ideal for hepatocellular carcinoma, and the long-term survival rate of patients needs to be improved.
The expression level of debranched enzyme homolog 1 (DBR1) was used as a diagnostic and prognostic biomarker for hepatocellular carcinoma. By measuring the expression level of DBR1 in biological samples compared with controls, the prognostic risk of patients was assessed, and DBR1 inhibitors were provided for treatment.
It improves the accuracy of prognostic assessment for hepatocellular carcinoma, provides more precise risk stratification criteria, helps develop personalized treatment plans, enhances monitoring and treatment intervention for high-risk patients, and DBR1 can also serve as a potential therapeutic target to improve treatment outcomes.
Smart Images

Figure CN120044242B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a prognostic biomarker for hepatocellular carcinoma and its application. Background Technology
[0002] Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Despite significant advancements in prevention, screening, diagnosis, and treatment technologies in recent years, the incidence and mortality rates of HCC remain high. According to 2022 data, HCC has become the sixth most common cancer globally and the third leading cause of cancer death. Liver cancer typically develops alongside long-term chronic liver disease or hepatitis virus infection, and its progression takes decades. However, many patients are diagnosed at an advanced stage, and the tumors often have aggressive metastases, making it difficult for current treatments to effectively control disease progression, resulting in a generally poor prognosis for HCC patients.
[0003] Currently, prognostic assessment of HCC mainly relies on imaging examinations (such as CT and MRI) and liver function indicators (such as tumor markers like AFP). However, these methods still have limitations in predicting the accuracy of overall survival, recurrence risk, and metastatic trends. Imaging examinations can usually only evaluate tumor progression after obvious lesions have appeared, and biomarkers such as AFP are often affected by non-cancerous diseases such as hepatitis and cirrhosis, leading to false positive or false negative results. In addition, although some novel biomarkers have been proposed, most have not yet entered clinical application, or their association with HCC progression and prognosis lacks large-scale validation, making it difficult to meet the needs of personalized prognostic assessment and treatment strategy development.
[0004] At the treatment level, recent interventions for HCC have primarily focused on angiogenesis, immune checkpoint inhibitors, and other emerging targets and gene therapy. Angiogenesis plays a crucial role in the development of HCC. Multi-target tyrosine kinase inhibitors such as sorafenib and lenvatinib, by inhibiting multiple kinase signaling pathways including VEGFR, have become first-line treatments for HCC. FGFR4 inhibitors (such as ipagogltinib) have also gradually shown good efficacy in patients with advanced HCC (especially those with FGF19 overexpression). Immune checkpoint inhibitors (ICIs) have become an important component of HCC treatment. For example, PD-1 / PD-L1 inhibitors (tislelizumab, camrelizumab, etc.) have been approved for clinical use, and CTLA-4 inhibitors (such as ipilimumab) have also shown potential in combination therapy. Multi-target combination strategies (such as the combination of TKIs and ICIs, and the combination of dual immune checkpoint inhibitors) have shown high response rates and conversion rates in multiple clinical trials. In addition, some emerging targets (such as phosphatidylserine) and gene therapy strategies are being actively explored. Some genes, such as AK R1B10, SNPD1, SNOZ6, and ZXDC, are closely related to the prognosis of HCC. However, the heterogeneity and aggressiveness of HCC still make the overall effect of existing treatments less than ideal, and the long-term survival rate of patients urgently needs to be improved.
[0005] Given the current situation, there is an urgent need to find new molecular markers and potential therapeutic targets that are closely related to the malignancy of tumors and patient prognosis in order to promote personalized diagnosis and treatment of HCC. Summary of the Invention
[0006] (a) Technical problems to be solved
[0007] Therefore, one of the main objectives of this invention is to provide the application of debranching enzyme homolog 1 (DBR1) expression level as a diagnostic and / or prognostic biomarker for hepatocellular carcinoma (HCC). This invention proposes DBR1 as a novel prognostic biomarker for HCC, which can, to some extent, compensate for the shortcomings of existing prognostic prediction systems. High expression of DBR1 may be associated with adverse prognostic factors such as malignant tumor progression and poor survival, thus providing more accurate prognostic judgments for clinicians. Furthermore, the crucial role of DBR1 in HCC cell proliferation, migration, and invasion suggests that it may be a potential therapeutic target, providing new insights for precision treatment and drug development in HCC. By integrating DBR1 with existing indicators or multi-omics data, the accuracy of prognostic assessment can be further improved, laying an important foundation for optimizing personalized treatment plans and improving long-term patient survival.
[0008] (II) Technical Solution
[0009] To address the aforementioned issues, this invention provides the application of debranched enzyme homolog 1 expression level as a diagnostic and / or prognostic biomarker for hepatocellular carcinoma.
[0010] In another aspect, the present invention provides the use of a reagent for measuring the expression level of debranched enzyme homolog 1 in a sample in the preparation of a diagnostic agent for assessing the prognosis of hepatocellular carcinoma in a subject.
[0011] In one embodiment, the application specifically includes:
[0012] S1: Obtain biological samples from the subject;
[0013] S2: Measure the expression level of debranched enzyme homolog 1 in the biological samples of the subjects;
[0014] S3: Compare the expression level of the debranched enzyme homology 1 in the biological sample of the subject with the average expression level of the debranched enzyme homology 1 from one or more control biological samples;
[0015] S4: Based on the expression level of debranched enzyme homolog 1 compared with the expression level of the control debranched enzyme homolog 1, a higher expression level of debranched enzyme homolog 1 indicates a poor prognosis for the subject with hepatocellular carcinoma.
[0016] In one embodiment, the subject is a mammal.
[0017] In one embodiment, the mammal is a human.
[0018] In one embodiment, the subject is healthy.
[0019] In one embodiment, the subject is unhealthy.
[0020] In one embodiment, the subject had hepatocellular carcinoma.
[0021] In one embodiment, the biological sample includes one or a combination of blood, serum, plasma, blood components, synovial fluid, urine, semen, saliva, feces, cerebrospinal fluid, gastric contents, vaginal secretions, mucus, tissue biopsy samples, tissue homogenates, bone marrow aspiration fluid, bone homogenates, sputum, aspirates, wound exudate, swabs, or swab washing solutions.
[0022] In one embodiment, the biological sample is a tissue sample.
[0023] In one embodiment, the tissue sample is liver tissue.
[0024] In one embodiment, the liver tissue is hepatocellular carcinoma tissue.
[0025] In one embodiment, the liver tissue is adjacent normal tissue.
[0026] In one embodiment, the liver tissue is fresh.
[0027] In one embodiment, the liver tissue is frozen.
[0028] In one embodiment, the control biological sample comprises a biological sample from the subject.
[0029] In one embodiment, the control biological sample includes a biological sample from a subject who is not the subject.
[0030] In one embodiment, subjects with higher DBR1 expression levels compared to the average DBR1 expression level in the control group are considered high-risk patients due to a higher relapse rate and poorer prognosis.
[0031] In one embodiment, subjects with lower DBR1 expression levels compared to the average DBR1 expression level in the control group are considered low-risk patients with a lower relapse rate and better prognosis.
[0032] In one embodiment, the method for detecting the DBR1 expression level includes one or a combination of quantitative PCR (RT-qPCR), electrophoresis, DNA microarray, next-generation sequencing (NGS), Western blot analysis, mass spectrometry (MS), fluorescence activated cell sorting (FACS), enzyme-linked immunosorbent assay (ELISA), immunohistochemistry (IHC), and immunofluorescence.
[0033] In one embodiment, the method for detecting DBR1 expression levels is quantitative PCR and Western blot analysis.
[0034] In another aspect, the present invention provides a diagnostic kit for assessing the prognosis of hepatocellular carcinoma in a subject, the diagnostic kit comprising the aforementioned diagnostic agent.
[0035] In another aspect, the present invention provides the use of DBA1 inhibitors in the preparation of medicaments for the prevention and / or treatment of hepatocellular carcinoma and / or diseases and / or symptoms associated with hepatocellular carcinoma.
[0036] In one embodiment, the inhibitor comprises one or a combination of antibodies, siRNA, miRNA, gRNA, sgRNA, and antisense oligonucleotides.
[0037] In one embodiment, the inhibitor is sgRNA.
[0038] In another aspect, the present invention provides the use of a pharmaceutical composition in the preparation of a medicament for the prevention and / or treatment of hepatocellular carcinoma and / or diseases and / or symptoms associated with hepatocellular carcinoma, said pharmaceutical composition comprising a therapeutically effective amount of the above-mentioned inhibitor.
[0039] In one embodiment, the pharmaceutical composition further includes a pharmaceutically or immunologically acceptable carrier or excipient.
[0040] In another aspect, the present invention provides the use of a pharmaceutical preparation in the preparation of a medicament for the prevention and / or treatment of hepatocellular carcinoma and / or diseases and / or symptoms associated with hepatocellular carcinoma, said pharmaceutical preparation comprising the above-described pharmaceutical composition.
[0041] In another aspect, the present invention provides a kit for detecting hepatocytes, the kit comprising a DBR1 antibody.
[0042] (III) Beneficial Effects
[0043] This invention provides the application of DBR1 expression level as a diagnostic and / or prognostic biomarker for hepatocellular carcinoma. Compared with existing technologies, it has the following advantages:
[0044] 1. Compared to traditional biomarkers that focus more on screening or early diagnosis, DBR1 has greater potential value in reflecting tumor invasiveness and predicting patient prognosis. Experimental results show that high DBR1 expression is often associated with poorer survival and a higher risk of recurrence in liver cancer patients, while patients with low expression show relatively better prognoses. This difference allows DBR1 to provide clinicians with more accurate risk stratification, helping to develop personalized treatment plans and follow-up programs.
[0045] 2. While traditional biomarkers such as AFP and DCP can reflect certain aspects of tumor biology, they are still not ideal in predicting long-term survival, recurrence, and metastasis in liver cancer patients. Incorporating DBR1 testing into the prognostic assessment system can complement existing indicators: for patients who test negative for traditional biomarkers but are still at high risk, high DBR1 expression suggests potential malignant progression, thereby strengthening the monitoring and treatment intervention for these patients.
[0046] 3. Besides its prognostic value, DBR1's crucial role in tumor cell proliferation, migration, and invasion also makes it a potential therapeutic target. High expression of DBR1 may promote the malignant biological behavior of liver cancer cells. Intervention targeting DBR1 or combined regulation of its downstream signaling pathways may offer new solutions to the challenges of drug resistance and recurrence. When used in combination with existing targeted drugs or immunotherapies, DBR1-targeted intervention is expected to further improve efficacy or delay tumor progression.
[0047] (iv) Terms and Definitions
[0048] As used in this article, the terms “DBR1” and “RNA lasso debranching enzyme 1” are used interchangeably and refer to debranching enzyme homolog 1.
[0049] The DBR1 disclosed in this invention can be a naturally purified product, a chemically synthesized product, or produced from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, higher animals, insects, and mammalian cells) using recombinant technology. Preferably, the DBR1 disclosed in this invention is encoded by the human DBR1 gene or its homologous genes or family genes.
[0050] Depending on the host used in the recombinant production protocol, the DBR1 disclosed in this invention may be glycosylated or non-glycosylated. The term also includes active fragments and active derivatives of DBR1.
[0051] As used herein, the terms "inhibitor" or "inhibitor of DBR1 or its encoding nucleic acid molecule" are used interchangeably and refer to substances that can reduce the level or activity of DBR1 or its encoding nucleic acid molecule. Inhibitors that can be used in this disclosure include, but are not limited to, antibodies against DBR1 or nucleic acid molecules encoding the protein, siRNA, miRNA, gRNA, sgRNA, and antisense oligonucleotides.
[0052] As used herein, "patient" or "subject" may refer to a vertebrate. In one embodiment, the term "subject" includes humans and animals, particularly mammals and other organisms.
[0053] As used in this article, the term "diagnosis" involves identifying and (early) detecting a clinical condition. Furthermore, assessing severity can be encompassed within the term "diagnosis."
[0054] As used herein, the term "prognosis" refers to the prediction of a subject's outcome or specific risk. This may also include an estimate of the subject's chance of recovery or the chance of an adverse outcome.
[0055] As used herein, the terms “marker,” “surrogate,” “prognostic marker,” “factor,” or “biomarker” are used interchangeably and refer to measurable and quantifiable biological markers (e.g., specific protein or enzyme concentrations or fragments thereof, specific hormone concentrations or fragments thereof, or the presence of biological substances or fragments thereof) used as indicators of health and physiological assessments, such as the risk of disease / disorder / clinical condition, preferably adverse events. A marker or biomarker is defined as a characteristic that can be objectively measured and assessed as an indicator of normal biological processes, pathogenesis, or pharmacological response to therapeutic interventions.
[0056] As used herein, the term "biological sample" refers to a biological sample obtained or isolated from a patient or subject. As used herein, "sample" can refer, for example, to a fluid or tissue sample obtained for analysis, diagnosis, prognosis, or evaluation of a subject (e.g., a patient) of interest. Preferably, samples are blood, serum, plasma, blood components, synovial fluid, urine, semen, saliva, feces, cerebrospinal fluid, gastric contents, vaginal secretions, mucus, tissue biopsy samples, tissue homogenates, bone marrow aspiration fluid, bone homogenates, sputum, aspirates, wound exudate, swabs, or swab washing solutions, etc.
[0057] As used herein, the term "antisense oligonucleotide" refers to an unmodified or modified nucleic acid having a nucleotide sequence complementary to the DBR1 gene polynucleotide sequence, including polynucleotide sequences associated with the transcription or translation of the DBR1 gene (e.g., promoters of the DBR1 gene polynucleotide), wherein the antisense polynucleotide is capable of hybridizing with the DBR1 gene polynucleotide sequence. Of particular interest are antisense polynucleotides capable of inhibiting the transcription and / or translation of polynucleotides encoding the DBR1 gene in vitro or in vivo.
[0058] As used herein, the terms “siRNA oligonucleotide,” “RNAi oligonucleotide,” “short interfering RNA,” or “siRNA” are used interchangeably and refer to oligonucleotides that function via posttranscriptional gene silencing (also known as RNA interference (RNAi)).
[0059] As used herein, the terms “guide RNA,” “mature crRNA,” “guide sequence,” and “gRNA” are used interchangeably and have the meanings commonly understood by those skilled in the art. Generally, guide RNA may comprise a direct repeat (DR) sequence and a guide sequence, or consist essentially of or comprise of a direct repeat sequence and a guide sequence (also referred to as a spacer sequence in the context of an endogenous CRISPR system).
[0060] As used herein, the term “therapeutic effective dose” refers to a dose sufficient to treat a disease with a reasonable benefit / risk ratio suitable for medical treatment, and the effective dose level includes subject type and severity, age, sex, drug activity, drug sensitivity, time of administration, route of administration and excretion rate, duration of treatment, factors including concomitant drugs, and other factors known in the medical field.
[0061] As used herein, the term "pharmaceuticalally acceptable" refers to a substance that is suitable for use in humans and / or animals without excessive adverse effects (such as toxicity, irritation, and allergic reactions), i.e., a reasonable benefit / risk ratio.
[0062] As used herein, the term “treatment” for a symptom or patient refers to steps taken to achieve a beneficial or desired outcome, including clinical outcomes. Beneficial or desired clinical outcomes include, but are not limited to, eliminating, substantially inhibiting, slowing, or reversing the progression of a disease, symptom, or condition; substantially improving or alleviating the clinical or aesthetic symptoms of a symptom; substantially preventing the clinical or aesthetic symptoms of a disease, symptom, or condition; and avoiding harmful or unpleasant symptoms. Treatment also refers to achieving one or more of the following: (a) reducing the severity of the symptom; (b) limiting the development of characteristic symptoms of the symptom being treated; (c) limiting the exacerbation of characteristic symptoms of the symptom being treated; (d) limiting the recurrence of the symptom in patients who previously had the symptom; and / or (e) limiting the recurrence of symptoms in patients who previously did not have symptoms of the symptom.
[0063] As used in this article, the term "prevention" refers to reducing the likelihood of the onset (or relapse) of a disease, disorder, condition, or associated symptom (such as acute myeloid leukemia). Attached Figure Description
[0064] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0065] Figure 1 (A) shows the difference in DBR1 gene expression between normal tissues and hepatocellular carcinoma tissues, and the results show that DBR1 expression is significantly reduced in hepatocellular carcinoma tissues. Figure 1 (B) Further comparison of DBR1 expression in different stages of liver cancer (stages 1 and 2 vs. stages 3 and 4) revealed that DBR1 expression in advanced liver cancer (stages 3 and 4) was significantly lower than that in early liver cancer (stages 1 and 2). Figure 1 (C) shows the survival curves. Patients were grouped according to their DBR1 expression levels (high expression vs. low expression). The results showed that the survival rate of patients in the high expression group was significantly higher than that in the low expression group, suggesting that high DBR1 expression may be associated with better survival prognosis. Figure 1 (D) shows immunohistochemical staining samples (tumor: ID3477, ID3196; normal tissue: ID3222, ID2429) from the Human Protein Atlas Database (HPA), illustrating DBR1 expression in patient liver tissue. The results indicate that DBR1 expression is high in normal tissue but significantly reduced in hepatocellular carcinoma tissue. Figure 1 (E) and Figure 1(F) The differences in DBR1 expression were further validated using the GSE60502 and GSE64041 datasets. In the GSE60502 dataset, DBR1 expression in hepatocellular carcinoma tissues was significantly lower than that in normal tissues (p<0.01), while in the GSE64041 dataset, similar results showed a significant decrease in DBR1 expression in hepatocellular carcinoma tissues (p<0.05). Figure 1 (G) shows HE staining images and spatial analysis results of hepatocellular carcinoma (HCC) tissues from the HCC DB database. HE staining clearly distinguishes the tumor region from other areas. Spatial analysis labels the tumor region (red), stroma region (green), normal tissue (blue), and immune cell region (orange). Furthermore, the DBR1 expression heatmap shows that DBR1 expression is significantly lower in the tumor region than in other regions, further supporting the correlation between DBR1 expression and the development and progression of HCC.
[0066] Figure 2 (A) is a schematic diagram of intraoperative samples from five patients with primary hepatocellular carcinoma collected from the Department of Liver Surgery at the First Affiliated Hospital of the University of Science and Technology of China. All patients were first-time patients and had not received any anti-cancer treatment. Liver cancer tissue and corresponding adjacent normal liver tissue were collected from each patient to ensure the authenticity and initial stage of the samples. Figure 2 (B): The relative mRNA expression level of DBR1 in hepatocellular carcinoma (HCC) tissues and adjacent normal tissues was detected by quantitative PCR. Results showed that the mRNA expression level of DBR1 in HCC tissues was significantly higher than that in adjacent normal tissues (*p<0.05). Data are expressed as mean ± standard error (SEM), with each point representing one patient. Figure 2 (C): Paired analysis showed that the mRNA expression level of DBR1 in liver cancer tissues of all patients was higher than that in the corresponding adjacent normal tissues. The connecting lines represent two tissue samples from the same patient. Figure 2 (D): The expression level of DBR1 protein in hepatocellular carcinoma (HCC) tissues and adjacent normal tissues was detected by Western blot. ACTIN was used as an internal control. The results showed that the protein expression of DBR1 in HCC tissues was significantly higher than that in adjacent normal tissues, further supporting its high expression in HCC.
[0067] Figure 3 (A): The relative expression levels of DBR1 protein in different hepatocellular carcinoma cell lines (HepG2, Hep3B, LM3, MHCC97H, and Huh7) were detected using RT-qPCR and Western Blot. The results showed that the expression of DBR1 varied greatly among different cell lines, with the highest expression in the Huh7 cell line. Figure 3(B): Effects of DBR1 knockout (DBR1KO) and human DBR1 knockout followed by re-expression (DBR1KO+hDBR1OE) on DBR1 transcriptional levels and protein expression in Huh7 cells. DBR1KO significantly reduced DBR1 expression levels, while DBR1KO+hDBR1OE restored DBR1 expression. Data are expressed as mean ± standard error (SEM), ns indicates no statistical difference, and **** indicates p < 0.0001. Figure 3 (C): Scratch assay to evaluate the effect of DBR1 on the migration ability of Huh7 cells. DBR1KO significantly inhibited cell migration, while DBR1KO+hDBR1OE significantly restored cell migration. The bar chart on the right shows the quantitative analysis of migration distance. ns indicates no statistical difference, and * indicates p<0.05. Figure 3 (D): Cell proliferation assay (MTT method) was used to detect the effect of DBR1 on the proliferation of Huh7 cells. DBR1KO significantly reduced cell proliferation, while DBR1KO+hDBR1OE restored cell proliferation. **** indicates p<0.0001. Figure 3 (E): Transwell assays were used to evaluate the effect of DBR1 on the invasive ability of Huh7 cells. DBR1KO significantly inhibited cell invasion, while DBR1KO+hDBR1OE restored cell invasion. The bar chart on the right shows the quantitative analysis of the number of invasive cells, **** indicates p<0.0001. Detailed Implementation
[0068] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0069] As used in this article, “containing,” “having,” or “including” includes “containing,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”
[0070] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the reagents, methods and equipment used are conventional reagents, methods and equipment in this technical field.
[0071] Example 1
[0072] Bioinformatics analysis of DBR1 gene expression:
[0073] 1. Data Acquisition and Preprocessing
[0074] RNA-seq data and clinical information of hepatocellular carcinoma patients, including patient survival time and tumor stage, were downloaded from the TCGA database. The GSE60502 and GSE64041 datasets, containing gene expression data from normal liver tissue and hepatocellular carcinoma tissue, were also downloaded from the GEO database. The downloaded data were cleaned and standardized using R (e.g., log2 transformation), and DBR1 gene expression data were selected for subsequent analysis. Low-quality samples and missing values were excluded.
[0075] 2. Differential gene expression analysis
[0076] In the TCGA dataset, the expression levels of the DBR1 gene in normal liver tissue and hepatocellular carcinoma tissue were extracted. The Wilcoxon rank-sum test was used to analyze the expression differences between the two groups, and box plots were used to visually represent the differences. Figure 1 A) The results showed that DBR1 expression was significantly reduced in hepatocellular carcinoma (HCC) tissues. Based on tumor staging information, HCC patients were divided into early-stage (stages I and II) and late-stage (stages III and IV) groups. The Kruskal-Wallis test was used to analyze the differences in DBR1 expression levels among samples from different stages, and the results are presented as box plots. Figure 1 B).
[0077] 3. Survival Analysis
[0078] Based on the median DBR1 expression value of samples from the TCGA database, patients were divided into a high-expression group and a low-expression group. Survival rates were calculated using the `survival` package in R, and Kaplan-Meier survival curves were plotted. Overall survival (OS) was compared between the two groups, and the statistical significance of the survival difference was assessed using the log-rank test. Figure 1 C).
[0079] 4. Immunohistochemical data analysis
[0080] Immunohistochemical staining samples obtained from the Human Protein Atlas (HPA) database included normal liver tissue samples (ID3222, ID2429) and hepatocellular carcinoma (HCC) tissue samples (ID3477, ID3196). The expression levels of DBR1 protein in normal and HCC tissues were compared by observing the immunohistochemical images, and the results were analyzed in conjunction with quantitative results provided by the database. Figure 1 D).
[0081] 5. GEO Data Validation
[0082] In the GEO dataset, the expression levels of DBR1 were extracted from the GSE60502 and GSE64041 datasets to validate the expression differences between normal and liver cancer tissues. A t-test was used to analyze the significance of the expression levels, and bar charts were plotted to present the results. Figure 1 E, Figure 1 F).
[0083] 6. Spatial Transcriptome Data Analysis
[0084] HE-stained images of hepatocellular carcinoma (HCC) tissues and corresponding spatial transcriptome data were obtained from the HCCDB database. The data included annotations of tumor regions, stromal regions, normal tissue, and immune cell-rich regions. By analyzing the DBR1 gene expression levels in different regions, a spatial expression heatmap was created to demonstrate the distribution pattern of DBR1 in the HCC tissue microenvironment, with a focus on comparing the expression levels in tumor regions with those in other regions. Figure 1 G).
[0085] 7. Statistical Analysis
[0086] All data analyses were performed using R (version 4.1.3). Differences in expression between two groups were assessed using the Wilcox-On rank-sum test, differences among multiple groups were assessed using the Kruskal-Wallis test, and survival analysis was performed using Kaplan-Meier curves and the log-rank test. All statistical tests were considered significant at a p-level of <0.05.
[0087] Example 2
[0088] Tissue expression analysis of DBR1 protein
[0089] 1. Sample collection and processing
[0090] Intraoperative samples were collected from five patients with primary hepatocellular carcinoma (HCC). These patients were all first-time patients and had not received any anticancer treatment. From each patient, liver cancer tissue and adjacent normal liver tissue samples were collected. The samples were immediately flash-frozen in liquid nitrogen and then transferred to a -80°C freezer for subsequent experimental use. Figure 2 A).
[0091] 2. RNA extraction
[0092] Total RNA was extracted from liver cancer tissue and adjacent normal tissue. For each tissue sample, 0.1 g of tissue was placed in a 1.5 mL EP tube, along with 3-4 grinding beads and 500 μL of Trizol. The tissue was homogenized by shaking at 60 Hz for 60 seconds using a tissue homogenizer. Then, 200 μL of chloroform was added to every 1 mL of Trizol, and the mixture was vigorously shaken for 15 seconds and allowed to stand at room temperature for 5 minutes. After centrifugation at 12000 g for 15 minutes at 4 °C, approximately 200 μL of the supernatant was transferred to a new RNase-free EP tube. An equal volume of isopropanol was added and the mixture was thoroughly mixed. The tube was then incubated at 4 °C for 10 minutes to precipitate RNA. After another centrifugation at 12000 g for 15 minutes at 4 °C, the supernatant was discarded. The RNA precipitate was washed with 1 mL of 75% ethanol and centrifuged at 7500 g for 3 minutes at 4 °C. Finally, the supernatant was discarded, the centrifuge tube was opened, and the RNA precipitate was allowed to dry at room temperature for approximately 15 minutes until it became transparent. Then, an appropriate amount of DEPC water was added to dissolve the RNA sample. RNA concentration and purity were measured using a NanoDrop 2000 spectrophotometer. Samples with OD260 / OD280 values between 1.8 and 2.0 were used for subsequent experiments. RNA samples were stored at -80°C for short periods.
[0093] 3. Reverse transcription
[0094] Extracted RNA was reverse transcribed using the Nanjing Novizan HiScript III RT SuperMix for qPCR+gDNA wiper kit (R323-01) to remove genomic DNA and synthesize cDNA. First, 1 μL of gDNA Eraser Mix, 500 ng RNA, and RNase-free H2O were added to a 4 μL reaction volume. The reaction was carried out at 42°C for 2 minutes, then at 37°C for 5 minutes, and stored at 4°C. Next, 4 μL of genomic DNA removal reaction solution and 1 μL of 5×RT Enzyme Mix were added to a 5 μL system. The reaction program was 37°C for 15 minutes, then at 85°C for 5 seconds, and stored at 4°C. The reverse transcription product was diluted 10-fold with ddH2O and stored at 4°C for short-term storage and -20°C for long-term storage.
[0095] 4. RT-qPCR detection
[0096] RT-qPCR was performed using Nanjing Novizan SYBR qPCR Master Mix (Q311-03) to analyze the mRNA expression level of the DBR1 gene. The reaction volume was 5 μL, including 2.5 μL of SYBR Master Mix, 0.125 μL each of forward and reverse primers, and 2.25 μL of diluted cDNA. The reaction was performed on a BIO-RAD CFX384 real-time PCR instrument. Each sample was tested in triplicate, with ACTB gene used as an internal control. Relative expression levels were calculated using the ΔΔCt method. Results showed that the mRNA expression level of DBR1 in hepatocellular carcinoma tissue was significantly higher than that in adjacent normal tissue (*p<0.05). Figure 2 B). Paired analysis results showed that the mRNA expression level of DBR1 in the liver cancer tissues of all patients was higher than that in the corresponding adjacent normal tissues (B). Figure 2 C).
[0097] RT-qPCR primers:
[0098]
[0099]
[0100] 5. Protein extraction and Western blot detection
[0101] Total protein was extracted from liver cancer tissue and adjacent normal tissue. For every 100 mg of tissue, 1 mL of pre-chilled RIPA lysis buffer (1:100 with PMSF) and 3-4 steel balls were added, and the mixture was thoroughly homogenized using a tissue homogenizer. The sample was placed on ice for 15 minutes, then centrifuged at 12000 rpm for 10 minutes at 4°C. The supernatant was collected as the total protein sample. The protein sample was mixed with 3× loading buffer, boiled at 100°C for 10 minutes, cooled, and stored at -20°C.
[0102] Place the prepared 10% gel plate into the electrophoresis apparatus and add 1x running buffer. After checking for leaks, load the samples sequentially according to the preset loading order. Turn on the power: 80V for 30 minutes for the stacking gel and 120V for 1 hour for the separating gel. Adjust the voltage and running time according to the size of the target protein. Soak the cut PVDF membrane in methanol for about 30 seconds until it becomes translucent. Open the transfer clamp, immersing the black side in the transfer container. Place a piece of filter paper soaked in the transfer container on each side. Pry open the gel plate, cut off the stacking gel, and remove the separating gel from the long gel plate. Place the gel in the transfer clamp in the following order from bottom to top: black gauze—filter paper—gel—PVDF membrane (approximately 9×5.6cm)—filter paper (approximately 10×8.5cm)—black gauze. Gently fix the gel with your fingers, cover the gel with the activated PVDF membrane, remove any air bubbles between the membrane and the gel, and close the transfer clamp. Place the assembled transfer clamps in the electrophoresis tank, with red and black membranes placed in the tank corresponding to each other. An ice pack should be placed in the tank, and the tank should be filled with transfer buffer. Set the voltage to 90V and the current to approximately 300mA for 1.5 hours. After transfer, remove the PVDF membrane and transfer it to 5% skim milk for one hour of room temperature shaking. After blocking, wash the PVDF membrane three times with PBST, shaking for 5 minutes each time at room temperature. Then place the PVDF membrane in a clean incubation box and incubate overnight with primary antibody at 4°C. Recover the primary antibody and wash the membrane three times with TBST, shaking for 10 minutes each time at room temperature. Add a 1:5000 solution of secondary antibody and incubate for 30 minutes at room temperature. After secondary antibody blocking, wash the membrane three times with PBST, 10 minutes each time. Then react the PVDF membrane with the developing substrate and expose it directly for development using a Biorad developer. The results showed that the protein expression of DBR1 in liver cancer tissue was significantly higher than that in adjacent normal tissue. Figure 2 D).
[0103] Western Blot antibody:
[0104] Antibody source Identification code DBR1 Polyclonal Antibody Proteintech Cat#:16019-1-AP Beta Actin Monoclonal Antibody Proteintech Cat#:66009-1-Ig
[0105] 6. Data Analysis
[0106] The relative expression level of DBR1 was calculated using the ΔΔCt method for RT-qPCR data, and the band gray values were analyzed using ImageJ software for Western blotting results. All data are expressed as mean ± standard error (SEM). Paired t-tests were used to analyze differences between groups, and p < 0.05 was considered statistically significant.
[0107] Example 3
[0108] The effect of DBR1 on the proliferative capacity of hepatocellular carcinoma cells:
[0109] 1. Detection of DBR1 expression in liver cancer cell lines
[0110] 1) Cell culture: Hep3B, HepG2, LM3, MHCC97H and Huh7 liver cancer cell lines were seeded in 6-well plates. Hep3B and HepG2 were cultured in MEM medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin) (Gibco, Cat#: C12571500BT), while LM3, MHCC97H and Huh7 were cultured in high-glucose DMEM medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin) (Gibco, Cat#: 12491015). The cells were cultured at 37°C in a 5% CO2 incubator until they reached 70%-80% confluence.
[0111] 2) RNA extraction and RT-qPCR detection: After washing cells with PBS, 1 mL of Trizol lysis buffer was added to each well to extract total RNA. Following the kit instructions, the extracted RNA was used to synthesize cDNA using a reverse transcription kit. Subsequently, RT-qPCR was performed using SYBR Green qPCR reagent to analyze the relative expression level of DBR1 mRNA, with GAPDH used as an internal control gene.
[0112] 3) Protein Extraction and Detection: After washing cells with PBS, 200 μL of pre-chilled RIPA lysis buffer (containing 1:100 diluted PMSF protease inhibitor) was added to each well of Hep3B, HepG2, LM3, MHCC97H, and Huh7 cells. Cells were scraped off with a cell scraper and transferred to 1.5 mL EP tubes. After lysis on ice for 15 minutes, the cells were centrifuged at 4°C and 12000 rpm for 10 minutes, and the supernatant was collected as the total protein sample. The expression level of DBR1 protein was detected by Western blotting, with ACTIN as an internal control.
[0113] 4) Data Analysis: The relative expression level of DBR1 was calculated using the ΔΔCt method for RT-qPCR data, and the band gray values were analyzed using ImageJ software for Western blotting results. Experiments were repeated three times, and data are expressed as mean ± standard error (SEM). Differences between groups were analyzed using t-tests, with p < 0.05 considered statistically significant.
[0114] 5) Results: The results showed that the expression of DBR1 varied greatly among different cell lines, with the highest expression in the Huh7 cell line. Figure 3 A).
[0115] 2. Constructing gene knockout cell lines using CRISPR-Cas9 technology
[0116] 1) Primer Design and Annealing: sgRNA sequences (NNNNNNNNNNNNNNNNNNNN+NGG) were screened from the exons preceding the target gene (DBR1) (100 bp after ATG to one-third of the exon). Primer sequences sg-hDBR1-F1 (SEQ ID No. 3: CACCGTGCATGTGACGATACTTGGG) and sg-hDBR1-R1 (SEQ ID No. 4: AAACCCCAAGTATCGTCACATGCAC) were designed. Subsequently, the primer annealing reaction system was prepared in a PCR instrument, including NEB buffer 2 (2 μL), Oligo A (100 μM, 2 μL), Oligo S (100 μM, 2 μL), and ddH2O (14 μL). The annealing program was 95℃ for 5 minutes followed by natural cooling to room temperature.
[0117] 2) Vector linearization and ligation: Using Pl301 plasmid (800 ng) and Bsmb1 restriction enzyme (1 μL), a digestion reaction system was prepared (buffer 2 μL, ddH2O to a final volume of 20 μL), and digestion was carried out at 37℃ for 1 hour. The digestion product was loaded onto a 1% agarose gel, and electrophoresis was performed at 100V for 1 hour. The electrophoresis results showed two bands (11 kb and 2 kb). The 11 kb band was excised and recovered from the gel. The recovered linearized vector was ligated with the renatured sgRNA product. The reaction system included 5× buffer (2 μL), T4 ligase (0.2 μL), digestion product (200 ng), renature product (5 μL), and ddH2O to a final volume of 10 μL. Ligation was carried out overnight at room temperature.
[0118] 3) Transformation and plating of competent cells: Thaw DH5α competent cells in an ice bath after removing them from the -80℃ freezer. Take 15 μL of competent cells and add 5 μL of ligation product, mix gently, and incubate on ice for 30 minutes. Heat shock in a 42℃ water bath for 45 seconds, then immediately incubate on ice for 2-3 minutes. Add 500 μL of antibiotic-free LB liquid medium and incubate at 37℃ on a shaker for 1 hour. Spread the bacterial culture onto LB solid plates containing Amp resistance using a spreader. After the bacterial culture dries, invert the plates and incubate overnight at 37℃.
[0119] 4) Single clone selection and bacterial culture identification: The next day, pick 3-5 single clones from the culture plate into 15mL centrifuge tubes, add 9mL of LB liquid medium containing Amp resistance, and incubate overnight at 37℃ in a shaker. For bacterial culture preservation, take 500μL of bacterial culture, add 500μL of 50% glycerol, mix well, and store at -80℃. Extract the plasmid and perform concentration detection, and verify plasmid quality by electrophoresis. The electrophoresis system is as follows: plasmid (2μL) mixed with 10× loading buffer (0.2μL) and loaded onto a 1% agarose gel. Electrophoresis conditions are 100V for 1 hour. The electrophoretic band of the positive plasmid is 2kb smaller than that of the control plasmid. Send the positive clones for sequencing. The total plasmid amount must be greater than 2μg. The sequencing primers are h-DBR1#3: SEQ ID No. 5: CAAGGCTGTTAGAGAGATAA.
[0120] 5) Construction of gene knockout cell lines: The constructed plasmid was transfected into 293T cells for lentiviral packaging. The transfection reaction system consisted of PL1 (3 μg), PL2 (6 μg), the constructed plasmid (10 μg), and PEI (38 μL). After infecting the target cells with the viral solution, 2 μg / mL puromycin was added for resistance selection. The selected cells were diluted into culture dishes, ensuring that the dilution ratio was sufficient to form a monoclonal cell population. Once monoclonal cells were visible to the naked eye, they were picked with a 1 mL pipette tip and cultured in 24-well plates. After the cells reached confluence, they were transferred to 6-well plates for further culture. After culture, a portion of the cells were used for qPCR and Western blotting to verify the DBR1 gene knockout effect. Positive clones were then expanded and preserved.
[0121] 6) Results: DBR1 knockout cell lines and knockout-re-expressing cell lines were successfully constructed. DBR1KO significantly reduced the expression level of DBR1. Figure 3 B).
[0122] SgRNA primers:
[0123]
[0124] 3. Experimental Procedure for Re-expressing DBR1 in Knockout Cells (Completion)
[0125] 1) Vector Construction and Sequencing Validation: The complete DBR1 insert fragment was obtained by PCR amplification. Using samples containing the DBR1 cDNA template, the full-length hDBR1 sequence was amplified using specific amplification primers (such as plvx-hDBR1-F and plvx-hDBR1-R). Subsequently, pLVX-CMV-MCS-2a-puroR was linearized by PCR, and the corresponding band (approximately 11 kb) was recovered by electrophoresis. The recovered linearized vector and the PCR-amplified DBR1 fragment were added to the T4 ligase reaction system at a molar ratio of 1:3 and ligated overnight at 16°C or for 2 hours at room temperature. The ligation product was transformed into DH5α competent cells, heat-shocked at 42°C for 45 seconds, and then recovered. The cells were plated on LB plates containing Amp resistance and incubated overnight at 37°C. Single clones were selected for plasmid extraction, and PCR or sequencing was performed using pIvx-F / pIvx-R and plvx-hDBR1-F / plvx-hDBR1-R primers to verify that the DBR1 fragment was correctly inserted.
[0126] 2) Lentiviral Packaging and Collection: Lentiviral packaging uses 293T cells in logarithmic growth phase, seeded in 6cm culture dishes, ensuring a cell density of 40–50% on the day of transfection. The recombinant pLVX-DBR1 vector is mixed with the envelope plasmid (e.g., pMD2.G) and packaging plasmid (e.g., psPAX2) in the recommended ratio (e.g., pLVX:psPAX 2:pMD2.G = 2:2:1), and transfection reagent (PEI or Lipofectamine 2000) is added. After thorough mixing, the mixture is added dropwise to the 293T cells. The culture medium is replaced with fresh medium 4–6 hours after transfection. The supernatant is collected within 48–72 hours post-transfection, and cell debris is removed by centrifugation at 12,000 rpm. If necessary, sucrose pad ultracentrifugation or the PE G method can be used to concentrate the virus to improve infection efficiency.
[0127] 3) Establishment and Validation of the DBR1 Rescue Cell Line: Seed DBR1KO cells onto plates. When the cell density reaches 30-50%, infect the cells with pLVX-DBR1 virus solution (with 8 μg / mL polybrene). Replace with fresh medium 24 hours after infection. If the vector carries drug resistance (e.g., puromycin), add the drug for selection after 48-72 hours; the recommended concentration is 1-2 μg / mL. After 3-5 days of selection, single clones can be picked or mixed positive cell populations can be used directly for experiments, depending on experimental needs. For single clone picking, dilute the selected cells into culture dishes, ensuring sufficient spacing between cells to form single clones. Once single clones are visible, pick them into 24-well plates for culture, then transfer to 6-well plates for amplification. Verify DBR1 expression levels using Western blotting or qPCR to confirm the successful establishment of the rescue cell line.
[0128] 4) Results: Western blotting was used to detect the expression level of DBR1 protein in the DBR1 replenished cell line (DBR1KO+hDBR1OE), confirming that DBR1 was successfully restored or upregulated. Figure 3 B).
[0129] Plvx primers:
[0130]
[0131] 4. Scratch healing test procedure:
[0132] Huh7 cells were seeded into 12-well plates at a density of 80,000–100,000 cells / well and cultured until confluence formed a monolayer. Before seeding, horizontal lines were marked on the back of each well using a marker pen (for easy identification of the same field of view during photography). After the cells had covered the bottom of the plate, straight lines were drawn vertically using a 200 μL pipette tip to create "scratch marks," ensuring a consistent scratch width and avoiding tilting or using damaged pipette tips. After scratching, the wells were slowly washed three times with PBS to remove cell debris. Serum-free medium was then added to inhibit cell proliferation and interference with the experiment. The cells were then cultured at 37°C and 5% CO2. Images of the initial scratch marks were taken at 0 hours, and scratch healing was recorded every 6 hours thereafter. After the experiment, changes in scratch width or migration area were measured using ImageJ software to assess cell migration ability. The experimental groups included the WT group, the DBR1KO group, and the DBR1KO+hDBR1OE group. By comparing scratch healing, the inhibitory effect of DBR1 knockout on the migration ability of Huh7 cells and the restorative effect of DBR1 re-expression on migration ability were observed. Serum-free culture medium was used during the experiment to avoid interference with cell proliferation. Gentle washing was performed to prevent adherent cells from detaching, and uniform scratch width was ensured to guarantee the reliability of the experimental data. Results are as follows: Figure 3 As shown in (C).
[0133] 5. MTT cell proliferation assay
[0134] First, prepare a 5 mg / mL MTT stock solution (dissolved in sterile PBS) (Beyotime, Cat#: C0009M), and dilute it 1:10 in the culture medium before use to a final concentration of 0.5 mg / mL. Seed the target cells into 96-well plates, with 500-10,000 cells per well, for a total volume of 100 μL, and incubate overnight at 37°C and 5% CO2. If necessary, the test compound can be added at this step to assess its effect on cell proliferation. Subsequently, add 10-15 μL of the diluted MTT solution to each well to maintain a final concentration of 0.5 mg / mL, and incubate the plate in an incubator under the same conditions for 1-4 hours. After incubation, add 100 μL of DMSO or other dissolving solution to each well to dissolve the formed formazan crystals, while gently shaking the plate to ensure complete dissolution. The absorbance was measured at 570 nm using a microplate reader (630 nm can be selected as the reference wavelength). The cell viability percentage was analyzed by calculating [(OD value of treated group - OD value of blank control) / (OD value of untreated control group - OD value of blank control) × 100%], and cell survival curves or dose-response curves were plotted. During the experiment, it is essential to ensure a consistent initial cell count in each well, avoid prolonged contact time between MTT reagent and cells (not exceeding 4 hours), and protect photosensitive compounds from light to ensure the accuracy of the experimental results. Results are as follows: Figure 3 As shown in (D).
[0135] 6. Transwell invasion test procedure
[0136] In the Transwell invasion assay, Huh7 cells were first serum-free starved for 12–24 hours to reduce background migration interference. Subsequently, the cells were digested, washed once with PBS, and resuspended in serum-free medium containing 0.1% BSA, adjusting the cell density to 1 × 10⁶ cells / year. 5 / mL. Transwell chambers (8μm pore size) coated with Matrigel (Beyotime, Cat#: FTW067) were used in the experiment. 40μL of diluted Matrigel was placed in the upper chamber of each Transwell and gelled at 37℃ for 2 hours, followed by hydration with serum-free medium for 30 minutes. 200μL of cell suspension (total cell volume 2×10⁶ cells / mL) was added to each Transwell upper chamber. 4Simultaneously, 500 μL of complete culture medium containing 10% FBS was added to the lower chamber of a 24-well plate as a chemisorption factor. The Transwell chamber was carefully inserted into the 24-well plate using tweezers, ensuring that air bubbles did not interfere with the experimental results. The apparatus was incubated at 37°C in a 5% CO2 incubator for 24 hours. Afterward, the culture medium in the upper chamber was carefully aspirated, and the cells were washed with PBS. Unpenetrated cells in the upper chamber were gently wiped away with a moistened cotton swab. The permeated cells in the lower chamber were fixed with 10% methanol solution for 30 seconds, stained with 0.1% crystal violet solution for 20 minutes, and then rinsed with tap water until the background was clear. The number of permeated cells was counted in 3-5 randomly selected fields of view under a microscope. To quantitatively analyze invasive ability, the stained cells were destained with 33% acetic acid solution, and the OD value was measured at a wavelength of 570 nm to indirectly reflect the cell number. The experimental groups included the WT group, the DBR1KO group, and the DBR1KO+hDBR1OE group. Results showed that DBR1KO significantly reduced the invasive ability of Huh7 cells, while DBR1KO+hDBR1OE significantly restored invasive ability. Experiments were repeated at least three times. Data are expressed as mean ± standard error (SEM), and differences between groups were determined through statistical analysis. Results are as follows: Figure 3 As shown in (E).
[0137] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.
[0138] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of DBR1 sgRNA in the preparation of drugs for the treatment of hepatocellular carcinoma, characterized in that, The primer sequences for the DBR1sgRNA are shown in SEQ ID No. 3 and SEQ ID No.
4.
2. The use of a pharmaceutical composition in the preparation of a medicament for treating hepatocellular carcinoma, characterized in that, The pharmaceutical composition comprises a therapeutically effective amount of the DBR1 sgRNA of claim 1.
3. The application according to claim 2, characterized in that, The pharmaceutical composition also includes a pharmaceutically or immunologically acceptable carrier or excipient.
4. The use of a pharmaceutical formulation in the preparation of a drug for treating hepatocellular carcinoma, characterized in that, The pharmaceutical preparation comprises the pharmaceutical composition of claim 2 or 3.
Citation Information
Patent Citations
RNAi [RNA (ribonucleic acid) interference] and application of RNAi to preparing medicines for treating hepatocellular carcinoma
CN106754928A
Method of predicting cancer prognosis and composition for same
CN113785076A