Humanized immunodeficient mouse model

Abstract

In some aspects, the disclosure provides humanized immunodeficient mouse models that support long term transplantation and function of human T cells, natural killer cells, and bone marrow cells without the need for conditioning.

Description

[0001] Related applications

[0002] This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Patent Application No. 63 / 404,597, filed on September 8, 2022, the entire contents of which are incorporated herein by reference in their entirety.

[0003] References to electronic sequence listings

[0004] The contents of the electronic sequence listing (J022770130WO00-SEQ-EMB.xml; size: 2,991 bytes; and creation date: September 5, 2023) are incorporated herein by reference in their entirety.

[0005] Government licensing rights

[0006] This invention was made with government support under Grant No. AI132963 awarded by the National Institutes of Health. The government has certain rights in this invention. Background of the Invention

[0008] Humanized mouse models are valuable preclinical tools that enable researchers to conduct more translationally relevant studies. These models are mice that contain functional human genes, cells, tissues, or microbiota. There are three general approaches to humanizing mice: transplanting a human immune system into an immunodeficient host, replacing mouse genes with human homologs, or transferring the fecal microbiota from a human donor into germ-free mice.

[0009] Human immune system transplantation typically involves the transplantation of human hematopoietic stem cells (HSCs) or human peripheral blood mononuclear cells (PBMCs). To facilitate the engraftment of human HSCs, immunodeficient mice are first conditioned (e.g., irradiated or subjected to some other form of myeloablative therapy) to weaken their immune systems. In addition, human HSCs are typically manipulated to enrich for human CD34 + HSC and CD3 depletion +T cells. These treatments prevent or at least reduce the likelihood of mice developing acute xenogeneic graft-versus-host disease (GvHD), a disease in which human immune cells attack host mouse tissues, primarily mediated by the presence of human leukocyte antigen (HLA)-restricted T cells. For mouse models designed to replicate human T cells and innate immunity, human PBMC transplants are often used; however, avoiding GvHD in these model systems is challenging. Conditioning treatments used to suppress the mouse immune system also kill mature HLA-restricted T cells, so these treatments cannot be used for PBMC transplants. Recipient mice transplanted with human PBMCs developed GvHD shortly after transplantation.

[0010] Therefore, there are many limitations to the development of the human immune system in humanized mice that allow for research into human stem cell therapies. These limitations include difficulty generating primary and recall human adaptive and innate cellular immune responses, including T cell priming and memory T cell production, as well as low human NK cell activity. These observations illustrate the urgent need for a more mature, fully functional human (adaptive and innate) immune system. Summary of the Invention

[0011] Immunodeficient mice transplanted with human immune cells are essential for evaluating the effectiveness and safety of human cell therapy products, which are, for example, engineered to avoid host immune rejection. Typically, a single mouse model is used to evaluate the specific immunobiology of a specific cell type. However, this point-of-care approach results in a larger overall direct mouse cost and a longer project timeline. In addition, the operation of human cell samples and the myeloablative conditioning of immunodeficient mice typically impair the survival, proliferation capacity and function of transplanted human immune cells. Therefore, new humanization methods and mouse models are needed. The present disclosure meets this demand and advances the field by providing new humanized mouse models and humanization methods in some aspects, which models and methods can be used, for example, to evaluate multiple complex aspects of human immune cell biology (e.g., human cell therapy products) in a single mouse strain. The methods provided herein are also intended to minimize the processing of human xenograft samples and the operation of immunodeficient mice.

[0012] Therefore, some aspects of the present disclosure provide humanized immunodeficient mouse models that support long-term implantation and function of human T cells, natural killer (NK) cells, and innate immune cells (e.g., myeloid cells such as basophils, dendritic cells, eosinophils, Langerhans cells, mast cells, monocytes, and macrophages and neutrophils) without the need for conditioning (e.g., myeloablative therapy). The humanized immunodeficient mouse models provided herein have robust human (adaptive and innate) immune systems, in part because they have little or no residual innate immunity, and they transgenically express human T cells, NK cells, and innate immune cells (e.g., myeloid cells) development and function required for human specific cytokines.

[0013] In some aspects, the present disclosure provides immunodeficient non-obese diabetic (NOD) mice comprising: an endogenous Il2rg allele comprising a disabling mutation (null mutation); an endogenous H2-K allele comprising a disabling mutation; an endogenous H2-D allele comprising a disabling mutation; an endogenous H2-A allele comprising a disabling mutation; an endogenous Kit allele comprising a disabling mutation; an exogenous nucleic acid encoding human interleukin 7 (huIL7); an exogenous nucleic acid encoding human interleukin 15 (huIL15); an exogenous nucleic acid encoding human interleukin 3 (huIL3); an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF); and an exogenous nucleic acid encoding human Steel factor (also known as human stem cell factor or human KIT ligand) (huSCF).

[0014] In some embodiments, the endogenous H2-K1 allele containing the disabling mutation is H2-K1 tm1Bpe In some embodiments, the endogenous H2-D allele containing the disabling mutation is H2-D1 tm1Bpe Allele. In some embodiments, the endogenous H2-A allele containing the disabling mutation is H2-Ab1 em1Mvw allele.

[0015] In some embodiments, the endogenous interleukin-2 receptor gamma (Il2rg) allele containing a disabling mutation is Il2rg tm1Wjl In some embodiments, the endogenous Il2rg allele containing the disabling mutation is Il2rg tm1Sug allele.

[0016] In some embodiments, the immunodeficient mouse further comprises an endogenous protein kinase, DNA activated catalytic subunit (Prkdc) allele comprising a disabling mutation. In some embodiments, the mutation is a severe combined immunodeficiency (scid) mutation. In some embodiments, the endogenous Prkdc allele comprising a disabling mutation is a Prkdc scid allele.

[0017] In some embodiments, the immunodeficient mouse further comprises an endogenous recombination activating gene 1 (Rag1) allele comprising a disabling mutation. In some embodiments, the endogenous Rag1 allele comprising a disabling mutation is Rag1 tm1Mom allele.

[0018] In some embodiments, the immunodeficient mouse further comprises an endogenous recombination activating gene 2 (Rag2) allele comprising a disabling mutation. In some embodiments, the endogenous Rag2 allele comprising a disabling mutation is Rag2 tm1Fwa allele.

[0019] In some embodiments, the immunodeficient mouse has a NOD scidγ background. In some embodiments, the immunodeficient mouse has a NSG-(K b D b ) null (IA null )Genetic background.

[0020] In some embodiments, the endogenous Kit allele containing the disabling mutation is Kit W-41J .

[0021] In some embodiments, the mouse further comprises (or has been transplanted with) human cells.

[0022] In some embodiments, the immunodeficient mouse further comprises (or has been transplanted with) unfractionated human umbilical cord blood comprising human cells.

[0023] In some embodiments, the human cells comprise human hematopoietic stem cells. In some embodiments, the human cells comprise human peripheral blood mononuclear cells.

[0024] In some embodiments, the human cells are not enriched for CD34 + Human hematopoietic stem cells. In some embodiments, CD3 + Human T cells were not depleted from human cells.

[0025] In some embodiments, the mouse has not undergone myeloablation, e.g., irradiation or chemomyeloablation. In other embodiments, the mouse has undergone myeloablation.

[0026] In other aspects, the present disclosure provides a method for producing a humanized mouse, the method comprising administering human cells to any one of the immunodeficient mice described herein.

[0027] In some embodiments, the method comprises administering unfractionated human umbilical cord blood comprising human cells. In some embodiments, the human cells comprise human hematopoietic stem cells. In some embodiments, the human cells comprise human hematopoietic peripheral blood mononuclear cells.

[0028] In still other aspects, the present disclosure provides a method for producing an immunodeficient mouse as claimed in any one of the preceding claims, comprising breeding: (i) a mouse comprising an endogenous Kit allele comprising a disabling mutation, an exogenous nucleic acid encoding human interleukin 3 (huIL3), an exogenous nucleic acid encoding human granulocyte-macrophage colony stimulating factor (huGM-CSF), and an exogenous nucleic acid encoding human Steel factor (huSCF); and (ii) a mouse comprising an endogenous H2-K allele comprising a disabling mutation, an endogenous H2-D allele comprising a disabling mutation, an endogenous H2-A allele comprising a disabling mutation, an exogenous nucleic acid encoding human interleukin 7 (huIL7), and an exogenous nucleic acid encoding human interleukin 15 (huIL15).

[0029] In some embodiments, the immunodeficient mouse is homozygous for an endogenous Kit allele containing a disabling mutation. In some embodiments, the immunodeficient mouse is homozygous for an endogenous H2-K allele containing a disabling mutation, is homozygous for an endogenous H2-D allele containing a disabling mutation, and / or is homozygous for an endogenous H2-A allele containing a disabling mutation.

[0030] Some aspects provide a method comprising administering human cells to the immunodeficient mouse described in any of the preceding paragraphs.

[0031] In some embodiments, the method further comprises administering unfractionated human umbilical cord blood comprising human cells.

[0032] In some embodiments, the human cells comprise human hematopoietic stem cells.

[0033] In some embodiments, the human cells comprise human peripheral blood mononuclear cells.

[0034] In some embodiments, the human cells are not enriched for CD34 + Human hematopoietic stem cells.

[0035] In some embodiments, CD3 + Human T cells were not depleted from human cells.

[0036] In some embodiments, the method does not involve myeloablating the immunodeficient mouse, optionally by irradiation or chemoablation.

[0037] Some aspects relate to an immunodeficient non-obese diabetic (NOD) mouse comprising: (a) an endogenous Il2rg allele comprising a disabling mutation, an endogenous Prkdc allele comprising a disabling mutation, and an endogenous Kit allele comprising a disabling mutation; and

[0038] (b) Transgenes encoding human interleukin 3 (huIL3), human granulocyte-macrophage colony-stimulating factor (huGM-CSF), and human Steel factor (huSCF).

[0039] In some embodiments, the immunodeficient mice are transplanted with human hematopoietic stem cells. In other embodiments, the immunodeficient mice are transplanted with human peripheral blood mononuclear cells.

[0040] In some embodiments, immunodeficient mice are transplanted with diseased human cells.

[0041] In some embodiments, the diseased human cells are obtained from a subject suffering from a genetic disorder.

[0042] In some embodiments, the genetic disorder is facioscapulohumeral muscular dystrophy (FSHD).

[0043] In some embodiments, the diseased human cell is a human muscle cell.

[0044] In some embodiments, the human muscle cells are CD56+ muscle stem cells.

[0045] Other aspects relate to methods comprising: administering human hematopoietic stem cells to a non-irradiated immunodeficient mouse of claim 1, wherein the human HSCs develop into innate immune cells; and administering the human diseased cells to the non-irradiated immunodeficient mouse.

[0046] In some embodiments, administering about 10 4 to about 10 6 Individual human HSCs.

[0047] In some embodiments, the human diseased cells are administered about 4 weeks to about 10 weeks after administration of the human HSCs.

[0048] In some embodiments, administering about 10 4 to about 10 6 Individual human diseased cells, optionally muscle cells, further optionally CD56+ muscle stem cells.

[0049] In some embodiments, the human diseased cells are obtained from a subject suffering from facioscapulohumeral muscular dystrophy (FSHD).

[0050] In some embodiments, the method further comprises administering the therapeutic agent to the immunodeficient mouse.

[0051] In some embodiments, the method further comprises measuring the response of innate immune cells to the human diseased cells.

[0052] In some embodiments, the response is an inflammatory response.

[0053] Some aspects relate to immunodeficient non-obese diabetic (NOD) mice comprising: (a) an endogenous Il2rg allele containing a disabling mutation, an endogenous Prkdc allele containing a disabling mutation, an endogenous H2-K allele containing a disabling mutation (H2-K null ); endogenous H2-D alleles containing disabling mutations (H2-D null ); endogenous H2-A alleles containing disabling mutations (H2-A null ); and (b) a transgene encoding human interleukin 15 (huIL15). In some embodiments, the methods herein comprise: administering human hematopoietic stem cells (HSCs) or human peripheral blood mononuclear cells (PBMCs) to immunodeficient mice, wherein the human HSCs develop into innate immune cells, optionally wherein the mice are non-irradiated; and administering human diseased cells to the immunodeficient mice. In some embodiments, administering about 10 4 to about 10 6 In some embodiments, the human diseased cells are administered about 4 weeks to about 10 weeks after the administration of the human HSCs or human PBMCs. In some embodiments, the human diseased cells are administered about 10 weeks after the administration of the human HSCs or human PBMCs. 4 to about 10 6 In some embodiments, the method further comprises administering the therapeutic method to an immunodeficient mouse. In some embodiments, the method further comprises measuring a response of innate immune cells to the human diseased cells. In some embodiments, the response is an inflammatory response.

[0054] Other aspects relate to immunodeficient non-obese diabetic (NOD) mice comprising: (a) an endogenous Il2rg allele containing a disabling mutation and an endogenous Prkdc allele containing a disabling mutation; and (b) a transgene encoding huIL15 and a transgene encoding human interleukin 7 (huIL7). In some embodiments, the methods herein comprise: administering human HSCs or human PBMCs to immunodeficient mice, wherein the human HSCs develop into innate immune cells, optionally wherein the mice are non-irradiated; and administering human diseased cells to the immunodeficient mice. In some embodiments, administering about 10 4 to about 10 6 In some embodiments, the human diseased cells are administered about 4 weeks to about 10 weeks after the administration of the human HSCs or human PBMCs. In some embodiments, the human diseased cells are administered about 10 weeks after the administration of the human HSCs or human PBMCs. 4 to about 10 6 In some embodiments, the method further comprises administering the therapeutic method to an immunodeficient mouse. In some embodiments, the method further comprises measuring a response of innate immune cells to the human diseased cells. In some embodiments, the response is an inflammatory response. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figures 1A-1E NSG-SMG3-W41 mice support human hematopoietic stem cell (HSC) engraftment and the selective expansion of innate immune cells, but not T cells. Figure 1A is a schematic diagram showing the experimental design comparing innate immune engraftment of NSG-SGM3 mice with or without 100 cGy irradiation and NSG-SGM3-W41 mice. Figure 1B Shown are flow cytometric analyses of human CD45+ cells in blood at the indicated time points after HSC injection. Figures 1C-1E Shown 4 weeks after HSC injection ( Figure 1C ), 8 weeks( Figure 1D ) or 12 weeks ( Figure 1E ) Flow cytometric analysis of the percentage of CD45+ cells co-expressing CD33+ myeloid cell markers, CD20+ B cell markers, and CD3+ T cell markers in blood.

[0057] Figures 2A-2G Co-xenotransplantation of human innate immune cells and skeletal muscle in NSG-SGM3-W41 mice. Figure 2ASchematic diagram showing the co-transplantation protocol of human donor HSCs with FSHD and control muscle stem cells (myoblasts) and processing of tibialis anterior (TA) xenografts for flow cytometry to identify cell lineages, RNA isolation for qPCR and NanoString, and sectioning for immunohistology. Figure 2B Table describing the myoblast cell lines used. DUX4 expression levels were previously described. Figure 2C Schematic diagram depicting the HSC and muscle experimental panels of six HSC donors and three FSHD family cohorts. Figures 2D-2G Shown are hCD45+ cells in spleens from the indicated transplantation conditions analyzed by flow cytometry ( Figure 2D ), hCD45 / CD20+B cells ( Figure 2E ), hCD45 / CD33+ bone marrow cells ( Figure 2F ) or hCD45 / CD3+ T cells ( Figure 2G Each point represents data from a single mouse, with bars showing mean ± SEM for each condition. Schematic diagrams in A and C were created using biorender.com.

[0058] Figures 3A-3C Enhanced accumulation of human CD45+ innate immune cells in FSHD muscle xenografts. Figure 3A Humanized TA muscles were cryosectioned and immunostained with human-specific anti-CD45 to identify HSCs and Hoechst to identify nuclei. Representative images of FSHD and control transplanted TA muscles are shown. Scale bar = 50 μm. Figure 3B Quantification of CD45+ cells per TA muscle section under the indicated transplantation conditions is shown. Each dot shows the number of human CD45+ cells in one muscle section, with bars showing the mean ± SEM for each condition. * = p < 0.05, ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001 according to Welch's t-test. Figure 3C Serial sections immunostained with human-specific anti-CD45 to identify immune cells or with spectrin β1 to identify human fibers and Hoechst and nuclei are shown. Based on the localization of spectrin β1 myofibers, the humanized muscle area is encircled with a dotted line and transposed onto the CD45 immunostained image. Scale bar = 100 μm.

[0059] Figures 4A-4D Enhanced accumulation of human B cells and macrophages in FSHD muscle xenografts. Humanized TA muscle was cryosectioned and immunostained with a human-specific antibody against CD19 to identify early B cells ( Figure 4A) or human specific antibodies for CD68 to identify macrophages ( Figure 4C ) Co-immunostained and Hoechst-stained nuclei of FSHD or control transplanted TA from mice transplanted with muscle groups 12, 15, or 17. Scale bar = 50 μm. Figure 4B Quantification of B cells revealed by immunostaining for human CD19. Each dot represents one muscle section, with bars showing the mean ± SEM for each condition. Figure 4D Quantification of macrophages revealed by human CD68 immunostaining. Each point represents one muscle section and is shown as the mean ± SEM for each condition. * = p < 0.05, ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001 according to Welch's t-test.

[0060] Figures 5A-5D FSHD and unaffected control muscle stem cells were transplanted and differentiated in HSC-transplanted NSG-SGM3-W41 mice. Figure 5A Humanized TA muscles were cryosectioned and co-stained with human-specific antibodies against lamin A / C to identify human nuclei, spectrin β1 to identify differentiated myofibers, and Hoechst to identify all nuclei. Representative images of FSHD and control xenografts from cohorts 12, 15D1, 15D2, 17D3, and 17D4 are shown. Scale bar = 100 μm. Figure 5B Quantification of spectrin β1 fibers for the indicated transplantation conditions is shown. Each dot represents the number of fibers in one muscle section, with bars showing the mean ± SEM for each condition. * = p < 0.05, ** = p < 0.01, according to Welch's t-test. Figure 5C Shown are representative images of FSHD and control xenografts from cohorts 12 and 15 with or without immune grafts, stained with spectrin β1 to identify differentiated myofibers. Scale bar = 100 μm. Figure 5D Quantification of spectrin β1 fibers for the indicated transplantation conditions is shown. Each dot represents the number of fibers in one muscle section, with bars showing the mean ± SEM for each condition. *** = p < 0.001, **** = p < 0.0001 by Welch's t-test.

[0061] Figures 6A-6D The inflammatory response to FSHD muscle is immune donor dependent. Figure 6A )、DUX4 target genes ( Figure 6B ) and complement genes ( Figure 6CNormalized NanoString counts (NanoString counts) were determined in RNA isolated from immune / muscle-transplanted TA muscle of the indicated cohorts. NanoString counts were log2 transformed, and fold changes in FSHD versus control gene expression were calculated. Significant gene expression changes are indicated with asterisks and were calculated using Welch's t-test. Figure 6D NanoString log2-transformed counts are shown, indicating C3 RNA expression from individual TA muscles. Each dot represents expression data from one TA muscle, with bars showing mean ± SEM for each condition. * = p < 0.05, ** = p < 0.01, **** = p < 0.0001, according to Welch's t-test.

[0062] Figures 7A-7B Human C3 localizes to FSHD and control human xenograft myofibers. Figure 7A Shown are cryosections of humanized TA muscle co-stained with human-specific antibodies to C3 and spectrin β1 to identify differentiated myofibers and Hoechst to identify nuclei. Representative images of FSHD and control xenografts at low (upper) and high (lower) magnification are shown. Scale bars = (upper) 100 μm, (lower) 50 μm. Figure 7B Quantification of C3 puncta in spectrin β1+ fibers from FSHD and control transplanted TA muscle sections from Cohorts 12, 15D1, 15D2, 17D3, and 17D4 is shown. Each dot represents the percentage of fibers with >10 C3 puncta, with bars showing mean ± SEM for each condition. *** = p < 0.001, **** = p < 0.0001 by Welch's t-test.

[0063] Figures 8A-8C Human CD45+ cells in the spleen and xenograft muscle of mice transplanted with donor HSC cells. Figure 8A Representative flow data from HSC and muscle co-transplanted mice are shown, including the gating strategy used to identify human immune cell subtypes. Figure 8B Flow cytometric analysis of the percentage of human CD45+ cells in the spleen is shown. Animals that did not develop a human immune cell population were also included (no IM). Each point represents data from one mouse, with bars showing the mean ± SEM for each condition. Figure 8C Quantification of CD45+ cells per section for the indicated transplantation conditions is shown. Each dot represents the number of CD45+ cells in one muscle section, with bars showing the mean ± SEM for each condition.

[0064] Figure 9Shown are cell engraftment (percent of total) 6 weeks after administration of unfractionated umbilical cord blood (UCB) to irradiated NSG-MHC DKO Tg(Hu-IL15) mice (n=10), irradiated NSG-MHC-class I / II KO mice (n=8), and irradiated NSG-Tg(Hu-IL7)(Hu-IL15) mice (n=10).

[0065] Figure 10A Shown are the results of flow cytometric analysis of cells collected from blood 3 weeks after administration of unfractionated UCB to irradiated NSG-MHC DKO Tg(Hu-IL15) mice (n=13) and irradiated NSG-Tg(Hu-IL7)(Hu-IL15) mice (n=14). Figure 10B Shown are cell engraftment (percent of total) 3 weeks after UCB administration. Figure 10C Shown are the results of flow cytometric analysis of CD4 T cells and CD8 T cells 3 weeks after UCB administration. Figure 10D Shown are the engraftment of CD4 T cells and CD8 T cells 3 weeks after administration of unfractionated UCB. Figure 10E Shown are the percentages of human CD45 cells 3, 6, and 9 weeks after UCB administration. Figure 10F Shown are the percentages of human CD3 T cells (as a percentage of human CD45 cells) 3, 6, and 9 weeks after UCB administration.

[0066] Figures 11A-11B Shown are cell engraftment (percent of total) 9 weeks after injection of dividing cells into NSG-MHC DKO Tg (Hu-IL15) mice. Figure 11C Shown are the engraftment of human CD45 cells 6 and 9 weeks after injection of split cells into NSG-MHC DKO Tg(Hu-IL15) mice. Detailed Description of the Invention

[0068] The humanized immunodeficient mouse model of transplanting human immune cells can evaluate the efficacy and safety of human cell therapy products and other therapeutic products in vivo. However, the use of humanized mice is hindered by model-specific limitations, some of which include the development of graft-versus-host disease (GvHD), the technical difficulties and costs associated with each humanized animal, and the lack of implantation of some human immune cells. Even though there are many available mouse models, clinically relevant humanized models are still very much needed in this field-for example, humanized models of clinical applications of cancer immunotherapeutics can be understood (see, for example, Lee et al., Dev Reprod., 2019, 2 (2): 79-92; Morillon et al., Anticancer Research, 2020, 40 (10): 5329-5341, each document is incorporated herein by reference). The present disclosure provides such a model.

[0069] Mouse model

[0070] Herein, for simplicity, reference is made to "mice" and "mouse models" (e.g., a proxy for a human condition). It should be understood that these terms are used interchangeably throughout the specification to encompass "rodents" and "rodent models," including mice, rats, and other rodent species, unless otherwise indicated.

[0071] It should also be understood that the standard genetic nomenclature used herein provides unique identification for different rodent strains, and the strain symbol conveys basic information about the type of strain or original species used and the genetic content of the strain. The International Committee on Standardized Genetic Nomenclature for Mice has promulgated rules for representing strains and original species. These rules can be obtained online from the Mouse Genome Database (MGD; informatics.jax.org) and published in print (Lyon et al. 1996). The strain symbol usually includes a laboratory registration code (laboratory code). The first laboratory code attached to the strain symbol identifies and indicates the founder of the strain. The laboratory code at the end of the strain symbol represents the current source of the mice for obtaining the strain. The different Lab codes attached to the same strain symbol distinguish sublines and warn users that genetic differentiation may exist between different sublines. The laboratory code is assigned by the central registry to ensure that each code is unique. Registry is maintained by the Institute for Laboratory Animal Research (ILAR) at the National Academy of Sciences, Washington, DC. Laboratory codes can be obtained electronically from the ILAR website (nas.edu / cls / ilarhome.nsf). See also Davisson MT, Genetic and Phenotypic Definition of Laboratory Mice and Rats / What Constitutes an Acceptable Genetic-Phenotypic Definition, National Research Council (US) International Committee of the Institute for Laboratory Animal Research. Washington (DC): National Academies Press (US); 1999.

[0072] When applied to mutant mouse strains, "genetic background" or "background" refers to its genetic makeup (all its alleles at all loci) excluding the mutant gene of interest and a small amount of other genetic material (usually from one or two other strains). Correct strain nomenclature indicates what the background of the mutant strain is. For example, the targeted mutant strain NOD.129S7(B6)-Rag1tm1Mom / J (The Jackson Laboratory (JAX) strain #003729) and NOD.Cg-Rag1 tm1Mom Prf1 tm1Sdz The genetic background of the / SzJ (JAX strain #004848) is primarily non-obese diabetic (NOD). However, the first strain carries a targeted mutation in the Rag1 gene, possibly derived from some Rag1-linked alleles from 129S7-derived embryonic stem (ES) cells, and possibly some B6 alleles from crosses in its breeding history. In contrast, the second strain is isogenic (Cg) with more than one donor strain in its breeding history. It carries targeted mutations in the Rag1 and Prf1 genes, and may also carry some background alleles from these other strains.

[0073] Mouse models can be modified to enable disease to be assessed. Any system (e.g., immune, respiratory, neural or circulatory), organ (e.g., blood, heart, blood vessel, spleen, thymus, lymph node or lung), tissue (e.g., epithelial, connective, muscle and neural) or cell type (e.g., lymphocyte or macrophage) can be modified independently or in combination to enable disease to be studied in the model provided herein.

[0074] Three conventional methods for generating genome-modified mice (e.g., knockout mice, transgenic mice) include DNA microinjection (Gordon and Ruddle, Science 1981:214:1244-124, incorporated herein by reference), embryonic stem cell-mediated gene transfer (Gossler et al., Proc. Natl. Acad. Sci. 1986, 83:9065-9069, incorporated herein by reference), and retroviral-mediated gene transfer (Jaenisch, Proc. Natl. Acad. Sci. 1976, 73:1260-1264, incorporated herein by reference), any of which can be used as provided herein. Genome editing methods utilizing, for example, clustered regularly interspaced palindromic repeats (CRISPR / Cas) nucleases, transcription activator-like effector nucleases (TALENs), or zinc finger nucleases (ZFNs) can also be used and described elsewhere herein.

[0075] Following delivery of the nucleic acid to a fertilized embryo (e.g., a one-cell embryo (e.g., a zygote) or a multicellular embryo (e.g., a developmental stage subsequent to the zygote, such as a blastocyst), the fertilized embryo is transferred to a pseudopregnant female, which subsequently gives birth to offspring. The presence or absence of a transgene of interest or a disabling mutation in an endogenous gene of interest can be confirmed, for example, using a variety of genotyping methods (e.g., sequencing and / or genomic PCR).

[0076] New mouse models can also be generated by breeding parental lines. Utilizing a wide variety of available mutant, knockout, knock-in, transgenic, Cre-lox, Tet-inducible systems, and other mouse strains, multiple mutations and transgenes can be combined to generate new mouse models. Multiple mouse strains can be bred together to generate double, triple, or even quadruple and higher multi-mutant / transgenic mice.

[0077] In some embodiments, parental mice are bred to produce F1 mice.Parental mice can be, for example, homozygous, heterozygous, semi-heterozygous or homozygous invalid at specific allele place.Homozygous has described the genotype of two identical alleles at given locus place, heterozygous has described the genotype of two different alleles at given locus place, semi-heterozygous has described the genotype that is only made up of the single copy of specific gene in other diploid organism, and homozygous invalid refers to the other diploid organism that wherein two copies of gene all lack.

[0078] As is known in the art, immunodeficient mice have an impaired or destroyed immune system, such as a specific deficiency in MHC class I, II, or both, a deficiency in B cells or T cells, or both, a deficiency in natural killer (NK) cells, a deficiency in myeloid cells (e.g., a deficiency in granulocytes and / or monocytes), a deficiency in macrophages, a deficiency in dendritic cells, and an immune deficiency caused by knocking out genes for cytokines, cytokine receptors, Toll-like receptors (TLRs), and various transducers and transcription factors of signaling pathways. Immunodeficiency mouse models include single gene mutation models such as nude (nu) strains and severe combined immunodeficiency (scid) strains, non-obese diabetic (NOD) strains, RAG (recombination activation gene) strains with targeted gene deletions, and various hybrids derived from double and triple mutant mouse strains with additional deficiencies in innate and adaptive immunity.

[0079] The impaired immune system can be measured by any method known in the art, including but not limited to, the production of mature immune cells (e.g., B cells, T cells, dendritic cells, macrophages, natural killer cells), defects in endogenous cytokine signaling, limited resistance to infection, and reduced survival. In some embodiments, immunodeficient mice lack mature mouse T cells, lack mature mouse B cells, lack functional mouse natural killer cells, and are endogenous (e.g., mouse) cytokine signaling defects. Mature T cells develop in the thymus and are released into other tissues, including blood, spleen, and lymphatic system. Mature B cells express pathogen-specific antibodies on their surface. Functional natural killer cells recognize and kill malignant and virally transformed cells without prior exposure. Endogenous (e.g., mouse) cytokine signaling is important in maintaining homeostasis and relies on cytokines to regulate immune, nervous, and endocrine system functions. Endogenous (e.g., mouse) cytokine signaling defects refer to cytokine signaling levels that are insufficient to maintain immune system homeostasis compared to a non-defective endogenous immune system.

[0080] "Lack" of a particular cell type or signal (e.g., a cytokine) in an immunodeficient mouse can be the complete absence of that cell type or signal, or can be a significant reduction in that cell type or signal relative to a non-immune deficient mouse (e.g., without genetic modification to reduce innate immunity). For example, the lack of a particular cell type (e.g., cell number) or signal (e.g., cytokine protein level) can be a reduction of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% relative to a non-immune deficient mouse.

[0081] The absence of a particular cell type can be assessed by any method known in the art, including but not limited to: flow cytometry; quantitative PCR (qPCR) of T cell markers (e.g., CD3, CD8, CD4, CD25, CD127, CD152), B cell markers (e.g., CD19, IgM, BCAP), and NK cells (e.g., CD224, CD122, NK1, NKp46, Ly49, CD11b, CD49b); immunofluorescence and / or enzyme-linked immunosorbent assay (ELISA). Deficiencies in cytokine signaling (e.g., mouse cytokine signaling) can be assessed by any method known in the art, including, but not limited to, flow cytometry, qPCR for cytokines (e.g., IL2, IL7, IL15, IFNγ, IL4, IL5, IL9, IL13, IL25, IL17A, IL17F, IL22, TNFα, IL12, CCL3, GM-CSF, IL6, IL10, TGFβ, IL18, IL21), immunofluorescence, and / or ELISA.

[0082] Non-limiting examples of immunodeficient mouse model backgrounds useful herein include the following mouse strains:

[0083] Nude (nu) [Flanagan SP. Genet Res 1966; 8:295-309; and Nehls M et al. Nature 1994; 372:103-7];

[0084] Scid (scid) [Bosma GC et al. Nature 1983; 301: 527-30; Mosier DE et al. Nature 1988; 335: 256-9; and Greiner DL et al. Stem Cells 1998; 16: 166-77];

[0085] NOD [Kikutani H et al Adv Immunol 1992;51:285-322; and Anderson MS et al Ann Rev Immunol 2005;23:447-85];

[0086] RAG1 and RAG 2 (rag) [Mombaerts P et al. Cell 1992; 68: 869-77; Shinkai U et al. Cell 1992; 68: 855-67];

[0087] NOD-scid [Greiner DL et al 1998; Shultz LD et al J Immunol 1995; 154: 180-91; Melkus MW et al Nature Med 2006; 12: 1316-22; and Denton PW et al PLoS Med 2008; 4(12): e357];

[0088] IL2rg null [DiSanto JP et al. Proc Natl Acad Sci USA 1995;92:377-81];

[0089] B2m null [Christianson SW et al J Immunol 1997;158:3578-86];

[0090] NOD-scid IL2rγ null [Shultz LD et al Nat Rev Immunol 2007;7:118-30; Ito M et al Blood 2002;100:3175-82; Ishikawa I et al Blood 2005;106:1565-73; and Macchiarini F et al J Exp Med 2005;202:1307-11];

[0091] ·NOD-scid B2m null [Shultz et al. 2007; Shultz LD et al. Transplantation 2003;76:1036-42; Islas-Ohlmayer MA et al. J Virol 2004;78:13891-900; and Macchiarini et al. 2005];

[0092] HLA transgenic mice [Grusby MJ et al. Proc Natl Acad Sci USA 1993; 90(9): 3913-7; and Roy CJ et al. Infect Immun 2005; 73(4): 2452-60. See, e.g., Belizario JE The Open Immunology Journal, 2009; 2: 79-85];

[0093] NOG mice (NOD.cg-Prkdc scid Il2rg tm1Sug ) [Shultz LD et al Nat Rev Immunol 2007;7:118-30]; and

[0094] BRG mice (BALB / c; 129S4-Rag2 tm1.1Flv )[Traggiai E et al. Science2004;304(5667):104-107].

[0095] Non-obese diabetes (NOD) background

[0096] In some embodiments, provided herein are immunodeficient mouse models with a non-obese diabetic (NOD) background. NOD mice (e.g., JAX strain #001976, NOD-Shi LtJ ) is a polygenic mouse model of autoimmune (e.g., type 1) diabetes characterized by hyperglycemia and insulitis (leukocyte infiltration of pancreatic islet cells). NOD mice are hypoinsulinemic and hyperglycemic, indicating selective destruction of pancreatic beta cells. The main component of diabetes susceptibility in NOD mice is a unique MHC haplotype. NOD mice also exhibit a variety of abnormal immune phenotypes, including defects in antigen-presenting cell immunoregulatory function, defects in T lymphocyte reservoir regulation, defects in NK cell function, defects in macrophage cytokine production (Fan et al., 2004), and impaired wound healing. It also lacks hemolytic complement C5. NOD mice are also severely deaf. Multiple mutations leading to immunodeficiency, targeted mutations in cytokine genes, and transgenes that affect immune function have been backcrossed into the NOD inbred background.

[0097] In some aspects of the present disclosure, the immunodeficient mice provided herein based on the NOD background have a gene selected from the group consisting of NOD-Cg.-Prkdc scid IL2rg tm1wJl / SzJ(NSG TM )、NOD.Cg-Rag1 tm1Mom Il2rg tm1Wjl / SzJ(NRG), NOD.Cg-Prkdc scid Il2rg tm1Sug / ShiJic(NOG), NOD-Prkdc em26Cd52 Il2rg em26Cd22 / NjuCrl(NCG) and BALB / c-Rag2 tm1Fwa Ilr2g tm1Sug Genetic background of JicTac(BRG) / JicTac(BRG) ("background"). Other immunodeficient mouse strains are contemplated herein.

[0098] In some embodiments, the immunodeficient mouse model based on the NOD background has NOD-Cg.-Prkdc scid IL2rg tm1wJl / SzJ Genetic background. The JAX mouse (e.g., JAX strain #005557) is an immunodeficient mouse that lacks mature T cells, B cells, and NK cells, is defective in multiple cytokine signaling pathways, and has many defects in innate immunity (see, e.g., Shultz, Ishikawa, & Greiner, 2007; Shultz et al., 2005; and Shultz et al., 1995, each of which is incorporated herein by reference). The NOD mouse strain NOD / ShiLtJ is derived from Mouse (see, e.g., Makino et al., 1980, incorporated herein by reference) includes Prkdc scid mutation (also called "severe combined immunodeficiency" mutation or "scid" mutation) and Il2rg tm1Wjl Targeted mutation. Il2rg tm1Wjl The mutation is a disabling mutation in the gene encoding the interleukin 2 receptor gamma chain (Il2rg, homologous to IL2RG in humans) that blocks NK cell differentiation, thereby eliminating the barrier that prevents efficient engraftment of primary human cells (Cao et al., 1995; Greiner et al., 1998; and Shultz et al., 2005, each of which is incorporated herein by reference).

[0099] In some embodiments, the immunodeficient mouse model has an NRG background. The NRG mouse (e.g., JAX strain #007799) is extremely immunodeficient. The mouse contains two mutations on a NOD / ShiLtJ genetic background; a targeted knockout mutation in the recombination activating gene 1 (Rag1) and a complete null allele of the IL2 receptor common gamma chain (IL2rg null The extreme immunodeficiency of NRG mice allows for the efficient transplantation of human CD34 + Immunodeficient NRG mice are humanized with hematopoietic stem cells (HSCs) and patient-derived xenografts (PDXs). They are more resistant to irradiation and genotoxic drugs than mice with a scid mutation in the DNA repair enzyme Prkdc.

[0100] In some embodiments, the immunodeficient mouse model is a NOG mouse. NOG mice (Ito M et al., Blood 2002) are extremely severe combined immunodeficient (scid) mice (Ohbo K. et al., Blood 1996) established by combining NOD / scid mice and IL2 receptor-γ chain knockout (IL2rγKO) mice. NOG mice lack T and B cells, lack natural killer (NK) cells, show reduced dendritic cell function and reduced macrophage function, and lack complement activity.

[0101] In some embodiments, the immunodeficient mouse model has an NCG background. NCG mice (e.g., Charles River stock #572) are produced by sequential CRISPR / Cas9 editing of the Prkdc and Il2rg loci in NOD / Nju mice, thereby generating mice of the same line as NOD / Nju. NOD / Nju carries a mutation in the Sirpa (SIRPα) gene, which allows transplantation of exogenous hematopoietic stem cells. Prkdc knockout produces a SCID-like phenotype lacking proper T cell and B cell formation. Knockout of the Il2rg gene further exacerbates the SCID-like phenotype and also leads to a reduction in NK cell production.

[0102] In some embodiments, the immunodeficient mouse model has a BRG background. tm1Fwa ) mice and BALB / cA-Il2rg(Ilr2g tm1Sug ) mice to produce BRG mice (BALB / c-Rag2 tm1Fwa Ilr2g tm1Sug BRG mice lack mature T, B, and NK cells, do not produce immunoglobulins, and exhibit reduced dendritic cell function relative to wild-type BALB / c mice.

[0103] Interleukin-2 receptor gamma (Il2rg) allele

[0104] This gene encodes a transmembrane protein that is a common subunit of several interleukin receptor complexes. In addition to this γ subunit, these receptors also contain α and β subunits. Signal transduction through this pathway is important in immune cell differentiation and function. In some embodiments, provided herein are endogenous interleukin 2 receptor γ chain (Il2rg) alleles (Il2rg) containing disabling mutations. null ) immunodeficient mouse model. null Examples of alleles include Il2rg tm1Wjl alleles (Cao X et al., Immunity. 1995 Mar; 2(3): 223-38) and Il2rg tm1Sug Alleles (Ohbo K et al., Blood. 1996 Feb 1; 87(3):956-67). In some embodiments, the immunodeficient mouse comprises Il2rg tm1Wjl In some embodiments, the immunodeficient mouse comprises Il2rg tm1SugAlleles. In some embodiments, the immunodeficient mouse comprises the Il2rgem26Cd22 allele. Mouse IL2Rγ is encoded by the mouse Il2rg gene (Gene ID: 16186). The human ortholog of mouse IL2Rγ is interleukin-2 receptor subunit gamma (IL2RG).

[0105] Protein kinase, DNA-activated catalytic subunit (Prkdc) alleles

[0106] This gene enables DNA-dependent protein kinase activity, double-stranded DNA binding activity and enzyme binding activity. It participates in several processes, including the regulation of cellular protein metabolism, the regulation of hematopoietic stem cell differentiation and the regulation of hematopoiesis. It works upstream or within several processes, including DNA metabolism, ectopic germ cell programmed cell death and immune system development. In some embodiments, provided herein are endogenous protein kinases containing disabling mutations, DNA-activated catalytic polypeptide (Prkdc) alleles (Prkdc null In some embodiments, the disabling mutation in the endogenous Prkdc allele is a severe combined immunodeficiency (scid) mutation. null Examples of alleles include Prkdc scid Alleles, commonly referred to as scid (Bosma GC et al., Nature. 1983 Feb 10; 301(5900):527-30) and Prkdc em26Cd52 In some embodiments, the immunodeficient mouse comprises Prkdc scid In some embodiments, the immunodeficient mouse comprises a Prkdc allele. em26Cd52 Alleles. Mouse PRKDC is encoded by the mouse Prkdc gene (Gene ID: 19090). The human ortholog of mouse PRKDC is protein kinase, DNA-activated, catalytic subunit (PRKDC).

[0107] In some embodiments, the immunodeficient mouse model has NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ Background (also known as NOD-scid IL2Rγ null ;NOD-scid IL2Rg null ; and NOD scidγ) (JAX strain #005557). These mice are extremely immunodeficient. The mice carry two mutations on the NOD / ShiLtJ genetic background; severe combined immunodeficiency (scid) and a complete null allele of the IL2 receptor common gamma chain (IL2rg nullscid mutations are located in the DNA repair complex protein PRKDC and confer B and T cell defects in mice. null The mutations prevent cytokine signaling through multiple receptors, resulting in a deficiency of functional NK cells. The severe immunodeficiency allows mice to be humanized by transplantation of human CD34+ HSCs, PBMCs, patient-derived xenografts (PDXs), or adult stem cells and tissues.

[0108] Recombination activating gene 1 (Rag1) allele

[0109] This gene enables multiple functions, including protein homodimerization activity, ubiquitin protein ligase activity, and zinc ion binding activity. It is involved in the development of the immune system, positive regulation of T cell differentiation, and protein ubiquitination. It acts upstream or within several processes, including negative regulation of T cell homeostasis, hematopoietic or lymphoid organ development, and apoptosis. In some embodiments, provided herein are endogenous recombination activating gene 1 (Rag1) alleles (Rag1) containing disabling mutations. null ) immunodeficient mouse model. Rag1 null Examples of alleles include: Rag1 tm1Mom (Mombaerts P et al., Cell. 1992 Mar 6; 68(5):869-77), Rag1 em1Gpt 、Rag1 em1Ldn 、Rag1 em2Gpt 、Rag1 em28Gpt 、Rag1 m1Btlr 、Rag1 tm1 (cre)Thr 、Rag1 tm1(GFP)Imku 、Rag1 tm1Fwa 、Rag1 tm1Jsek 、Rag1 m1Anu 、Rag1 tm1.1Sadu 、Rag1 tm1Mnz 、Rag1 coln 、Rag1 em1Dgs 、Rag1 em2Dgs 、Rag1 em2Ldn 、Rag1 em2Tutzy 、Rag1 em3Ldn 、Rag1 em4Ldn 、Rag1 em5Lutzy 、Rag1 em8Lutzy 、Rag1 em10Lutzy 、Rag1 m2Btlr 、Rag1 m3Btlr 、Rag1 m4Btlr 、Rag1 tm1Bal 、Rag1 tm1Jmj 、Rag1tm1Nju 、Rag1 tm1Smoc 、Rag1 tm1a(KOMP)Wtsi and Rag1 tm1e(KOMP)Wtsi In some embodiments, the immunodeficient mouse comprises Rag1 tm1Mom Alleles. Mouse RAG1 is encoded by the mouse Rag1 gene (Gene ID: 19373). The human ortholog of mouse RAG1 is recombination activator 1 (RAG1).

[0110] Recombination activating gene 2 (Rag2) allele

[0111] This gene enables multiple functions, including phosphatidylinositol phosphate binding activity, phosphatidylinositol-3,4-bisphosphate binding activity, and zinc ion binding activity. Participates in V(D)J recombination and pre-B cell allele rejection. It acts upstream or within several processes, including positive regulation of B cell homeostatic proliferation, lymphocyte differentiation, and organ growth. In some embodiments, provided herein are endogenous recombination activating gene 2 (Rag2) alleles (Rag2) containing disabling mutations. null ) immunodeficient mouse model. Rag2 null Examples of alleles include: Rag2 tm1Fwa (Shinkai Y et al., Cell. 1992 Mar 6; 68(5):855-67), Rag2 tm1Mnz 、Rag2 m1Btlr 、Rag2 tm1.1Cgn 、Rag2 tm1.1Desi 、Rag2 tm1Avla 、Rag2 tm1Cgn 、Rag2 tm1Mao 、Rag1 tm1Libo and Rag2 tm1Tgi In some embodiments, the immunodeficient mouse comprises Rag2 tm1Fwa Alleles. Mouse RAG2 is encoded by the mouse Rag2 gene (Gene ID: 5897). The human ortholog of mouse RAG2 is recombination activator 2 (RAG2).

[0112] MHC class I / class II alleles

[0113] The major histocompatibility complex (MHC) genomic region carries repeated genes that express protein molecules responsible for rejection of transplanted tissues, restricted antigen presentation, and self- and non-self recognition. The Mhc genomic region in mice (located on chromosome 17) is named H2, and the genes within this region are generally divided into three different categories (I to III) based on their structure and function. Class I molecules typically elicit an immune response by presenting peptide antigens derived from intracellular proteins to T lymphocytes. Class II molecules play an important role in the selection of T cell repertoires, the establishment and regulation of adaptive immune responses, and autoimmune deviations. In some embodiments, provided herein are endogenous histocompatibility 2, K region (H2-K) alleles (H2-K) containing disabling mutations. null ) immunodeficient mouse model. null Examples of alleles include: H2-K1 tm1Bpe (Perarnau B et al., Eur J Immunol. 1999 April; 29(4): 1243-52), H2-K bm1 、H2-K bm3 、H2-K bm4 、H2-K bm5 、H2-K bm8 、H2-K bm10 、H2-K bm11 、H2-K bm16 、H2-K bm23 、H2-K bm29 、H2-K dm4 、H2-K dm5 、H2-K em1 (HLA-A*0201)Gpt 、Tg(GFAP-B2m,GFAP-H2-K b )1Gjh、Tg(H2-K)1Alm、Tg(H2-K b )1Rms, Tg(HLA-A2 / H2-K)1Scr, Tg(HLA-A / H2-K)1Chmb and Tg(HLA-B / H2-K)1Chmb. In some embodiments, the immunodeficient mouse model comprises an endogenous histocompatibility 2, K1, K region (H2-K1) allele (H2-K1) containing a disabling mutation. null ). In some embodiments, the immunodeficient mouse model comprises H2-K1 tm1Bpe Alleles. The human ortholog of mouse H2-K1 is the major histocompatibility complex, class I, A (HLA-A).

[0114] In some embodiments, provided herein are endogenous H2-D alleles (H2-D) comprising a disabling mutation. null) immunodeficient mouse model. null Examples of alleles include: H2-D1 tm1Bpe (Pascolo S et al., J Exp Med. 1997 Jun 16; 185(12):2043-51), H2-D dm1 、Tg(H2-D b )2Bujf、Tg(H2-D d )28Bee、Tg(H2-D d )D8Gja、Tg(H2-D d / H2-L d )DL1U1 and Tg(HLA-A24 / H2-D / B2M)3DVs. In some embodiments, the immunodeficient mouse model comprises an endogenous histocompatibility 2, D1, locus 1 (H2-D1) allele containing a disabling mutation (H2-D1 null ). In some embodiments, the immunodeficient mouse model comprises H2-D1 tm1Bpe Alleles. The human ortholog of mouse H2-D1 is major histocompatibility complex, class I, A (HLA-A).

[0115] In some embodiments, provided herein are endogenous H2-A alleles (H2-A) comprising a disabling mutation. null ) immunodeficient mouse model. null Examples of alleles include: H2-Ab1 em1Mvw (Brehm MA et al., FASEBJ. 2019 Mar;33(3):3137-3151), H2-Ab1 bm12 ;H2-Ab1 em1(HLA-DPB1)Smoc ;H2-Ab1 em1Dys ;H2-Ab1 em1Gpt ;H2-Ab1 em1Ygch ;H2-Ab1 em2Gpt ;H2-Ab1 em2Smoc ;H2-Ab1 em2Ygch ;H2-Ab1 em3Smoc ;H2-Ab1 em4Smoc ;H2-Ab1 em22Gp； H2-Ab1 tm1,Jssh ;H2-Ab1 tm1,Koni ;H2-Ab1 Tm1,1Sish ;H2-Ab1 tm1Doi ;H2-Ab1 Tm1Gru ;H2-Ab1 tmJpl ;H2-Ab1 Tm1Hpl ;H2-Ab1 tm1Koni ;H2-Ab1tm1Wug ;H2-Ab1 tm2Hpl ;H2 em1Gpt ;H2 em1Smoc ;Tg(Ab1TL)1Gru;Tg(CD2-CD4,HLA-DQA1,HLA-DQB1)1Ell;Tg(CD4,HLA-DQA1,HLA-1DQB1)N8Ell;Tg(68-H2-Ab o )#Rhd;Tg(H2-Ab1)62Dim;Tg(H2-Ab1)GBQRhd;Tg(H2-Ea-H2-Ab1)1Pmr;Tg(HLA-DQA 1,HLA-DQB1)70Myl;Tg(HLA-DQA1,HLA-DQB1_73Myl,Tg(KRT14-H2-Ab1)1Glm;H2-Ab1 tm1a (EUCOMM)Hmgu ;H2-Ab1 tm1e(EUCOMM)Hmgu ; and H2-Ab1 tm2e(EUCOMM)Hmgu In some embodiments, the immunodeficient mouse model comprises an endogenous H2-Ab1 allele containing a disabling mutation (H2-Ab1 null ). In some embodiments, the immunodeficient mouse model comprises H2-Ab1 em1Mvw Alleles. The human ortholog of mouse H2-Ab1 is major histocompatibility complex, class II, DQβ1 (HLA-DQB1).

[0116] In some embodiments, provided herein are immunodeficient mouse models comprising an endogenous mouse H2-K allele containing a disabling mutation, an endogenous mouse H2-D allele containing a disabling mutation, and an endogenous mouse H2-A allele containing a disabling mutation. In some embodiments, the endogenous H2-K1 allele containing a disabling mutation is H2-K1 tm1Bpe Alleles, the endogenous H2-D allele containing the disabling mutation is H2-D1 tm1Bpe allele, and the endogenous H2-A allele containing a disabling mutation is H2-Ab1 em1Mvw allele.

[0117] In some embodiments, the immunodeficient mouse model has NOD.Cg-Prkdc scid H2-K1 tm1Bpe H2-Ab1 em1Mvw H2-D1 tm1Bpe Il2rg tm1Wjl / SzJ background (also known as NSG-MHC I / IIDKO; NSG-(K b D b ) null (IA)null ; and NSG-(K b D b ) null (IA null NSG-MHC I / IIDKO mutant mice combine features of the severe combined immunodeficiency mutation (scid), IL2 receptor γ chain deficiency, MHC class I molecule deficiency (H2-K and D), and MHC class II molecule deficiency (IA) and exhibit a significant delay in the onset of GvHD.

[0118] Kit allele

[0119] This gene (c-Kit proto-oncogene) is the cellular homolog of the transforming gene of the feline retrovirus (v-Kit). The protein includes features of a protein kinase transmembrane receptor. In some embodiments, provided herein are endogenous Kit proto-oncogene receptor tyrosine kinase (Kit) alleles (Kit) containing a disabling mutation. null In some embodiments, the mutation in the Kit allele is a spontaneous mutation. null Examples of alleles include: Kit W-41J (Cosgun et al., Cell Stem Cell, 2014, 15(2):227-238); Del(5Kit-Cep135)1Utr; In(5)9Rk; In(5)30Rk; In(5)33Rk; Kit W-19H ;Kit W-57J 、Kit W-18J 、Kit W-sh 、Kit W-43J 、Kit W-34J 、Kit W-55J 、Kit W-35J and Kit W-39J In some embodiments, the immunodeficient mouse comprises Kit W-41J Alleles. Mouse KIT is encoded by the mouse Kit gene (Gene ID: 16590). The human ortholog of mouse KIT is the KIT proto-oncogene, receptor tyrosine kinase (KIT).

[0120] Human cytokines

[0121] In some embodiments, the immunodeficient mouse models provided herein express several exogenous nucleic acids (e.g., transgenics), each of which encodes a human cytokine. In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human interleukin 7 (huIL7). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human interleukin 15 (huIL15). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human interleukin 3 (huIL3). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human granulocyte-macrophage colony stimulating factor (huGM-CSF). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human Steel (huSCF). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding huIL1, an exogenous nucleic acid encoding huIL15, an exogenous nucleic acid encoding huIL3, an exogenous nucleic acid encoding huGM-CSF, and an exogenous nucleic acid encoding huSCF. Thus, in some embodiments, cells of the immunodeficient mouse model express huIL1, express huIL15, express huIL3, express huGM-CSF, and express huSCF.

[0122] Human IL7

[0123] In some embodiments, the immunodeficient mice provided herein express human interleukin 7 (huIL7). Interleukin 7 is a cytokine that is crucial in the development of B and T cells. IL7 binds to hepatocyte growth factor to promote the growth of B cell precursors and stimulates V(D)J rearrangement of the T cell receptor. IL7 also plays a role in the survival of lymphocytes and the maintenance and development of naive and memory T cells.

[0124] The human IL7 sequence can be any human IL7 sequence known in the art (see, e.g., Gene ID: 3574). In some embodiments, the human IL7 sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human IL7 sequence can be expressed (e.g., in mouse cells) by any method provided herein.

[0125] Human IL15

[0126] In some embodiments, the immunodeficient mice provided herein express human interleukin 15 (huIL15). Interleukin 15 is a cytokine that binds to hematopoietin receptors to stimulate cell differentiation and regulate CD8 + Cytokines that regulate the activation and proliferation of T cells and natural killer cells.

[0127] The human IL15 sequence can be any human IL15 sequence known in the art (see, e.g., Gene ID: 3600). In some embodiments, the human IL15 sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human IL15 sequence can be expressed (e.g., in mouse cells) by any of the methods provided herein.

[0128] Human IL3

[0129] In some embodiments, the immunodeficient mice provided herein express human interleukin 3 (huIL3). Interleukin 3 is a cytokine that promotes the growth and proliferation of a wide variety of hematopoietic cell types, including granulocytes, monocytes, and dendritic cells. IL3 is produced by activated T cells and stimulates the differentiation of immature myelomonocytic cells to alter macrophage and granulocyte populations.

[0130] The human IL3 sequence can be any human IL3 sequence known in the art (see, e.g., Gene ID: 3562). In some embodiments, the human IL3 sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human IL3 sequence can be expressed (e.g., in mouse cells) by any of the methods provided herein.

[0131] Human GM-CSF

[0132] In some embodiments, the immunodeficient mice provided herein express human granulocyte-macrophage colony-stimulating factor (huGM-CSF). GM-CSF is a cytokine that regulates macrophage and granulocyte differentiation, dendritic cell development, and maintenance of homeostasis.

[0133] The human GM-CSF sequence can be any human GM-CSF sequence known in the art (see, e.g., Gene ID: 1437). In some embodiments, the human GM-CSF sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human GM-CSF sequence can be expressed (e.g., in mouse cells) by any of the methods provided herein.

[0134] Human SCF

[0135] In some embodiments, the immunodeficient mice provided herein express human Steel Factor (SCF, SF, or KITLG). SCF, also known as KIT ligand (KITLG), is a ligand for the tyrosine kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that plays a role in germ cell and neural cell development and hematopoiesis in utero, all of which are believed to reflect a role in cell migration. In adults, it functions pleiotropically, but is primarily known for its continued requirement for hematopoiesis.

[0136] The human SCF sequence can be any human SCF sequence known in the art (see, e.g., Gene ID: 4254). In some embodiments, the human SCF sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human SCF sequence can be expressed by any of the methods provided herein (e.g., in mouse cells).

[0137] Exemplary Humanized Immunodeficient Mouse Model

[0138] Immunodeficient mice expressing a human IL7 transgene

[0139] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises an exogenous nucleic acid encoding human interleukin-7 (huIL7) (e.g., a human IL7 transgene). In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ. In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from peripheral blood mononuclear cells (PBMCs), hematopoietic stem cells (HSCs), and umbilical cord blood (UCB) cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0140] Immunodeficient mice expressing human IL7 and human IL15 transgenes

[0141] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises an exogenous nucleic acid encoding human interleukin-7 (huIL7) (e.g., a huIL7 transgene) and an exogenous nucleic acid encoding human interleukin-15 (huIL15) (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0142] In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0143] MHC-deficient immunodeficient mice expressing a human IL-15 transgene

[0144] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises: an endogenous H2-K allele containing a disabling mutation (H2-K null ); endogenous H2-D alleles containing disabling mutations (H2-D null ); endogenous H2-A alleles containing disabling mutations (H2-A null ); and an exogenous nucleic acid encoding huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0145] In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0146] MHC-deficient immunodeficient mice expressing human IL7 and human IL15 transgenes

[0147] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises: an endogenous H2-K allele containing a disabling mutation (H2-K null ); endogenous H2-D alleles containing disabling mutations (H2-D null ); endogenous H2-A alleles containing disabling mutations (H2-A null ); an exogenous nucleic acid encoding huIL7 (e.g., a huIL7 transgene); and an exogenous nucleic acid encoding huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0148] In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0149] MHC-deficient immunodeficient mice expressing human IL3, human GM-CSF, human SCF, and human IL15 transgenes

[0150] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises: an endogenous H2-K allele containing a disabling mutation (H2-K null ); endogenous H2-D alleles containing disabling mutations (H2-D null ); endogenous H2-A alleles containing disabling mutations (H2-A null); exogenous nucleic acid encoding human interleukin-3 (huIL3); exogenous nucleic acid encoding human granulocyte-macrophage colony stimulating factor (huGM-CSF); and exogenous nucleic acid encoding human Steel factor (huSCF); and exogenous nucleic acid encoding huIL15 (e.g., huIL15 transgene). In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0151] In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0152] MHC-deficient immunodeficient mice expressing human IL3, human GM-CSF, human SCF, and human IL7 transgenes

[0153] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises: an endogenous H2-K allele containing a disabling mutation (H2-K null ); endogenous H2-D alleles containing disabling mutations (H2-D null ); endogenous H2-A alleles containing disabling mutations (H2-A null ); exogenous nucleic acid encoding huIL3; exogenous nucleic acid encoding huGM-CSF; and exogenous nucleic acid encoding huSCF; and exogenous nucleic acid encoding huIL7 (e.g., huIL7 transgene). In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0154] In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0155] MHC-deficient immunodeficient mice expressing human IL3, human GM-CSF, human SCF, human IL7, and human IL15 transgenes

[0156] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises: an endogenous H2-K allele containing a disabling mutation (H2-K null ); endogenous H2-D alleles containing disabling mutations (H2-D null ); endogenous H2-A alleles containing disabling mutations (H2-A null ); exogenous nucleic acid encoding huIL3; exogenous nucleic acid encoding huGM-CS; and exogenous nucleic acid encoding huSCF; exogenous nucleic acid encoding huIL7 (e.g., a huIL7 transgene); and exogenous nucleic acid encoding human huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0157] In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0158] Immunodeficient mice expressing human IL3, human GM-CSF, human SCF, and human IL15 transgenes

[0159] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises: an exogenous nucleic acid encoding huIL3; an exogenous nucleic acid encoding huGM-CS; an exogenous nucleic acid encoding huSCF; and an exogenous nucleic acid encoding human huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0160] In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0161] Immunodeficient mice deficient in MHC and Kit and expressing human IL3, human GM-CSF, human SCF, human IL7, and human IL15 transgenes

[0162] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises: an endogenous H2-K allele containing a disabling mutation (H2-K null ); endogenous H2-D alleles containing disabling mutations (H2-D null ); endogenous H2-A alleles containing disabling mutations (H2-A null ); endogenous Kit allele containing a disabling mutation (Kit null ); exogenous nucleic acid encoding huIL3; exogenous nucleic acid encoding huGM-CS; exogenous nucleic acid encoding huSCF; exogenous nucleic acid encoding huIL7 (e.g., huIL7 transgene); and exogenous nucleic acid encoding human huIL15 (e.g., huIL15 transgene). In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0163] In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0164] In some embodiments, the humanized immunodeficient mouse model of the present invention comprises: an endogenous Il2rg allele containing a disabling mutation (Il2rg null ); endogenous H2-K alleles containing disabling mutations (H2-K null ); endogenous H2-D alleles containing disabling mutations (H2-D null ); endogenous H2-A alleles containing disabling mutations (H2-A null ); endogenous Kit allele containing a disabling mutation (Kit null ); exogenous nucleic acid encoding human interleukin-7 (huIL7); exogenous nucleic acid encoding human interleukin-15 (huIL15); exogenous nucleic acid encoding human interleukin-3 (huIL3); exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF); and exogenous nucleic acid encoding human Steel factor (huSCF). In some embodiments, the humanized immunodeficient mouse model further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the humanized immunodeficient mouse model is for Il2rg null The allele is homozygous for Prkdc null The allele is homozygous for H2-K null The allele is homozygous for H2-D null The allele is homozygous for H2-A null The allele is homozygous and for Kit null The allele is homozygous. In some embodiments, the humanized immunodeficient mouse has been transplanted with HSC. In some embodiments, the humanized immunodeficient mouse has been transplanted with PBMC. In some embodiments, the humanized immunodeficient mouse has been transplanted with human umbilical cord blood cells (e.g., unfractionated human UCB cells).

[0165] In some embodiments, the humanized immunodeficient mouse model of the present disclosure comprises: Il2rg tm1Wjl Allele; Prkdc scid Allele; H2-K1 tm1BpeAllele; H2-D1 tm1Bpe Allele; H2-Ab1 em1Mvw Allele; Kit W-41J alleles; exogenous nucleic acid encoding huIL7; exogenous nucleic acid encoding huIL15, exogenous nucleic acid encoding huIL3, exogenous nucleic acid encoding huGM-CSF; and exogenous nucleic acid encoding huSCF. In some embodiments, the humanized immunodeficient mouse model is for Il2rg tm1Wjl Alleles are homozygous; for Prkdc scid Alleles are homozygous; for H2-K1 tm1Bpe Alleles are homozygous; for H2-D1 tm1Bpe Alleles are homozygous; for H2-Ab1 em1Mvw The allele is homozygous; and for Kit W-41J The allele is homozygous. In some embodiments, the humanized immunodeficient mouse has been transplanted with HSC. In some embodiments, the humanized immunodeficient mouse has been transplanted with PBMC. In some embodiments, the humanized immunodeficient mouse has been transplanted with human umbilical cord blood cells (e.g., unfractionated human UCB cells).

[0166] In some embodiments, the humanized immunodeficient mouse model of the present disclosure comprises: Il2rg tm1Sug Allele; Prkdc scid Allele; H2-K1 tm1Bpe Allele; H2-D1 tm1Bpe Allele; H2-Ab1 em1Mvw Allele; Kit W-41J alleles; exogenous nucleic acid encoding huIL7; exogenous nucleic acid encoding huIL15, exogenous nucleic acid encoding huIL3, exogenous nucleic acid encoding huGM-CSF; and exogenous nucleic acid encoding huSCF. In some embodiments, the humanized immunodeficient mouse model is for Il2rg tm1Sug Alleles are homozygous; for Prkdc scid Alleles are homozygous; for H2-K1 tm1Bpe Alleles are homozygous; for H2-D1 tm1Bpe Alleles are homozygous; for H2-Ab1 em1Mvw The allele is homozygous; and for Kit W-41J The allele is homozygous. In some embodiments, the humanized immunodeficient mouse has been transplanted with HSCs. In some embodiments, the humanized immunodeficient mouse has been transplanted with PBMCs. In some embodiments, the humanized immunodeficient mouse has been transplanted with human umbilical cord blood cells.

[0167] Kit-deficient immunodeficient mice expressing human IL3, human GM-CSF, and human SCF transgenes

[0168] In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises: an endogenous Kit allele containing a disabling mutation (Kit null ); exogenous nucleic acid encoding huIL3; exogenous nucleic acid encoding huGM-CS; and exogenous nucleic acid encoding huSCF. In some embodiments, the genome of the mouse further comprises an endogenous Il2rg allele containing a disabling mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele containing a disabling mutation (Prkdc null In some embodiments, the genetic background of the mouse is NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0169] In some embodiments, the immunodeficient mouse model has been transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse has been irradiated. In some embodiments, the methods of the present disclosure comprise administering human cells to the mouse. In some embodiments, the methods further comprise irradiating the mouse prior to transplanting the human cells.

[0170] human cells

[0171] "Humanized" mice are immunodeficient mice transplanted with human cells. "Transplantation" refers to the process in which human cells migrate to an existing target tissue in the body and integrate into it. The transplanted human cells are then implanted into immunodeficient mice with a functional human immune system. Most commonly, human cells, such as hematopoietic stem cells (HSCs) or peripheral blood mononuclear cells (PBMCs), are "fractionated" or "separated"—separated from other cell types and subcellular components (e.g., by centrifugation)—before being used for humanization. Fractionation involves treating a human cell colony to enrich the colony for one or more specific cell types. This treatment may involve exhausting one or more specific cell types of the colony. The fractionated human HSC and PBMC colonies develop into various human immune cell types. HSCs develop into dendritic cells, lymphocytes (including T cells, natural killer cells, and B cells), and bone marrow cells (including macrophages, granulocytes, platelets, and red blood cells) through a process called hematopoiesis. PBMCs primarily develop into lymphocytes. In some embodiments, human HSCs are administered to an immunodeficient mouse model provided herein to humanize the mouse model. In some embodiments, human PBMCs are administered to the immunodeficient mouse models provided herein to humanize the mouse models.

[0172] Typically, human HSC and human PBMC are obtained from human umbilical cord blood. Human umbilical cord blood is usually fractionated to separate HSC and / or PBMC from other cell types and subcellular components. The fractionation of blood results in the removal of more mature immune cells such as T cells that cause graft-versus-host reactions. However, fractionation requires the cost of increasing time, energy, and preclinical evaluation, and can damage cells. This can reduce the survival and proliferation rate of human immune cell colonies, thereby endangering the successful transplantation of immunodeficient mice.

[0173] Surprisingly, the inventors have found that for the immunodeficient mouse models provided herein, fractionation of human umbilical cord blood is not required. In some embodiments, unfractionated human umbilical cord blood can be administered to immunodeficient mice to promote engraftment of the human immune system. Due to the unique combination of alleles used to generate the immunodeficient mouse models provided herein, unfractionated human umbilical cord blood can be used without inducing a graft-versus-host reaction in mice, and in some embodiments, without conditioning the mice. "Unfractionated human umbilical cord blood" refers to human umbilical cord blood that has not been fractionated and therefore contains mature HLA-restricted T cells.

[0174] Thus, in some embodiments, prior to human cell implantation, for example, prior to administration (e.g., injection) of human cells, the immunodeficient mouse is not "conditioned." Conditioning refers to a group of treatments used to suppress the immune system and eliminate the stem cell niche prior to human cell transplantation. Conditioning typically includes myeloablative techniques such as irradiation and myeloablative chemotherapy (e.g., busulfan (1,4-butanediol dimethanesulfonic acid)). Thus, in some embodiments, the humanized immunodeficient mouse model provided herein is not conditioned. In some embodiments, the method for producing a humanized immunodeficient mouse model does not include a conditioning step.

[0175] In some embodiments, relative to control mice, the immunodeficient mice provided herein support the time length of human immune cell (for example, human T cell, human NK cell and / or human bone marrow cell) implantation to extend at least 25%.For example, relative to control mice, the immunodeficient mice provided herein support the time length of human immune cell (for example, human T cell, human NK cell and / or human bone marrow cell) implantation to extend at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%.In some embodiments, relative to control mice, the immunodeficient mice provided herein support the time length of human immune cell (for example, human T cell, human NK cell and / or human bone marrow cell) implantation to extend 25%-100%, 25%-75%, 25%-50%, 50%-100%, 50%-75% or 75%-100%.

[0176] In some embodiments, relative to control mice, in immunodeficient mice provided herein, the quantity of human immune cells (for example, human T cells, human NK cells and / or human bone marrow cells) transplanted increases by at least 25%.For example, relative to control mice, in immunodeficient mice provided herein, the quantity of human immune cells (for example, human T cells, human NK cells and / or human bone marrow cells) transplanted increases by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%. In some embodiments, the number of human immune cells (e.g., human T cells, human NK cells and / or human bone marrow cells) transplanted in the immunodeficient mice provided herein is increased by 25%-100%, 25%-75%, 25%-50%, 50%-100%, 50%-75% or 75%-100% relative to control mice.

[0177] In some embodiments, the cell death rate of the human immune cell (for example, human T cell, human NK cell and / or human bone marrow cell) transplanted in the immunodeficient mice provided herein is reduced by at least 25%.For example, relative to control mice, the cell death rate of the human immune cell (for example, human T cell, human NK cell and / or human bone marrow cell) transplanted in the immunodeficient mice provided herein is reduced by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%. In some embodiments, the cell death rate of human immune cells (e.g., human T cells, human NK cells and / or human bone marrow cells) transplanted in the immunodeficient mice provided herein is reduced by 25%-100%, 25%-75%, 25%-50%, 50%-100%, 50%-75% or 75%-100% relative to control mice.

[0178] In some embodiments, the cell proliferation rate of the human immune cell (for example, human T cell, human NK cell and / or human bone marrow cell) transplanted in the immunodeficient mice provided herein increases by at least 25%.For example, relative to control mice, the cell proliferation rate of the human immune cell (for example, human T cell, human NK cell and / or human bone marrow cell) transplanted in the immunodeficient mice provided herein can increase by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%. In some embodiments, the cell proliferation rate of human immune cells (e.g., human T cells, human NK cells and / or human bone marrow cells) transplanted in the immunodeficient mice provided herein is increased by 25%-100%, 25%-75%, 25%-50%, 50%-100%, 50%-75% or 75%-100% relative to control mice.

[0179] For example, the control mouse can be a non-immunodeficient and / or non-humanized mouse. In some embodiments, the control mouse is a NOD scid-γ mouse ( mice).

[0180] Methods for injecting immunodeficient mice with human cells to generate humanized mouse models include, but are not limited to, intraperitoneal or intravenous injection (Shultz et al., J Immunol, 2015, 174: 6477-6489; Pearson et al., Curr Protoc Immunol. 2008; 15-21; Kim et al., AIDS Res Hum Retrovirus, 2016, 32(2): 194-2020; Yaguchi et al., Cell & Mol Immunol, 2018, 15: 953-962). In some embodiments, mice are injected in the facial vein, heart, or liver.

[0181] In some embodiments, mice are injected with approximately 1×10 4 to about 1×10 10 For example, a mouse can be injected with approximately 1 × 10 4 to about 1×10 9 , about 1×10 4 to about 1×10 8 , about 1×10 4 to about 1×10 7 , about 1×10 4 to about 1×10 6 , about 1×10 4 to about 1×10 5 , about 1×10 5 to about 1×10 10 , about 1×10 5 to about 1×10 9 , about 1×10 5 to about 1×10 8 , about 1×10 5 to about 1×10 7 , 1×10 5 to about 1×10 6 , about 1×10 6 to about 1×10 10 , about 1×10 6 to about 1×10 9 , 1×10 6 to about 1×10 8 or about 1×10 6 to about 1×10 7 In some embodiments, mice are injected with approximately 1×10 4 , about 1×10 5 , about 1×10 6 , about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×1010 Individual human cells.

[0182] In some embodiments, human cells are prepared in a solution (e.g., a buffered solution). In some embodiments, the volume of the solution is about 50 μl to about 250 μl. For example, the volume of the solution can be about 50 μl, 60 μl, 70 μl, 80 μl, 90 μl, 100 μl, 110 μl, 120 μl, 130 μl, 140 μl, 150 μl, 160 μl, 170 μl, 180 μl, 190 μl, 200 μl, 210 μl, 220 μl, 230 μl, 240 μl, or 250 μl.

[0183] In some embodiments, the mouse is injected with about 50 μl to about 250 μl of human umbilical cord blood. For example, the solution can have a volume of about 50 μl, 60 μl, 70 μl, 80 μl, 90 μl, 100 μl, 110 μl, 120 μl, 130 μl, 140 μl, 150 μl, 160 μl, 170 μl, 180 μl, 190 μl, 200 μl, 210 μl, 220 μl, 230 μl, 240 μl, or 250 μl of human umbilical cord blood.

[0184] Nucleic Acids: Engineering and Delivery

[0185] In some embodiments, the nucleic acid provided herein is engineered (e.g., exogenous). Engineered nucleic acids are nucleic acids that do not exist in nature (e.g., at least two nucleotides covalently linked together, and in some cases, comprising a phosphodiester bond, referred to as a phosphodiester backbone). Engineered nucleic acids include recombinant nucleic acids and synthetic nucleic acids. Recombinant nucleic acids are molecules constructed by joining nucleic acids (e.g., isolated nucleic acids, synthetic nucleic acids, or a combination thereof) from two different organisms (e.g., humans and mice). Synthetic nucleic acids are molecules that are amplified or chemically synthesized or synthesized in other ways. Synthetic nucleic acids include those that are chemically modified or otherwise modified, but can be base-paired with naturally occurring nucleic acid molecules (combined therewith). Recombinant and synthetic nucleic acids also include those molecules obtained by any of the foregoing replications.

[0186] The engineered nucleic acid can comprise DNA (e.g., genomic DNA, cDNA, or a combination of genomic and cDNA), RNA, or a hybrid molecule, for example, wherein the nucleic acid comprises any combination of deoxyribonucleotides and ribonucleotides (e.g., artificial or natural), and any combination of two or more bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine.

[0187] In some embodiments, the nucleic acid is complementary DNA (cDNA).cDNA is synthesized from a single-stranded RNA (e.g., messenger RNA (mRNA) or microRNA (miRNA)) template in a reaction catalyzed by reverse transcriptase.

[0188] The engineered (e.g., exogenous) nucleic acids of the present disclosure can be generated using standard molecular biology methods (see, e.g., Green and Sambrook, Molecular Cloning, A Laboratory Manual, 2012, Cold Spring Harbor Press). In some embodiments, the engineered (e.g., exogenous) nucleic acids of the present disclosure are generated using GIBSON. Cloning to produce nucleic acids (see, eg, GIBSON, DG et al., Nature Methods, 343-345, 2009; and Gibson, DG et al., Nature Methods, 901-903, 2010, each of which is incorporated herein by reference). Typically, three enzyme activities are used in a single-tube reaction: a 5' exonuclease, a 3' extension activity of a DNA polymerase, and a DNA ligase activity. The 5' exonuclease activity cuts back the 5' end sequence and exposes a complementary sequence for annealing. The polymerase activity then fills the gap in the annealed domain. The DNA ligase then seals the nick and covalently links the DNA fragments together. The overlapping sequences of the adjacent fragments are much longer than those used in Golden Gate Assembly, and therefore result in a higher percentage of correct assembly. Other methods for producing engineered nucleic acids can be used in accordance with the present disclosure.

[0189] Gene is a unique nucleotide sequence, and its order determines the order of monomers in polynucleotides or polypeptides.Gene usually encodes proteins.Gene can be endogenous (naturally present in host organisms) or exogenous (naturally or by genetic engineering transfer to host organisms).Allele is one of two or more optional forms of genes found at the same locus on chromosome produced by mutation.In some embodiments, gene includes promoter sequence, coding region (for example, exon), non-coding region (for example, intron) and regulatory region (also referred to as regulatory sequence).

[0190] Mice containing human genes are considered to contain human transgenes. A transgene is a gene that is foreign to the host organism. In other words, a transgene is a gene that is transferred into the host organism naturally or through genetic engineering. The transgene does not occur naturally in the host organism (the organism containing the transgene, e.g., a mouse).

[0191] A promoter is a nucleotide sequence (e.g., ATG) to which RNA polymerase binds to initiate transcription. A promoter is typically located directly upstream (5' end) of the transcription start site. In some embodiments, a promoter is an endogenous promoter. An endogenous promoter is a promoter naturally occurring in the host animal.

[0192] An open reading frame is a continuous stretch of codons that begins with a start codon (e.g., ATG) and ends with a stop codon (e.g., TAA, TAG, or TGA) and encodes a polypeptide, such as a protein. An open reading frame is operably linked to a promoter if the promoter regulates the transcription of the open reading frame.

[0193] Exons are regions of a gene that code for amino acids. Introns (and other non-coding DNA) are regions of a gene that do not code for amino acids.

[0194] In some embodiments, the nucleotide sequence of coding product (for example, protein) has a length of 200 base pairs (bp) to 100 kilobases (kb). In some embodiments, the nucleotide sequence has a length of at least 10kb. For example, the nucleotide sequence can have a length of at least 15kb, at least 20kb, at least 25kb, at least 30kb or at least 35kb. In some embodiments, the length of the nucleotide sequence is 10 to 100kb, 10 to 75kb, 10 to 50kb, 10 to 30kb, 20 to 100kb, 20 to 75kb, 20 to 50kb, 20 to 30kb, 30 to 100kb, 30 to 75kb or 30 to 50kb.

[0195] Any nucleic acid provided herein can have a length of 200bp to 500kb, 200bp to 250kb or 200bp to 100kb. In some embodiments, the length of nucleic acid is at least 10kb. For example, nucleic acid can have a length of at least 15kb, at least 20kb, at least 25kb, at least 30kb, at least 35kb, at least 50kb, at least 100kb, at least 200kb, at least 300kb, at least 400kb or at least 500kb. In some embodiments, the length of nucleic acid is 10 to 500kb, 20 to 400kb, 10 to 300kb, 10 to 200kb or 10 to 100kb. In some embodiments, the length of the nucleic acid is 10 to 100 kb, 10 to 75 kb, 10 to 50 kb, 10 to 30 kb, 20 to 100 kb, 20 to 75 kb, 20 to 50 kb, 20 to 30 kb, 30 to 100 kb, 30 to 75 kb, or 30 to 50 kb. The nucleic acid can be circular or linear.

[0196] In some embodiments, nucleic acid as described herein comprises modification. With respect to nucleic acid, modification is any operation on nucleic acid relative to corresponding wild-type nucleic acid (e.g., naturally occurring nucleic acid). Therefore, genomic modification is any operation on nucleic acid in genome (e.g., in coding region, non-coding region and / or regulatory region) relative to corresponding wild-type nucleic acid in genome (e.g., naturally occurring (unmodified) nucleic acid). Non-limiting examples of nucleic acid (e.g., genomic) modification include deletion, insertion, "deletion insertion (indel)" (deletion and insertion) and substitution (e.g., point mutation). In some embodiments, deletion, insertion, deletion insertion or other modification in gene leads to frameshift mutation so that gene no longer encodes functional product (e.g., protein). Modification also includes chemical modification, e.g., chemical modification of at least one core base. Methods of nucleic acid modification, e.g., those methods leading to gene inactivation are known, and include but are not limited to, RNA interference, chemical modification and gene editing (e.g., using recombinase or other programmable nuclease systems, e.g., CRISPR / Cas, TALENs and / or ZFNs).

[0197] As is known in the art, a disabling mutation results in a gene product with little or no function. A disabling mutation results in a gene product with no detectable / measurable function.

[0198] Nucleic acid can be modified, such as one or more allelotrope of gene, so that it does not produce the functional gene product (for example, functional protein) of detectable level.Therefore, null allelotrope is the allelotrope that does not produce the functional gene product (for example, functional protein) of detectable level.The detectable level of protein is any protein level that uses standard protein detection analysis (such as flow cytometry and / or ELISA) to detect.In some embodiments, null allelotrope is not transcribed.In some embodiments, null allelotrope does not encode functional protein.

[0199] The carrier that is used to deliver nucleic acid comprises minicircle, plasmid, bacterial artificial chromosome (BAC) and yeast artificial chromosome.However, it should be understood that carrier may not be needed.For example, cyclization or linearization nucleic acid can be delivered to embryo without carrier backbone.Carrier backbone is very little (~4kb), and the scope of donor DNA to be cyclized can be, for example,>100bp to 50kb.

[0200] Methods for delivering nucleic acids to mouse embryos (e.g., mice) to generate transgenic mice include, but are not limited to, electroporation (see, e.g., Wang W et al., J Genet Genomics 2016; 43(5):319-27; WO 2016 / 054032; and WO 2017 / 124086, each of which is incorporated herein by reference), DNA microinjection (see, e.g., Gordon and Ruddle, Science 1981;214:1244-124, incorporated herein by reference), embryonic stem cell-mediated gene transfer (see, e.g., Gossler et al., Proc. Natl. Acad. Sci. 1986;83:9065-9069, incorporated herein by reference), and retrovirus-mediated gene transfer (see, e.g., Jaenisch, Proc. Natl. Acad. Sci. 1976;73:1260-1264, incorporated herein by reference), any of which can be used as provided herein.

[0201] Genome editing methods

[0202] The present application contemplates the use of, for example, a variety of gene editing techniques utilizing engineered nucleic acids to knock out target endogenous genes (e.g., Il2rg, Prkdc, H2-K, H2-D, H2-A, and / or Kit) or to introduce nucleic acids into the mouse genome (e.g., to generate transgenic mice expressing human IL7, human IL15, human IL3, human GM-CSF, and / or human SCF). The immunodeficient mice described herein can be generated by any gene editing technique known in the art.

[0203] For example, any suitable method can be used to introduce engineered nucleic acids, such as guide RNA, donor polynucleotides and other nucleic acid coding sequences into the genome of an embryo or cell (e.g., stem cell). The application contemplates the use of a variety of gene editing techniques, for example, nucleic acids are deleted from the genome of an embryo or cell to produce knockout mice, or nucleic acids are introduced into the genome of an embryo or cell to produce transgenic mice. Non-limiting examples include systems based on programmable nucleases, such as clustered regularly interspaced short palindromic repeats (CRISPR) systems, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). See, for example, Carroll D Genetics.2011; 188 (4): 773-782; Joung JK et al. Nat Rev Mol Cell Biol.2013; 14 (1): 49-55; and Gaj T et al. Trends Biotechnol.2013 Jul; 31 (7): 397-405, each of which is incorporated herein by reference.

[0204] In some embodiments, the CRISPR system is used to edit the genome of a mouse (e.g., a mouse embryo) provided herein. See, for example, Harms DW et al., Curr Protoc Hum Genet.2014; 83: 15.7.1-15.7.27; and Inui M et al., Sci Rep.2014; 4: 5396, each of which is incorporated herein by reference. For example, Cas9 mRNA or protein, one or more guide RNAs (gRNAs) and / or donor nucleic acids can be delivered directly (e.g., injected or electroporated) to a mouse embryo at a single cell (fertilized egg) stage or a subsequent stage to promote homology-directed repair (HDR), e.g., deleting a nucleic acid sequence from the genome or introducing an engineered nucleic acid (e.g., a donor nucleic acid) into the genome.

[0205] The CRISPR / Cas system is a naturally occurring defense mechanism in prokaryotes that is redirected to act as a DNA targeting platform for the guidance of RNA for gene editing. The engineered CRISPR system comprises two main components: guide RNA (gRNA) and CRISPR-associated nucleases (e.g., Cas proteins). gRNA is a short synthetic RNA that consists of a scaffold sequence for nuclease binding and a user-defined nucleotide spacer (e.g., about 15-25 nucleotides, or about 20 nucleotides) that defines the genomic target to be modified (e.g., gene). Therefore, people can change the genomic target of Cas proteins by simply changing the target sequence present in gRNA. In some embodiments, Cas9 endonucleases are from Streptococcus pyogenes (NGG PAM) or Staphylococcus aureus (NNGRRT or NNGRR (N) PAM), although as provided herein, other Cas9 homologues, straight homologues and / or variants (e.g., evolutionary versions of Cas9) can be used. Other non-limiting examples of RNA-guided nucleases that can be used as provided herein include Cpf1 (TTN PAM); SpCas9 D1135E variant (NGG (reduced NAG binding) PAM); SpCas9 VRER variant (NGCG PAM); SpCas9 EQR variant (NGAG PAM); SpCas9 VQR variant (NGAN or NGNG PAM); Neisseria meningitidis (NM) Cas9 (NNNNGATT PAM); Streptococcus thermophilus (ST) Cas9 (NNAGAAW PAM); and Treponema denticola (TD) Cas9 (NAAAAC). In some embodiments, the CRISPR-associated nuclease is selected from Cas9, Cpf1, C2c1, and C2c3. In some embodiments, the Cas nuclease is Cas9.

[0206] The guide RNA comprises at least a spacer sequence that hybridizes (binds) to a target nucleic acid sequence and a CRISPR repeat sequence that binds an endonuclease and guides the endonuclease to the target nucleic acid sequence. As will be appreciated by one of ordinary skill in the art, each gRNA is designed to comprise a spacer sequence that is complementary to its genomic target sequence. See, e.g., Jinek et al., Science, 2012; 337: 816-821 and Deltcheva et al., Nature, 2011; 471: 602-607, each of which is incorporated herein by reference.

[0207] In some embodiments, the RNA-guided nuclease and gRNA are complexed to form a ribonucleoprotein (RNP) prior to delivery to the embryo.

[0208] The concentration of the RNA-guided nuclease or nucleic acid encoding the RNA-guided nuclease can vary. In some embodiments, the concentration is 100 ng / μl to 1000 ng / μl. For example, the concentration can be 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 ng / μl. In some embodiments, the concentration is 100 ng / μl to 500 ng / μl or 200 ng / μl to 500 ng / μl.

[0209] The concentration of the gRNA can also vary. In some embodiments, the concentration is 200 ng / μl to 2000 ng / μl. For example, the concentration can be 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 ng / μl. In some embodiments, the concentration is 500 ng / μl to 1000 ng / μl. In some embodiments, the concentration is 100 ng / μl to 1000 ng / μl. For example, the concentration can be 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 ng / μl.

[0210] In some embodiments, the ratio of the concentration of RNA-guided nuclease or nucleic acid encoding the RNA-guided nuclease to the concentration of gRNA is 2: 1. In other embodiments, the ratio of the concentration of RNA-guided nuclease or nucleic acid encoding the RNA-guided nuclease to the concentration of gRNA is 1:1.

[0211] Donor nucleic acid generally includes the sequence of interest flanked by homology arms.Homology arms are regions homologous to the genomic DNA regions positioned in the genomic locus in ssDNA.One homology arm is positioned at the left (5') side (left homology arm) of the target genomic region (sequence of interest is introduced therein), and another homology arm is positioned at the right (3') side (right homology arm) of the target genomic region.These homology arms make it possible to carry out homologous recombination between ssDNA donor and genomic locus, thereby causing the sequence of interest to be inserted into the target genomic locus (for example, by homology-directed repair (HDR) mediated by CRISPR / Cas9-).

[0212] In some embodiments, the length of a homology arm is 20 to 200, 20 to 300, 20 to 400, 20 to 500, 20 to 600, 20 to 700, 20 to 800 or 20 to 900 nucleotide bases. In some embodiments, the length of a homology arm is 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 nucleotide bases. In some embodiments, the length of a homology arm is different from the length of another homology arm. In some embodiments, the donor DNA is single-stranded. In some embodiments, the donor DNA is double-stranded. In some embodiments, the donor DNA is modified by phosphorothioate. Other modifications can be made.

[0213] How to use

[0214] A key hurdle in translating human cell therapies into the clinic is the need for robust preclinical animal models for evaluating the efficacy, safety, and importantly, immunogenicity of human cell therapies, such as human stem cell-based and immune cell-based therapies. Because cell therapy products are human-derived, testing these products in vivo using other species is challenging due to potential xenograft reactions. One approach to evaluating cell therapy products without exposing patients to risks is to use humanized mice—immunodeficient mice transplanted with functional human cells, tissues, and immune systems. Humanized mice can provide a much-needed preclinical bridge for evaluating the safety, efficacy, and immunogenicity of cell products derived from human stem cells.

[0215] Therefore, in some embodiments, the humanized immunodeficient mouse model of the present disclosure can be used to evaluate the clinical efficacy of cell therapy products. Non-limiting examples of cell therapy products include cellular immunotherapy, cancer vaccines, and other types of autologous and allogeneic cells for certain therapeutic indications, including hematopoietic stem cells and adult and embryonic stem cells. Cell therapy refers to the transfer of autologous or allogeneic cell material into a patient for medical purposes. The mouse model provided herein, which is intended to replicate the human immune system, can be used to evaluate such cell therapies.

[0216] Thus, in some embodiments, the methods provided herein comprise administering a cell therapy product to a humanized immunodeficient mouse as described herein.

[0217] In some embodiments, the humanized immunodeficient mice are transplanted with HSCs. In some embodiments, the humanized immunodeficient mice are transplanted with PBMCs. In some embodiments, the humanized immunodeficient mice are transplanted with human umbilical cord blood cells.

[0218] The method can further include evaluating one or more clinically relevant characteristics of the cell therapy product or one or more clinically relevant effects on the transplanted human immune system. Clinically relevant characteristics can include, for example, reduced tumor growth or resolution of infection.

[0219] In some embodiments, the cell therapy product is designed to treat cancer (e.g., alleviate one or more symptoms of cancer). Non-limiting examples of human cancers include: adenoid cystic carcinoma, adrenal tumors, amyloidosis, anal cancer, appendix cancer, astrocytoma, ataxia telangiectasia, Beckwith-Wiedeman syndrome, bile duct cancer, Birt-Hogg-Dube syndrome, bladder cancer, bone cancer, brainstem glioma, brain cancer, breast cancer, Carney syndrome, cervical cancer, colorectal cancer, Cowden syndrome, craniopharyngioma, desmoid tumor, desmoplastic infantile ganglionectomy Gastrointestinal stromal tumors (GISTs), germ cell tumors, gestational trophoblastic disease, head and neck cancer, hereditary breast and ovarian cancer, hereditary diffuse gastric cancer, hereditary leiomyomatosis and renal cell carcinoma, hereditary mixed polyposis syndrome, hereditary pancreatitis, hereditary papillary renal cell carcinoma, HIV / AIDS-related cancers, and juvenile polyposis syndrome. , kidney cancer, lacrimal gland tumors, laryngeal and hypopharyngeal cancer, leukemia, Li-Fraumeni syndrome, liver cancer, lung cancer, lymphoma, Lynch syndrome, mastocytosis, medulloblastoma, melanoma, meningioma, mesothelioma, multiple endocrine neoplasia type 1, multiple endocrine neoplasia type 2, multiple myeloma, MUTYH-associated polyposis, myelodysplastic syndrome, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, gastrointestinal neuroendocrine tumors, lung neuroendocrine tumors, pancreatic neuroendocrine tumors, 1 Neurofibromatosis type 1, neurofibromatosis type 2, nevoid basal cell carcinoma syndrome, mouth and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, Peutz-Jeghers syndrome, pheochromocytoma and paraganglioma, pituitary adenoma, pleuropulmonary blastoma, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, non-melanoma skin cancer, small intestine cancer, stomach cancer, testicular cancer, thymoma and thymic cancer, thyroid cancer, tuberous sclerosis complex, uterine cancer, vaginal cancer, Von Hippel-Lindau syndrome, vulvar cancer, Waldenstrom macroglobulinemia, Werner syndrome, Wilms tumor, and xeroderma pigmentosum.

[0220] In some embodiments, the cell therapy product is designed to treat an autoimmune disease.

[0221] In some embodiments, the cell therapy product is designed to treat a genetic disease.

[0222] There are several types of cell therapy products that can be tested using the humanized immunodeficient mouse model of the present disclosure. In some embodiments, the cell therapy product is a stem cell-based cell therapy product. In some embodiments, the cell therapy product is a non-stem cell-based cell therapy product. In some embodiments, the cell therapy product is an adoptive cell therapy (ACT) product. In some embodiments, the cell therapy product is a scaffold-based or scaffold-free cell therapy product. In some embodiments, the cell therapy product is a bone marrow aspirate (BMA)-derived cell therapy product. The present disclosure also contemplates testing of non-cellular therapies, for example, with multicellular components. See, for example, El-Hakim El-Kadiry A et al., Front.Med., November 22, 2021, Gene and Cell Therapy, which is incorporated herein by reference.

[0223] In some embodiments, humanized immunodeficiency mouse model of the present disclosure can be used for studying the disease relevant to the human immune system.The disease relevant to the human immune system is to have at least in part due to human immune cells or the pathophysiological disease or illness affected by it.The non-limiting examples of the disease relevant to the human immune system of the humanized immunodeficiency mouse model research provided herein include: muscle disorder (for example, muscular dystrophy, myopathy, etc.), autoimmune disorder (for example, rheumatoid arthritis, Crohn's disease, ulcerative colitis, lupus or any other autoimmune disease or illness provided herein), cancer (for example, melanoma, leukemia, lymphoma or any other cancer provided herein), metabolic disorder (for example, diabetes, obesity, etc.). In some embodiments, the disease relevant to the human immune system of the research may include applying the potential treatment for the disease to the humanized immunodeficiency mouse model, and characterizing the effect of potential treatment.Potential treatment can be cell therapy products, protein (for example, antibody, peptide, etc.), small molecule or any other potential treatment known in the art. Characterizing the effect of a potential treatment can be, for example, measuring the levels of a protein associated with the disease (e.g., a biomarker) in a sample from the mice, imaging the mice to study disease progression, measuring survival following a potential treatment, or any other method known in the art for characterizing a disease.

[0224] In some embodiments, the humanized immunodeficient mouse model of the present disclosure can be used to study muscular dystrophy. Muscular dystrophy is a genetic disease characterized by muscle weakness and wasting with or without neurological involvement. Non-limiting examples of muscular dystrophy include: Becker type, congenital, Duchenne type, distal type, Emery-Dreifuss type, facioscapulohumeral type (FSHD), limb-girdle type, myotonic type, and oculopharyngeal type. In some embodiments, the humanized immunodeficient mouse model of the present disclosure can be used to study FSHD type muscular dystrophy.

[0225] Treatment

[0226] Treatment modalities are different approaches and strategies used to treat various diseases and health conditions in a subject. Herein, the terms "subject," "patient," and "individual" are used interchangeably. In some embodiments, the subject is a human subject. Other animal subjects are also contemplated herein. Some of the most common treatments include drug therapy, which involves the use of drugs to treat the disease and control symptoms. Other treatment modalities include gene therapy and immunotherapy, which use genetic manipulation and the immune system, respectively, to treat diseases such as cancer and genetic disorders. There are many treatment modalities available, and the choice of treatment depends on the patient's condition, medical history, and the expertise of the healthcare provider.

[0227] In some embodiments, treatment is a targeted therapy. Targeted therapy is a type of treatment that uses drugs or other substances to more accurately identify and attack cells than standard therapy. For example, unlike chemotherapy that can affect healthy cells as well as cancer cells, targeted therapy is designed to interfere with the specific molecules or pathways involved in cancer cell growth and survival. Targeted therapy is based on the principle that diseased cells typically have certain genetic or molecular abnormalities (which distinguish them from normal cells). By targeting these specific abnormalities, targeted therapy can be more effective and less toxic than conventional therapies (such as chemotherapy). Non-limiting examples of targeted therapy include drugs that block the activity of specific enzymes or growth factor receptors, and immunotherapies that stimulate the immune system to identify and attack diseased cells.

[0228] In some embodiments, the mouse models provided herein are used to test the effects of therapeutic modalities. Non-limiting examples of therapeutic modalities that can be used as provided herein include antibodies, small molecule drugs, gene therapy, cell therapy, vaccines, hormones, enzyme replacement therapy, and nucleic acid-based therapies.

[0229] Antibodies are proteins produced by the immune system that can specifically recognize and bind to foreign substances (such as viruses and bacteria) and help neutralize or eliminate them from the body. Antibodies can also be designed and produced in the laboratory and used as therapeutic agents to target specific proteins or cells in the body. The therapeutic antibodies used herein can be full-length antibodies or antibody fragments. Antibody fragments are smaller fragments of full-length antibodies with antigen binding ability. Some of the most commonly used antibody fragments include Fab (fragment antigen binding) fragments, F(ab')2 (fragment antigen binding dimer) fragments, single-chain variable fragments (scFv), nanobodies, bispecific antibodies, diabodies, triabodies and domain antibodies (dAbs). Fab fragments are the variable regions of antibodies that contain antigen binding sites. Fab fragments can be produced by enzymatic cleavage of antibody molecules and are often used in, for example, diagnostic applications. F(ab')2 fragments are Fab fragments that are joined together by disulfide bonds, thereby producing fragments that can simultaneously bind to two antigen molecules. Single-chain variable fragments are recombinant antibody fragments that include the variable regions of the heavy and light chains of antibodies connected by a short linker peptide. For example, single-chain variable fragments can be produced in bacteria or yeast and are often used to target tumors or other disease-associated antigens. Nanobodies are single-domain antibody fragments derived from camelid or shark antibodies that have a small size and high stability. For example, nanobodies can be produced by genetic engineering. Bispecific antibodies are antibodies that can bind to two different antigens simultaneously. Bispecific antibodies can be produced by fusing two different Fab or scFv fragments together or by engineering a single antibody molecule to contain two different antigen-binding sites. Diabodies are artificially engineered antibodies consisting of two different single-chain variable fragments (scFv) joined together. Diabodies have a small size and can bind to two different antigens simultaneously. Triabodies are artificially engineered antibodies consisting of three different single-chain variable fragments (scFv) joined together. Triabodies have a small size and can bind to three different antigens simultaneously. Domain antibodies are antibody fragments consisting of a single variable domain of an antibody that can be produced in bacteria or yeast. dAbs have a small size and high stability.

[0230] Small molecule drugs are low molecular weight (e.g., less than 10 kDa) compounds that can bind to specific proteins in the body and alter their activity. For example, small molecule drugs are commonly used to treat diseases such as cancer, hypertension, and diabetes.

[0231] Gene therapy involves the delivery of genetic material (such as DNA or RNA) to cells in the body to, for example, correct a genetic defect or alter cell function.

[0232] For example, cell therapy involves the transplantation or modification of cells within the body to replace damaged or diseased cells or tissues. Non-limiting examples of cell therapy include stem cell therapy, CAR T cell therapy, gene editing using CRISPR / Cas9, mesenchymal stem cell therapy, retinal pigment epithelial cell therapy, natural killer cell therapy, tumor infiltrating lymphocyte therapy, dendritic cell therapy, umbilical cord blood stem cell therapy, and tissue engineering.

[0233] Vaccines are biological agents that stimulate the immune system to produce a protective immune response against a specific infectious agent, such as a virus or bacteria. There are several types of vaccines, each using a different approach to stimulate the immune response. Some of the most common vaccine types include inactivated vaccines, live attenuated vaccines, subunit vaccines, recombinant and conjugate vaccines, mRNA vaccines, viral vector vaccines, and DNA vaccines.

[0234] Hormones are chemical messengers produced by the endocrine system that regulate various physiological functions in the body. Hormones are used as therapeutic agents to treat various diseases, such as diabetes, thyroid disorders, and growth hormone deficiency.

[0235] Enzyme replacement therapy involves administering enzymes to replace or supplement deficient or missing enzymes in the body.

[0236] Nucleic acid-based therapy involves delivering nucleic acids (such as DNA or RNA) to cells in the body to change gene expression or cell function. Nucleic acid-based therapy includes antisense oligonucleotide therapy and RNA interference therapy. RNA interference (RNAi) therapy is a gene therapy that involves using small RNA molecules to silence or "knock down" the expression of specific genes in the body. Examples of RNAi molecule types include short interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), ribozymes, aptamers, antisense RNA and CRISPR RNA (crRNA). Short interfering RNA is a double-stranded RNA molecule with a length of generally 21-23 nucleotides. siRNA molecules are used to silence specific genes by targeting the mRNA of a specific gene for degradation. MicroRNA is a small single-stranded RNA molecule with a length of generally 20-24 nucleotides. MiRNA molecules regulate the expression of multiple genes by targeting the mRNA of multiple genes for degradation or translation inhibition. Short hairpin RNA is a single-stranded RNA molecule with a length of generally 19-29 nucleotides, and folds itself to form a hairpin structure. shRNA molecules are used to silence specific genes by targeting their mRNA for degradation. Ribozymes are RNA molecules that have enzymatic activity and can cut specific RNA molecules (including mRNA). Aptamers are RNA molecules that can bind to specific targets (such as proteins or other molecules) with high affinity and specificity. Antisense RNA is a single-stranded RNA molecule that is complementary to a specific mRNA molecule. Antisense RNA molecules inhibit the translation of target mRNA by forming double-stranded RNA molecules that are degraded by cells. CRISPR RNA is an RNA molecule that is part of the CRISPR-Cas9 system, which is a genome editing tool that can be used to delete or modify specific genes.

[0237] Route of administration

[0238] For example, cells (eg, human cells) and / or therapeutic modalities (or other substances / agents) of the disclosure can be administered to immunodeficient mice by systemic administration or by local administration.

[0239] In some embodiments, cells or treatments are administered by systemic administration. Systemic administration routes in mice involve methods of introducing drugs or treatments into the mouse body to achieve systemic distribution and desired effects. Intravenous (IV) injection is a commonly used route in mice and involves delivering the drug or treatment directly into a vein, such as the tail vein, lateral caudal vein, retroorbital sinus, or jugular vein. IV injection provides rapid and direct access to the systemic circulation, thereby ensuring immediate distribution throughout the body. This route is suitable for substances that require rapid systemic action. Intraperitoneal (IP) injection involves delivering the drug or treatment into the peritoneal cavity of the mouse. The substance is absorbed through the peritoneum and enters the systemic circulation. This route provides widespread distribution of the drug in the peritoneal cavity and systemic circulation, making it suitable for drugs that require extensive contact with abdominal organs. Subcutaneous (SC) injection involves delivering the drug or treatment into the subcutaneous tissue, typically in the dorsal region or behind the neck of the mouse. The substance is absorbed into the systemic circulation through the capillaries of the subcutaneous tissue. SC injection allows a slow but continuous release of the drug into the systemic circulation, making it suitable for substances that require a longer duration of action. Intramuscular (IM) injection involves delivering the drug or treatment directly into the mouse's muscle tissue, such as the quadriceps or gastrocnemius muscles. The substance is absorbed through the capillaries within the muscle and enters the systemic circulation. Compared to other routes, IM injection allows for sustained release and a longer duration of action, making it suitable for substances that require a sustained effect. Oral gavage involves administering the drug or treatment directly into the stomach of the mouse using a feeding needle or oral gavage needle. This route is commonly used for substances that are orally bioavailable and stable in the gastrointestinal tract. Oral gavage allows for systemic distribution through absorption in the gastrointestinal tract, making it suitable for substances that can be administered orally. Inhalation involves administering the drug or treatment through inhalation of aerosolized substances. An inhalation chamber or specialized equipment is used to deliver the substance to the mouse's respiratory system. Inhalation allows for targeted delivery to the lungs and allows for systemic distribution through absorption in the respiratory tract. This route is suitable for substances that target the respiratory system or need to be delivered directly to the lungs.

[0240] In some embodiments, cells or treatments are administered by topical administration. The topical administration route for mice involves delivering drugs or treatments directly to specific target tissues or areas of interest in the mouse body. In contrast to systemic approaches intended for widespread distribution, these approaches focus on local delivery to obtain local effects. Various topical administration routes are commonly used to achieve specific research objectives in mice. Intradermal (ID) injection is a local approach for delivering drugs or treatments to the dermis (i.e., the skin layer directly beneath the epidermis). This approach is suitable for targeting the skin or for substances requiring local effects in skin tissue. Subcutaneous (SC) injections, traditionally associated with systemic administration, can also be used for topical administration in mice. By targeting a specific subcutaneous area or anatomical site, drugs or treatments can be directly delivered to the desired local area. Intramuscular (IM) injections are used as both systemic and topical administration routes. In the case of topical administration, drugs or treatments are injected directly into the muscle tissue of the specific site of interest. Intraperitoneal (IP) injections, primarily considered a systemic approach, can also be used for topical administration within the peritoneal cavity. By delivering drugs or treatments to the peritoneal cavity, local effects can be achieved in organs or tissues within the abdominal region. Intra-articular injection involves delivering a drug or treatment directly into the joint space. Intranasal administration requires delivering a drug or treatment through the nasal cavity. This local route allows for targeted effects in the nasal passages or the potential for targeting the central nervous system via the olfactory pathway. Topical administration involves applying a drug or treatment directly to the skin or mucous membranes. This local route allows for local effects on skin or mucosal surfaces (such as the eyes, ears, or genitals).

[0241] In some embodiments, cells and / or agents are administered in situ. In situ administration refers to delivering a drug or treatment directly to an anatomically correct or suitable location in the body, thereby simulating the natural or original location of the disease or condition being studied. In the case of animal studies, particularly in mice, in situ administration is intended to reproduce the physiological and anatomical characteristics of a specific organ or tissue to study disease progression, therapeutic response, or other related biological processes. In situ administration of mice involves various techniques targeting specific organs or tissues. A commonly used approach is orthotopic tumor implantation, in which tumor cells or tissues are injected or surgically placed directly into the corresponding anatomical site of interest. This method allows researchers to study tumor growth, metastasis, and therapeutic response in a manner that closely simulates the natural environment of the tumor. Another approach is organ-specific injection, in which a drug or treatment is delivered directly to a specific organ or tissue of interest. By injecting cells or other substances into organs such as the liver, lungs, brain, or other organs, researchers can study organ-specific effects, disease models, or therapeutic interventions. Orthotopic transplantation is another technique used in mice, involving surgical transfer or transplantation of tissues or cells into the anatomically correct location in the recipient mouse. This approach is often used in transplantation research to assess graft survival, integration, and function. In situ infusion or instillation involves introducing a substance directly into an organ or cavity via a catheter or needle. For example, instilling a drug into the bladder or bronchi can mimic the physiological conditions of urinary or respiratory diseases, allowing researchers to study local effects or therapeutic pathways.

[0242] In some embodiments, cells of the present disclosure (e.g., human cells) are administered to the mammary fat pads of immunodeficient mice. The mammary fat pads of the mouse model refer to the area of ​​specialized adipose (fat) tissue located within the mammary region of female mice. In female mice, mammary glands are located in pairs along the abdominal region. Each mammary gland is composed of multiple lobes and duct structures embedded in the surrounding mammary fat pads.

[0243] In some embodiments, cells of the present disclosure (e.g., human cells) are administered to the renal capsule of immunodeficient mice. The renal capsule of mice refers to the outer layer or covering that encapsulates the kidney. It is a fibrous layer composed of connective tissue that surrounds and protects the kidney, thereby providing structural support. The renal capsule acts as a barrier, thereby separating the kidney from surrounding tissues and organs. The renal capsule is often used in various procedures, including transplanting or implanting cells, tissues, or therapeutic modalities into the kidney. This may involve making an incision in the renal capsule to access the kidney and perform the desired operation.

[0244] Determination

[0245] In some embodiments, the method further comprises determining one or more effects of the treatment modality on the human cells.

[0246] In some embodiments, the assays include analyzing cell death (e.g., necrosis and / or apoptosis), inflammation, oxidative stress, changes in cell morphology, changes in cell function, accumulation of toxic substances, and changes in enzyme activity.

[0247] In some embodiments, the method includes measuring cell death, which can lead to tissue damage and dysfunction. Cell death assays are used to measure and quantify different forms of cell death, such as apoptosis, necrosis, and autophagy. These assays help understand the mechanism and extent of cell death in various biological processes. Several commonly used cell death assays include Annexin V / propidium iodide (PI) assays, TUNEL assays, caspase activity assays, LDH release assays, MTT assays, PI exclusion assays, and Assay. The Annexin V / PI assay distinguishes between early apoptosis and late apoptotic or necrotic cells. Annexin V, labeled with a fluorescent marker, binds to phosphatidylserine, a marker of early apoptosis. Propidium iodide (PI) stains cells with damaged cell membranes, indicating late apoptosis or necrosis. Flow cytometry is commonly used to analyze the distribution of stained cells. The TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) assay detects DNA fragmentation, a characteristic of apoptosis. It involves the use of modified nucleotides to label DNA chain breaks, which can be observed using a fluorescence microscope or flow cytometer. This assay allows quantification of apoptotic cells in a population. Caspase activity assays measure the activity of specific caspases (enzymes involved in apoptosis). Using fluorescent or colorimetric assay substrates, these assays detect the cleavage of substrates by active caspases, thereby generating a measurable signal. The activity of caspase-3, -8, or -9 can be measured, indicating activation of the apoptotic pathway. The LDH (lactate dehydrogenase) release assay measures the release of LDH (an enzyme) into the culture medium when cell membranes are damaged or disrupted, a characteristic of necrotic cell death. This assay uses a colorimetric or fluorometric assay to quantify the amount of LDH in the culture supernatant, indicating compromised membrane integrity and cell death. The MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay measures cell viability based on the ability of viable cells to reduce MTT (a yellow tetrazolium salt) to a purple formazan product. Formazan can be quantified spectrophotometrically, and a decrease in formazan production indicates decreased cell viability. The PI exclusion assay uses propidium iodide (PI), a DNA-intercalating fluorescent dye, to distinguish between viable and non-viable cells. PI cannot penetrate intact cell membranes, so it only stains cells with compromised membrane integrity, such as necrotic cells. Flow cytometry or fluorescence microscopy can be used to analyze the stained cells. The assay is a luminescent analysis utilizing a luminescent caspase substrate. Upon caspase cleavage, the substrate emits a light signal. These assays can be specific for different caspases, such as caspase-3 / 7 or caspase-8, thereby providing sensitive and quantitative measurements of caspase activity, indicating apoptotic cell death.

[0248] In some embodiments, the method includes measuring inflammation that can cause swelling, redness, and pain. Inflammation assays are widely used to study and measure the presence and extent of inflammation, a complex immune response that occurs in various tissues and organs. These assays help understand the underlying mechanisms of inflammation, identify potential therapeutic targets, and evaluate the efficacy of anti-inflammatory treatments. Several commonly used inflammation assays include cytokine analysis, cell migration assays, leukocyte adhesion assays, nitric oxide assays, myeloperoxidase assays, histological staining, reactive oxygen species analysis, and inflammatory gene expression analysis. Cytokine analysis is a key method for quantifying inflammation. This analysis involves measuring the levels of specific cytokines, such as interleukins (ILs), tumor necrosis factor-α (TNF-α), and interferons (IFNs), in biological samples using techniques such as ELISA, multiplex immunoassays, or protein arrays. By assessing cytokine profiles, one can gain insight into the inflammatory processes occurring in different tissues. Cell migration assays are used to study the migratory ability of immune cells (such as neutrophils or monocytes) in response to inflammatory stimuli. Transwell assays or scratch assays provide valuable information about immune cell migration and infiltration of inflamed tissues. Leukocyte adhesion assays focus on measuring the adhesion of leukocytes (white blood cells) to endothelial cells, a key step in the inflammatory response. By employing flow chamber analysis or static adhesion assays, the adhesion properties of leukocytes under inflammatory conditions can be assessed, thereby contributing to our understanding of leukocyte-endothelial cell interactions. Nitric oxide (NO) assays are used to measure the production of nitric oxide, a signaling molecule involved in inflammation. Griess reagent-based assays or fluorescent probes allow one to assess the level of nitric oxide, which is used as an indicator of inflammatory activity. Myeloperoxidase (MPO) assays are used to quantify the presence of neutrophils in tissues or the extent of inflammation. MPO is an enzyme released by activated neutrophils and macrophages during inflammation, and measuring MPO activity provides an understanding of the level of neutrophil infiltration and inflammatory activity. Histological staining techniques, such as hematoxylin and eosin (H&E) staining, play a vital role in visualizing and assessing inflammatory changes in tissue samples. Inflammatory responses can be identified and characterized by examining cellular and tissue changes, including immune cell infiltration, tissue damage, and edema. Reactive oxygen species (ROS) analysis detects the presence of reactive oxygen species produced during inflammation. Fluorescent probes, such as dichlorofluorescein diacetic acid (DCFDA), enable the measurement of ROS production in cells or tissues, indicating the presence and extent of inflammation. Inflammatory gene expression analysis involves quantifying the expression levels of specific inflammatory genes, including cytokines, chemokines, and adhesion molecules. Techniques such as quantitative real-time polymerase chain reaction (qPCR) or gene expression microarrays allow one to assess gene expression patterns, providing insights into the molecular aspects of the inflammatory response.

[0249] In some embodiments, the method includes measuring oxidative stress, which can damage cellular components and lead to tissue dysfunction. Oxidative stress analysis is a valuable tool for measuring and assessing the levels of reactive oxygen species (ROS) and oxidative damage in cells and tissues. These analyses provide insight into oxidative stress states, which are implicated in a variety of physiological and pathological conditions. Several commonly used oxidative stress assays include DCFDA analysis, NBT analysis, total antioxidant capacity analysis, lipid peroxidation analysis, protein carbonyl analysis, glutathione analysis, DNA oxidation analysis, and mitochondrial membrane potential analysis. DCFDA analysis is a widely used fluorescence assay for measuring intracellular ROS levels. The non-fluorescent probe DCFDA is oxidized by ROS to form the fluorescent compound dichlorofluorescein (DCF). The fluorescence intensity of DCF is proportional to the level of ROS in the cell and can be quantified using fluorescence microscopy or flow cytometry. The NBT assay detects superoxide anions (a type of ROS) by their ability to reduce NBT to form formazan crystals. The intensity of the resulting blue formazan precipitate is proportional to the level of superoxide anions produced. This analysis is commonly used in histochemical analysis to visualize and quantify superoxide production in tissues. Total antioxidant capacity analysis measures the total antioxidant capacity of biological samples, covering both enzymatic and non-enzymatic antioxidants. These analyses assess the ability of samples to scavenge free radicals or prevent oxidative damage. Methods such as Trolox equivalent antioxidant capacity (TEAC) analysis and ferric reducing antioxidant capacity (FRAP) analysis are used to determine total antioxidant capacity. Lipid peroxidation analysis assesses the level of lipid peroxidation products such as malondialdehyde (MDA) as an indicator of oxidative damage to lipids. Thiobarbituric acid reactive substances (TBARS) analysis or MDA analysis are commonly used to measure lipid peroxidation, which is a common consequence of oxidative stress. Protein carbonyl analysis detects the presence of carbonylated proteins, which are produced by protein oxidation due to oxidative stress. These analyses use 2,4-dinitrophenylhydrazine (DNPH) to derivatize carbonyl groups and quantify protein-bound DNPH, thereby providing a measure of protein oxidation using spectrophotometry. Glutathione assays assess levels of the reduced (GSH) and oxidized (GSSG) forms of glutathione, an important intracellular antioxidant. These assays, such as enzyme cycling assays or assays based on Ellman's reagent, provide insight into cellular antioxidant capacity and redox balance. DNA oxidation assays detect and quantify DNA damage caused by oxidative stress. Comet assays (single-cell gel electrophoresis) and 8-hydroxy-2'-deoxyguanosine (8-OHdG) assays are commonly used to assess DNA damage, including oxidized bases and DNA strand breaks caused by oxidative stress. Mitochondrial membrane potential assays measure changes in mitochondrial function caused by oxidative stress. Fluorescent dyes such as JC-1 or TMRE (tetramethylrhodamine ethyl ester) are used to assess changes in mitochondrial membrane potential using fluorescence microscopy or flow cytometry.

[0250] In some embodiments, the method includes analyzing changes in cell morphology, for example, changes in cell size, shape, and structure, which can lead to tissue dysfunction. Analyzing changes in cell morphology is a way to study cellular changes associated with various biological processes or pathological conditions. By examining the structural features and shape of cells, one can gain insight into cellular function, differentiation, disease progression, and response to treatment. Several commonly used methods enable the assessment of changes in cell morphology. Optical microscopy is a fundamental technique for visualizing and assessing cell morphology. Brightfield microscopy provides high-resolution images that allow one to examine overall cell shape, size, and features, such as organelles and cytoplasmic structure. Phase contrast microscopy and differential interference contrast (DIC) microscopy enhance contrast and improve visualization of cellular details, especially for transparent or unstained cells. Fluorescence microscopy utilizes fluorescent dyes or genetically encoded fluorescent proteins to label specific cellular components or structures. By targeting specific molecules, one can visualize and study changes in cell morphology, such as changes in cytoskeletal organization, organelle distribution, or nuclear morphology. Techniques like immunofluorescence staining and live cell imaging provide valuable information about cellular dynamics and structural changes. Electron microscopy (EM) provides high-resolution imaging of cellular structures at the ultrastructural level. Transmission electron microscopy (TEM) provides detailed views of organelles, membranes, and cytoplasmic components. Scanning electron microscopy (SEM) enables three-dimensional visualization of the cell surface and can reveal changes in cell shape, surface morphology, or the presence of cellular processes. Cytospin and cell smear techniques involve spreading cells on a glass slide, followed by fixation and staining. These methods allow one to examine cell morphology under a microscope and assess characteristics such as cell size, shape, nuclear characteristics, and the presence of cellular inclusions or abnormalities. Staining techniques such as Giemsa, Wright-Giemsa, or Papanicolaou staining can be used to enhance cellular detail and facilitate identification of specific cell types. High-content imaging combines automated microscopy with image analysis software to quantitatively assess changes in cell morphology and subcellular structure. This approach enables large-scale cellular phenotyping screens, measuring parameters such as cell shape, size, texture, or fluorescence intensity. High-content imaging is particularly useful for studying cellular responses to treatments, genetic perturbations, or disease-related processes. Advanced image analysis software tools can be used to quantify changes in cell morphology in microscopy images. These tools allow for the measurement of parameters such as cell area, perimeter, circularity, aspect ratio, and intensity distribution. By comparing these morphological parameters between different experimental conditions or cell populations, changes in cell shape or structure can be identified and quantified.

[0251] In some embodiments, the method includes analyzing changes in cellular function, which can lead to tissue dysfunction and organ failure. Analyzing changes in cellular function is crucial for understanding cellular processes, evaluating the effects of treatments or genetic modifications, and studying disease mechanisms. A variety of techniques and assays can be used to assess changes in cellular function. These methods provide valuable insights into cell behavior, signaling pathways, metabolism, and overall cellular health. Enzyme activity assays measure the activity levels of specific enzymes involved in various cellular processes. By using specific substrates that undergo measurable changes upon enzymatic reactions, one can assess changes in metabolic pathways, signal transduction, or other enzymatic processes. Calcium imaging techniques enable monitoring of intracellular calcium levels, which plays a key role in cell signaling and the regulation of various cellular functions. Fluorescence microscopy using calcium-sensitive dyes allows assessment of changes in calcium dynamics, providing insight into processes such as neuronal signaling, muscle contraction, or cellular communication. Electrophysiological techniques, such as patch clamp recordings, measure the electrical activity of cells. These techniques assess changes in membrane potential, ion channel activity, action potentials, synaptic transmission, or other electrical properties of cells. Electrophysiology is widely used in neuroscience and cardiac research to study cellular excitability and function. Metabolic analysis measures various aspects of cellular metabolism, such as glucose uptake, ATP production, or oxygen consumption. By utilizing specific substrates or indicators, these analyses allow one to quantify changes in cellular energy metabolism or metabolic pathways. Cell proliferation and viability assays assess changes in cell growth, division, or survival. Techniques such as the MTT assay, cell counting, or live / dead staining provide quantitative or qualitative measurements of changes in cell proliferation or viability in response to treatment, genetic changes, or environmental conditions. Analyzing cell signaling pathways reveals changes in cellular responses or signaling cascades. Techniques such as Western blotting, immunofluorescence staining, or ELISA can be used to analyze protein expression, phosphorylation levels, or the activation state of specific signaling molecules. These methods elucidate changes in signaling pathways involved in processes such as cell growth, differentiation, or immune responses. Functional imaging techniques, such as fMRI or PET, are used to study changes in cellular function in living organisms or tissues. These non-invasive imaging methods provide insight into functional changes in organs, tissues, or specific cell types and are often used in neuroscience, cardiovascular research, or oncology. Flow cytometry allows for the simultaneous analysis of multiple cellular parameters. By using fluorescently labeled antibodies or dyes, flow cytometry assesses changes in cell surface markers, intracellular protein expression, cell cycle distribution, or apoptosis. It provides quantitative information on changes in various cellular functions within complex cell populations.

[0252] In some embodiments, the method includes analyzing the accumulation of toxic substances that can cause tissue damage and dysfunction. Analyzing the accumulation of toxic substances is necessary for studying the effects of various chemicals, pollutants, or drugs on cells and organisms. These analyses provide valuable insights into toxicological mechanisms, potential side effects of substances, and the efficacy of detoxification or protective interventions. Several commonly used methods enable the assessment of the accumulation of toxic substances. Analytical techniques such as HPLC (high performance liquid chromatography) and GC-MS (gas chromatography-mass spectrometry) allow the identification and quantification of toxic substances. HPLC separates and quantifies a wide range of compounds, thereby providing information about their accumulation levels. GC-MS combines gas chromatography and mass spectrometry to detect and characterize toxic substances, particularly volatile or semi-volatile compounds, based on their mass-to-charge ratio. Fluorescence spectroscopy measures the fluorescence emission of a sample when excited with a specific wavelength. By using fluorescent probes or dyes, fluorescence spectroscopy can assess the accumulation of toxic substances by monitoring changes in fluorescence intensity or emission spectra. These probes selectively bind to or react with specific toxic compounds, thereby providing a direct readout of their accumulation. Enzyme activity analysis assesses changes in enzyme function caused by toxic substances. These assays use specific substrates and indicators to measure enzyme activity, providing insights into the effects of toxic substances on cellular processes. Some toxic compounds can interfere with cellular enzymes, inhibiting their activity or causing aberrant enzymatic reactions. Immunohistochemistry and immunofluorescence techniques use specific antibodies to detect and visualize the accumulation of toxic substances in tissues or cells. By targeting specific antigens or epitopes associated with the toxic compound, these techniques allow for the spatial identification and localization of accumulated toxic substances. Cell-based assays utilize specific fluorescent dyes or probes to assess the accumulation of toxic substances in cultured cells. These assays employ fluorescence microscopy or flow cytometry to quantify the accumulation of toxic compounds, providing insight into their cellular uptake, distribution, and metabolism. Tissue analysis can be used to study the accumulation of toxic substances in vivo. Tissue analysis involves extracting and quantifying toxic compounds from organs or biological fluids, enabling assessment of their accumulation levels and distribution patterns in different tissues or body compartments. Indirect assays target specific physiological or biochemical changes induced by the toxic substance. Assays that measure markers of oxidative stress, DNA damage, or metabolic alterations can indirectly infer the presence and accumulation of toxic compounds. These changes serve as indicators of the effects of the toxic substance on cells or organisms.

[0253] In some embodiments, the method includes analyzing changes in enzyme activity that can lead to tissue dysfunction and organ failure. Analyzing changes in enzyme activity can be used to study enzymatic processes, assess the impact of various factors on enzyme function, and identify potential disease-related alterations. Several commonly used methods allow for the quantitative measurement of enzyme catalytic activity and the detection of changes in its function. Spectrophotometric assays quantify enzyme activity by measuring absorbance or color changes. These assays typically involve enzymatic reactions that produce or consume specific substrates, resulting in changes in light absorption. By monitoring absorbance or color intensity, the rate of enzyme activity can be determined. Examples include the use of substrates such as NADH or NADPH, which exhibit changes in absorbance during enzymatic reactions. Fluorometric assays rely on the detection of fluorescence emitted by substrates or products of enzymatic reactions. Fluorescent molecules can be designed to specifically interact with certain enzymes, producing a fluorescent signal based on enzyme activity. By measuring fluorescence intensity, enzyme activity can be quantified. Fluorometric assays are highly sensitive and are often used in high-throughput screening. Radiometric assays involve the use of radioactive isotopes to track enzymatic reactions. Radioactive substrates or cofactors are used in enzymatic reactions, and techniques such as liquid scintillation counting are used to measure the radioactivity of the reaction products. These analyses offer high sensitivity, but require special precautions due to the use of radioactive materials. Enzyme-linked immunosorbent assays (ELISAs) exploit the specificity of antibodies to detect and quantify enzyme activity. In these analyses, enzymes are coupled to antibodies or antigens, and their activity is measured by detecting the enzyme reaction products. ELISAs are widely used for the quantification of various enzymes or enzyme activities in biological samples. Gel electrophoresis techniques, such as zymography or native gel electrophoresis, are used to assess changes in enzyme activity based on the mobility of the enzyme in a gel matrix. Enzymes are separated according to their size, charge, or activity, and subsequent staining or activity-based detection methods reveal changes in enzyme activity. Kinetic analyses measure the rate of an enzyme-catalyzed reaction under varying substrate concentrations or reaction conditions. These analyses determine key kinetic parameters, such as the Michaelis-Menten constant (Km) and maximum reaction velocity (Vmax), providing insights into enzyme-substrate interactions and the effects of various factors on enzyme activity. Common kinetic analyses include Lineweaver-Burk plots and steady-state kinetic analyses. Mass spectrometry can be used to quantify enzyme activity by measuring the consumption or production of metabolites involved in an enzymatic reaction. Isotopically labeled substrates or reactants can be introduced, and changes in the isotope ratio are detected using mass spectrometry. This approach allows for precise measurement of enzyme activity and can be applied to complex enzymatic pathways. Activity-based probes are small molecules that react selectively with active enzyme sites. These probes covalently modify active enzymes, allowing their subsequent detection or isolation. Activity-based probes provide a powerful approach for profiling enzyme activity in complex biological systems.

[0254] In some embodiments, the method comprises analyzing for increased survival. In some embodiments, the method comprises analyzing for improved symptoms. In some embodiments, the method comprises analyzing for improved overall health.

[0255] Other aspects

[0256] Additional aspects of the disclosure are provided in the following numbered paragraphs.

[0257] 1. An immunodeficient mouse comprising:

[0258] An endogenous H2-K allele containing a disabling mutation, an endogenous H2-D allele containing a disabling mutation, an endogenous H2-A allele containing a disabling mutation, and an exogenous nucleic acid selected from a nucleic acid encoding human interleukin 7 (huIL7) and a nucleic acid encoding human interleukin 15 (huIL15).

[0259] 2. The immunodeficient mouse of paragraph 1, comprising a nucleic acid encoding huIL7 and a nucleic acid encoding huIL15.

[0260] 3. The immunodeficient mouse of paragraph 1, wherein the endogenous H2-K1 allele containing the disabling mutation is H2-K1 tm1Bpe allele.

[0261] 4. The immunodeficient mouse of paragraph 1, wherein the endogenous H2-D allele containing the disabling mutation is H2-D1 tm1Bpe allele.

[0262] 5. The immunodeficient mouse of paragraph 1, wherein the endogenous H2-A allele containing the disabling mutation is H2-Ab1 em1Mvw allele.

[0263] 6. The immunodeficient mouse of any of the preceding paragraphs, further comprising an endogenous interleukin-2 receptor gamma (Il2rg) allele containing a disabling mutation.

[0264] 7. The immunodeficient mouse of paragraph 6, wherein the endogenous Il2rg allele containing the disabling mutation is Il2rg tm1Wjl allele.

[0265] 8. The immunodeficient mouse of paragraph 6, wherein the endogenous Il2rg allele containing the disabling mutation is Il2rg tm1Sug allele.

[0266] 9. The immunodeficient mouse of any of the preceding paragraphs, further comprising an endogenous protein kinase, DNA-activated catalytic subunit (Prkdc) allele containing a disabling mutation.

[0267] 10. The immunodeficient mouse of paragraph 9, wherein the mutation is a severe combined immunodeficiency (scid) mutation.

[0268] 11. The immunodeficient mouse of paragraph 10, wherein the endogenous Prkdc allele containing the disabling mutation is Prkdc scid allele.

[0269] 12. The immunodeficient mouse of any of the preceding paragraphs, further comprising an endogenous recombination activator gene 1 (Rag1) allele containing a disabling mutation.

[0270] 13. The immunodeficient mouse of paragraph 12, wherein the endogenous Rag1 allele containing the disabling mutation is Rag1 tm1Mom allele.

[0271] 14. The immunodeficient mouse of any of the preceding paragraphs, further comprising an endogenous recombination activator gene 2 (Rag2) allele containing a disabling mutation.

[0272] 15. The immunodeficient mouse of paragraph 14, wherein the endogenous Rag2 allele containing the disabling mutation is Rag2 tm1Fwa allele.

[0273] 16. The immunodeficient mouse of any one of the preceding paragraphs, wherein the immunodeficient mouse has a non-obese diabetic (NOD) background.

[0274] 17. The immunodeficient mouse of paragraph 16, wherein the immunodeficient mouse has a NOD scidγ background.

[0275] 18. The immunodeficient mouse of paragraph 16 or 17, wherein the immunodeficient mouse has NSG-(K b D b ) null (IA null )Genetic background.

[0276] 19. The immunodeficient mouse of any of the preceding paragraphs, wherein the mouse further comprises an exogenous nucleic acid selected from a nucleic acid encoding human interleukin 3 (huIL3), a nucleic acid encoding human granulocyte / macrophage stimulating factor (huGM-CSF), and a nucleic acid encoding human Steel factor (huSCF).

[0277] 20. The immunodeficient mouse of paragraph 17, wherein the mouse further comprises a nucleic acid encoding huIL3, a nucleic acid encoding huGM-CSF, and a nucleic acid encoding huSCF.

[0278] 21. The immunodeficient mouse of any of the preceding paragraphs, wherein the immunodeficient mouse further comprises an endogenous Kit allele comprising a disabling mutation.

[0279] 22. The immunodeficient mouse of paragraph 21, wherein the endogenous Kit allele containing the disabling mutation is Kit W-41J .

[0280] 23. The immunodeficient mouse of any of the preceding paragraphs, wherein the mouse further comprises (or has been transplanted with) human cells.

[0281] 24. The immunodeficient mouse of paragraph 23, wherein the mouse further comprises (or has been transplanted with) unfractionated human umbilical cord blood comprising human cells.

[0282] 25. The immunodeficient mouse of paragraph 23 or 24, wherein the human cells comprise human hematopoietic stem cells.

[0283] 26. The immunodeficient mouse of any of paragraphs 23-25, wherein the human cells comprise human peripheral blood mononuclear cells.

[0284] 27. The immunodeficient mouse of the preceding paragraph, wherein the human cells are not enriched for CD34 + Human hematopoietic stem cells.

[0285] 28. The immunodeficient mouse of the preceding paragraph, wherein CD3 + Human T cells were not depleted from human cells.

[0286] 29. The immunodeficient mouse of any of the preceding paragraphs, wherein the mouse has not undergone myeloablation, optionally irradiation or chemomyeloablation.

[0287] 30. A method for producing a humanized mouse, the method comprising administering human cells to the immunodeficient mouse of any of paragraphs 1-22.

[0288] 31. The method of paragraph 30, wherein the method comprises administering unfractionated human umbilical cord blood comprising human cells.

[0289] 32. The method of paragraph 30 or 31, wherein the human cells comprise human hematopoietic stem cells.

[0290] 33. The method of any of paragraphs 30-32, wherein the human cells comprise human hematopoietic peripheral blood mononuclear cells.

[0291] 34. A method of producing an immunodeficient mouse as described in any of the preceding paragraphs, the method comprising breeding:

[0292] (i) a mouse comprising an endogenous Kit allele comprising a disabling mutation, an exogenous nucleic acid encoding human interleukin 3 (huIL3), an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF), and an exogenous nucleic acid encoding human Steel factor (huSCF); and

[0293] (ii) A mouse comprising an endogenous H2-K allele containing a disabling mutation, an endogenous H2-D allele containing a disabling mutation, an endogenous H2-A allele containing a disabling mutation, an exogenous nucleic acid encoding human interleukin 7 (huIL7), and an exogenous nucleic acid encoding human interleukin 15 (huIL15).

[0294] 35. The method of paragraph 34, wherein the immunodeficient mouse is homozygous for an endogenous Kit allele containing a disabling mutation.

[0295] 36. The method of paragraph 35 or 36, wherein the immunodeficient mouse is homozygous for an endogenous H2-K allele containing a disabling mutation, is homozygous for an endogenous H2-D allele containing a disabling mutation, and / or is homozygous for an endogenous H2-A allele containing a disabling mutation.

[0296] 37. A method comprising administering human cells to the immunodeficient mouse of any of the preceding paragraphs.

[0297] 38. The method of paragraph 37, wherein the method further comprises administering unfractionated human umbilical cord blood comprising human cells.

[0298] 39. The method of paragraph 37 or 38, wherein the human cells comprise human hematopoietic stem cells.

[0299] 40. The method of any of paragraphs 37-39, wherein the human cells comprise human peripheral blood mononuclear cells.

[0300] 41. The method of any of paragraphs 37-40, wherein the human cells are not enriched for CD34 + Human hematopoietic stem cells.

[0301] 42. The method of any one of paragraphs 37-41, wherein CD3 + Human T cells were not depleted from human cells.

[0302] 43. The method of any of paragraphs 37-42, wherein the method does not comprise myeloablating the immunodeficient mouse, optionally by irradiation or chemoablation.

[0303] 44. Mouse models with the genotypes / strains described in Table 1.

[0304] 45. The offspring mice of any of the matings described in Examples 1-5.

[0305] 46. ​​An immunodeficient non-obese diabetic (NOD) mouse comprising:

[0306] Endogenous Il2rg alleles containing disabling mutations;

[0307] Endogenous H2-K alleles containing disabling mutations;

[0308] Endogenous H2-D alleles containing disabling mutations;

[0309] Endogenous H2-A alleles containing disabling mutations;

[0310] Endogenous Kit alleles containing disabling mutations;

[0311] an exogenous nucleic acid encoding human interleukin 7 (huIL7);

[0312] an exogenous nucleic acid encoding human interleukin 15 (huIL15);

[0313] an exogenous nucleic acid encoding human interleukin 3 (huIL3);

[0314] an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF); and

[0315] Exogenous nucleic acid encoding human Steel Factor (huSCF).

[0316] 47. The immunodeficient mouse of paragraph 46, wherein the endogenous H2-K1 allele containing the disabling mutation is H2-K1 tm1Bpe allele.

[0317] 48. The immunodeficient mouse of paragraph 46 or 47, wherein the endogenous H2-D allele containing the disabling mutation is H2-D1 tm1Bpe allele.

[0318] 49. The immunodeficient mouse of any one of the preceding paragraphs, wherein the endogenous H2-A allele containing the disabling mutation is H2-Ab1 em1Mvw allele.

[0319] 50. The immunodeficient mouse of any one of the preceding paragraphs, wherein the endogenous Il2rg allele containing the disabling mutation is Il2rg tm1Wjl allele.

[0320] 51. The immunodeficient mouse of any one of paragraphs 46-49, wherein the endogenous Il2rg allele containing the disabling mutation is Il2rg tm1Sug allele.

[0321] 52. The immunodeficient mouse of any of the preceding paragraphs, further comprising an endogenous Prkdc allele comprising a disabling mutation.

[0322] 53. The immunodeficient mouse of paragraph 52, wherein the disabling mutation in the endogenous Prkdc allele is a severe combined immunodeficiency (scid) mutation.

[0323] 54. The immunodeficient mouse of paragraph 53, wherein the endogenous Prkdc allele containing the disabling mutation is Prkdc scid allele.

[0324] 55. The immunodeficient mouse of any of the preceding paragraphs, further comprising an endogenous recombination activator gene 1 (Rag1) allele containing a disabling mutation.

[0325] 56. The immunodeficient mouse of paragraph 55, wherein the endogenous Rag1 allele containing the disabling mutation is Rag1 tm1Mom allele.

[0326] 57. The immunodeficient mouse of any of the preceding paragraphs, further comprising an endogenous recombination activator gene 2 (Rag2) allele containing a disabling mutation.

[0327] 58. The immunodeficient mouse of paragraph 12, wherein the endogenous Rag2 allele containing the disabling mutation is Rag2 tm1Fwa allele.

[0328] 59. The immunodeficient mouse of any one of the preceding paragraphs, wherein the immunodeficient mouse has a NODscidγ background.

[0329] 60. The immunodeficient mouse of paragraph 59, wherein the immunodeficient mouse has NSG-(K b D b ) null (IA null )Genetic background.

[0330] 61. The immunodeficient mouse of any of the preceding paragraphs, wherein the endogenous Kit allele containing the disabling mutation is Kit W-41J .

[0331] 62. The immunodeficient mouse of any one of the preceding paragraphs, wherein the mouse further comprises (or has been transplanted with) human cells.

[0332] 63. The immunodeficient mouse of paragraph 62, wherein the mouse further comprises (or has been transplanted with) unfractionated human umbilical cord blood comprising human cells.

[0333] 64. The immunodeficient mouse of paragraph 62 or 63, wherein the human cells comprise human hematopoietic stem cells.

[0334] 65. The immunodeficient mouse of any of paragraphs 62-64, wherein the human cells comprise human peripheral blood mononuclear cells.

[0335] 66. The immunodeficient mouse of any one of the preceding paragraphs, wherein the human cells are not enriched for CD34 + Human hematopoietic stem cells.

[0336] 67. The immunodeficient mouse of any one of the preceding paragraphs, wherein CD3 + Human T cells were not depleted from human cells.

[0337] 68. The immunodeficient mouse of any of the preceding paragraphs, wherein the mouse has not undergone myeloablation, optionally irradiation or chemomyeloablation.

[0338] 69. A method of producing a humanized mouse, the method comprising administering human cells to the immunodeficient mouse of any of paragraphs 46-61.

[0339] 70. The method of paragraph 69, wherein the method comprises administering unfractionated human umbilical cord blood comprising human cells.

[0340] 71. The method of paragraph 69 or 70, wherein the human cells comprise human hematopoietic stem cells.

[0341] 72. The method of any of paragraphs 69-71, wherein the human cells comprise human hematopoietic peripheral blood mononuclear cells.

[0342] 73. A method of producing the immunodeficient mouse of any of the preceding paragraphs, the method comprising breeding:

[0343] (i) a mouse comprising an endogenous Kit allele comprising a disabling mutation, an exogenous nucleic acid encoding human interleukin 3 (huIL3), an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF), and an exogenous nucleic acid encoding human Steel factor (huSCF); and

[0344] (ii) A mouse comprising an endogenous H2-K allele containing a disabling mutation, an endogenous H2-D allele containing a disabling mutation, an endogenous H2-A allele containing a disabling mutation, an exogenous nucleic acid encoding human interleukin 7 (huIL7), and an exogenous nucleic acid encoding human interleukin 15 (huIL15).

[0345] 74. The method of paragraph 73, wherein the immunodeficient mouse is homozygous for an endogenous Kit allele containing a disabling mutation.

[0346] 75. The method of paragraph 73 or 74, wherein the immunodeficient mouse is homozygous for an endogenous H2-K allele containing a disabling mutation, is homozygous for an endogenous H2-D allele containing a disabling mutation, and / or is homozygous for an endogenous H2-A allele containing a disabling mutation.

[0347] 76. A method comprising:

[0348] The human cells are administered to the immunodeficient mouse of any of the preceding paragraphs.

[0349] 77. The method of paragraph 76, wherein the method further comprises administering unfractionated human umbilical cord blood comprising human cells.

[0350] 78. The method of paragraph 76 or 77, wherein the human cells comprise human hematopoietic stem cells.

[0351] 79. The method of any of paragraphs 76-78, wherein the human cells comprise human peripheral blood mononuclear cells.

[0352] 80. The method of any of paragraphs 76-79, wherein the human cells are not enriched for CD34 + Human hematopoietic stem cells.

[0353] 81. The method of any one of paragraphs 76-80, wherein CD3 + Human T cells were not depleted from human cells.

[0354] 82. The method of any of paragraphs 76-81, wherein the method does not comprise myeloablating the immunodeficient mouse, optionally by irradiation or chemoablation. Example

[0355] Table 1. Mouse strains

[0356]

[0357]

[0358] Tg: transgenic / genetically modified

[0359] SGM3: transgene encoding human interleukin-3 (hui L3); transgene encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF); transgene encoding human stem cell factor (huSCF)

[0360] W41:Kit W-41J mutant allele

[0361] Table 1 Description of mouse strains:

[0362] Strain 1 Severe immunodeficient platform strains for all models used in this study – see RRID:IMSR_JAX:005557.

[0363] Line 2 (NSG-MHC DKO): lacks expression of major histocompatibility class I and class II genes and supports engraftment of human peripheral blood mononuclear cells (PBMCs) or unfractionated human umbilical cord blood without the development of acute xenogeneic graft-versus-host disease (GVHD) – see RRID:IMSR_JAX:025216.

[0364] Line 3 (NSG-Tg(Hu-IL7)): Provides expression of the human IL7 transgene, which contributes to the development and survival of T cells, NK cells, and other lymphocytes. This line was prepared using clone RP11-19N15 ordered from CHORI BACPAC. The only gene contained in the BAC is human IL7. The BAC is 164,110 bps in length. It is located at 79630616-79794725 on chromosome 8q21.12. The accession numbers are B85558 (positive strand) and AQ14183 (negative strand). It was grown in LB + chloramphenicol, and the DNA was purified using the Qiagen Large Construct kit. The product was sequenced before injection into NOD+ / scid embryos.

[0365] Three of the 84 potential founders were positive for the transgene. All were female. All mice were male. The mice were mated and had large litters. One of the strains was fixed as homozygous.

[0366] Line 4 (NSG-Tg(Hu-IL15)): Provides expression of human IL15, which supports the development and survival of human natural killer (NK) cells and also contributes to the survival of human T cells. This line was generated using a 200 kbp BACPAC obtained from Chori BACPAC. Pronuclear injection generates a male transgenic founder, who transmits the transgene to his offspring. NSG-Tg(Hu-IL15) mice produce physiological levels of human IL15 - see RRID:IMSR_JAX:030890.

[0367] Line 5 (NSG-Tg (Hu-IL7) (Hu-IL15)): This line dually expresses human IL7 and IL15.

[0368] Line 6 (NSG-Tg(SGM3)W41): CRISPR Cas9 was used to generate a G to A point mutation in the Kit gene of NSG mice, resulting in the W41 mutation. This line supports human HSC transplantation but requires irradiated recipients.

[0369] Strain 7 (NSG-MHC DKO Tg(Hu-IL15)): This strain expresses human IL15 in the absence of mouse class I and class II MHC.

[0370] Line 8 (NSG-Tg(Hu-IL15)Tg(Hu-SGM3)): This line expresses human IL15 as well as human stem cell factor, human IL3, and human GM-CSF.

[0371] Strain 9 (NSG-MHC DKO Tg (Hu-IL7)(Hu-IL15)): This strain expresses human IL7 and human IL15 in the absence of mouse class I and class II MHC.

[0372] Strain 10 (NSG-MHC DKO Tg(Hu-IL15)(SGM3)): This strain expresses human IL15 in the absence of mouse class I and class II MHC, as well as human stem cell factor, human IL3, and human GM-CSF.

[0373] Strain 11 (NSG-MHC DKO Tg(Hu-IL7)(Hu-IL15)(SGM3)W41): This strain expresses human IL7 and human IL15, as well as human stem cell factor, human IL3, and human GM-CSF, in the absence of mouse class I and class II MHC, and also expresses the W41 mutation.

[0374] Strain 12 (NSG-MHC DKO Tg(Hu-IL7)(Hu-IL15)(SGM3)): This strain expresses human IL7 and human IL15, as well as human stem cell factor, human IL3, and human GM-CSF in the absence of mouse class I and class II MHC.

[0375] Strain 13 (NSG-MHC DKO Tg(Hu-IL7)(SGM3)): This strain expresses human IL7 and human stem cell factor, human IL3, and human GM-CSF in the absence of mouse class I and class II MHC.

[0376] Line 14 (NSG-SGM3): This triple transgenic line expresses human IL3, GM-CSF (CSF2) and SCF (KITLG), cytokines that support stable engraftment of myeloid lineages and regulatory T cell populations, allowing superior engraftment of diverse hematopoietic lineages - see RRID:IMSR_JAX:013062.

[0377] use Mouse model strains 1-8 and strains 9-13 were generated by genetic crosses as described below. Mice generated from each of the crosses described below should be genotyped for each genotype by PCR, RT-PCR, or melting curve analysis where appropriate.

[0378] Example 1: Generation of NSG-MHC DKO Tg(Hu-IL7)(Hu-IL15) mice (strain 9)

[0379] Mating 1

[0380] NSG-Tg (Hu-IL7 / Hu-IL7) (Hu-IL15 / Hu-IL15) (strain 5)

[0381] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15) (strain 7)

[0382] 100% of offspring mice should be heterozygous for the MHC class I / II double knockout (MHC DKO), hemizygous for the human IL7 (Hu-IL7) transgene, and homozygous for the human IL-15 (Hu-IL15) transgene:

[0383] NSG-(+ / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(mating 1 offspring)

[0384] Mating 2

[0385] NSG-(+ / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(mating 1 offspring)

[0386] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15) (strain 7)

[0387] 25% of the offspring mice should be homozygous for MHC DKO, hemizygous for the Hu-IL-7 transgene, and homozygous for the Hu-IL-15 transgene:

[0388] NSG-(MHC DKO / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (mating 2 offspring)

[0389] Mating 3

[0390] NSG-(MHC DKO / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (mating 2 offspring)

[0391] X NSG-(MHC DKO / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (mating 2 offspring)

[0392] 12.5% ​​of the offspring mice should be homozygous for MHC DKO, hemizygous for the Hu-IL7 transgene, and homozygous for the Hu-IL15 transgene:

[0393] NSG-(MHC DKO / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (mating 3 offspring A)

[0394] 12.5% ​​of the offspring mice should be homozygous for MHC DKO, homozygous for the Hu-IL7 transgene, and homozygous for the Hu-IL15 transgene:

[0395] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(mating 3 offspring B)

[0396] Mating 4

[0397] NSG-(MHC DKO / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (mating 3 offspring A)

[0398] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (mating 3 offspring B)

[0399] 50% of the offspring mice should be homozygous for MHC DKO, homozygous for the Hu-IL7 transgene, and homozygous for the Hu-IL15 transgene:

[0400] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (mating 4 offspring)

[0401] Mating 5

[0402] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (mating 4 offspring)

[0403] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (mating 4 offspring)

[0404] The NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) progeny line was maintained by sib mating.

[0405] Example 2: Generation of NSG-MHC DKO Tg(Hu-IL15)(SGM3) (Line 10)

[0406] Mating 1

[0407] NSG-Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Strain 8)

[0408] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15) (strain 7)

[0409] 100% of the offspring mice should be heterozygous for MHC DKO, homozygous for the Hu-IL15 transgene, and hemizygous for the human SGM3 (SMG3) transgene:

[0410] NSG-(+ / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 1 offspring)

[0411] Mating 2

[0412] NSG-(+ / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 1 offspring)

[0413] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15) (strain 7)

[0414] 25% of the offspring mice should be homozygous for MHC DKO, homozygous for the Hu-IL15 transgene, and hemizygous for the human SGM3 (SMG3) transgene:

[0415] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 2 offspring)

[0416] Mating 3

[0417] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 2 offspring)

[0418] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 2 offspring)

[0419] 25% of the offspring mice should be homozygous for MHC DKO, homozygous for the Hu-IL15 transgene, and homozygous for the human SGM3 (SMG3) transgene:

[0420] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 3 offspring A)

[0421] 50% of the offspring mice should be heterozygous for MHC DKO, homozygous for the Hu-IL15 transgene, and hemizygous for the human SGM3 (SMG3) transgene:

[0422] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 3 offspring B)

[0423] Mating 4

[0424] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 3 offspring A)

[0425] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 3 offspring B)

[0426] 50% of the offspring mice should be homozygous for MHC DKO, homozygous for the Hu-IL15 transgene, and homozygous for the human SGM3 (SMG3) transgene:

[0427] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (mating 4 offspring)

[0428] Mating 5

[0429] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (mating 4 offspring)

[0430] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (mating 4 offspring)

[0431] The NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) progeny line was maintained by sib mating.

[0432] Example 3: Generation of NSG-MHC DKO W41 Tg(Hu-IL15)(Hu-IL7)(SGM3)(Strain 11)

[0433] Mating 1

[0434] NSG-(+ / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (1 offspring from 9 females of the strain)

[0435] X NSG-(W41 / W41)Tg(SGM3 / SGM3) (line 6 male)

[0436] 25% of the offspring mice should be heterozygous for MHC DKO and heterozygous for Kit W-41J Heterozygous for the mutant (W41) allele, hemizygous for the Hu-IL7 transgene, hemizygous for the Hu-IL15 transgene, and hemizygous for the SGM3 transgene:

[0437] NSG-(+ / MHC DKO)(+ / W41)Tg(+ / Hu-IL7)(+ / Hu-IL15)(+ / SGM3)(mating 1 offspring)

[0438] Mating 2

[0439] NSG-(+ / MHC DKO)(+ / W41)Tg(+ / Hu-IL7)(+ / Hu-IL15)(+ / SGM3)(mating 1 offspring)

[0440] X NSG-(MHC DKO / MHC DKO)Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Strain 10)

[0441] 3.125% of offspring mice should be homozygous for MHC DKO and for Kit W-41J Heterozygous for the mutant (W41) allele, hemizygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene:

[0442] NSG-(MHC DKO / MHC DKO)(+ / W41)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 2 offspring)

[0443] Mating 3

[0444] NSG-(MHC DKO / MHC DKO)(+ / W41)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 2 offspring)

[0445] X

[0446] NSG-(MHC DKO / MHC DKO)(+ / W41)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 2 offspring)

[0447] 12.5% ​​of offspring mice should be homozygous for MHC DKO and for Kit W-41J Heterozygous for the mutant (W41) allele, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene:

[0448] NSG-(MHC DKO / MHC DKO)(+ / W41)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 3 offspring A)

[0449] 12.5% ​​of the offspring mice should be:

[0450] NSG-(MHC DKO / MHC DKO)(W41 / W41)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 3 offspring B)

[0451] Mating 4

[0452] NSG-(MHC DKO / MHC DKO)(+ / W41)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 3 offspring A)

[0453] X

[0454] NSG-(MHC DKO / MHC DKO)(W41 / W41)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 3 offspring B)

[0455] 25% of the offspring mice should be homozygous for MHC DKO and 25% for Kit W-41J Homozygous for the mutant (W41) allele, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene:

[0456] NSG-(MHC DKO / MHC DKO)(W41 / W41)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 4 offspring)

[0457] Mating 5

[0458] NSG-(MHC DKO / MHC DKO)(W41 / W41)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 4 offspring)

[0459] X

[0460] NSG-(MHC DKO / MHC DKO)(W41 / W41)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 4 offspring)

[0461] The NSG-(MHC DKO / MHC DKO)(W41 / W41)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) progeny line was maintained by sib mating.

[0462] Example 4: Generation of NSG-MHC DKO Tg(Hu-IL7)(Hu-IL15)(SGM3)(Strain 12)

[0463] Mating 1

[0464] NSG-Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Strain 8)

[0465] X NSG-(+ / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (9 lines mated with 1 offspring)

[0466] 25% of the offspring mice should be heterozygous for MHC DKO, hemizygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and hemizygous for the SGM3 transgene:

[0467] NSG-(+ / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 1 offspring)

[0468] Mating 2

[0469] NSG-(+ / MHC DKO)Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 1 offspring)

[0470] X NSG-Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(strain)

[0471] 12.5% ​​of the offspring mice should be heterozygous for MHC DKO, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and hemizygous for the SGM3 transgene:

[0472] NSG-(+ / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 2 offspring)

[0473] Mating 3

[0474] NSG-(+ / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 2 offspring)

[0475] X NSG-(+ / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3)(mating 2 offspring)

[0476] 12.5% ​​of the offspring mice should be heterozygous for MHC DKO, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene:

[0477] NSG-(+ / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 3 offspring)

[0478] Mating 4

[0479] NSG-(+ / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 3 offspring)

[0480] X NSG-(+ / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 3 offspring)

[0481] 25% of the offspring mice should be homozygous for MHC DKO, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene:

[0482] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 4 offspring)

[0483] Mating 5

[0484] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 4 offspring)

[0485] X

[0486] NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(mating 4 offspring)

[0487] NSG- The (MHC DKO / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) progeny line will be maintained by sib mating.

[0488] Example 5: Generation of NSG-MHC DKO Tg(Hu-IL7)(SGM3) (Line 13)

[0489] Mating 1

[0490] NSG-(+ / MHC DKO)(+ / W41)Tg(+ / Hu-IL7)(+ / Hu-IL15)(+ / SGM3)(1 offspring from 11 matings)

[0491] X NSG-(SGM3 / SGM3) (line 14)

[0492] 3. 125% of offspring mice should be heterozygous for MHC DKO, hemizygous for the Hu-IL7 transgene, and homozygous for the SGM3 transgene:

[0493] NSG-(+ / MHC DKO)Tg(+ / Hu-IL-7)(SGM3 / SGM3)(mating 1 offspring)

[0494] Mating 2

[0495] NSG-(+ / MHC DKO)Tg(+ / Hu-IL-7)(SGM3 / SGM3)(mating 1 offspring)

[0496] X NSG-(+ / MHC DKO)Tg(+ / Hu-IL-7)(SGM3 / SGM3)(mating 1 offspring)

[0497] 6.25% of offspring mice should be homozygous for MHC DKO, hemizygous for the Hu-IL7 transgene, and hemizygous for the SGM3 transgene:

[0498] NSG-(MHC DKO / MHC DKO)Tg(+ / Hu-IL7)(+ / SGM3)(mating 2 offspring A)

[0499] 3. 125% of offspring mice should be heterozygous for MHC DKO, homozygous for the Hu-IL7 transgene, and homozygous for the SGM3 transgene:

[0500] NSG-(+ / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3)(mating 2 offspring B)

[0501] Mating 3

[0502] NSG-(MHC DKO / MHC DKO)Tg(+ / Hu-IL7)(+ / SGM3)(mating 2 offspring A)

[0503] X NSG-(+ / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3)(mating 2 offspring B)

[0504] 50% 3.125% of the offspring mice should be homozygous for MHC DKO, homozygous for the Hu-IL7 transgene, and homozygous for the SGM3 transgene:

[0505] NSG-(MHC / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3) (mating 3 offspring)

[0506] Mating 4

[0507] NSG-(MHC / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3) (mating 3 offspring)

[0508] X NSG-(MHC / MHC DKO)Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3) (mating 3 offspring)

[0509] The NSG-(MHC DKO / MHC DKO)Tg(Hu-IL7 / HuIL7)(SGM3 / SGM3) progeny line was maintained by sib mating.

[0510] Example 6: Using NSG-SGM3-W41 mice to study the role of innate immunity in FSHD muscle pathology

[0511] Facioscapulohumeral muscular dystrophy (FSHD) disease progression is associated with muscle inflammation, although its role in FSHD muscle pathology is unclear. Facioscapulohumeral muscular dystrophy is a common epigenetic disease caused by genetic disruptions including contraction of the D4Z4 repeat at the 4qA locus or loss-of-function mutations in chromatin modifying genes, which lead to hypomethylation of the D4Z4 locus and misexpression of the germline transcription factor gene DUX4 (FSHD disease gene). DUX4 is encoded by the terminal D4Z4 repeat and functions normally during early germline development. Misexpression of DUX4 in muscle disrupts the muscle transcriptome through activation of a large set of germline-specific genes that are surrogate biomarkers of DUX4 expression, although their role in DUX4 muscle pathology is unknown.

[0512] DUX4 misexpression alone appears insufficient to explain FSHD muscle pathology. Although DUX4 misexpression leads to myotoxicity in patient muscle cells in vitro and in inducible mouse models in vivo, the onset of muscle pathology in FSHD patients is highly variable, including early onset and non-manifest disease. Clinical disease begins sporadically in the facial, scapular, and humeral muscles, which are often affected asymmetrically and involve most muscle groups over time. Finally, transient expression of DUX4 in transgenic zebrafish and mouse models leads to delayed muscle pathology, and transient DUX4 induction in human myoblast culture models produces H3.X and H3.Y histones that mark DUX4 target genes for delayed myotoxicity.

[0513] Our research focuses on the role of innate immunity as a modifier and amplifier of FSHD muscle pathology and disease progression. FSHD disease progression involves immune cell infiltration, followed by muscle turnover and replacement with fat and fibrosis, as demonstrated by transcriptomic and immunohistological analyses of muscle biopsies from patients and from a DUX4-induced mouse model. DUX4 misexpression inhibits nonsense-mediated decay (NMD), leading to the production of aberrantly spliced ​​RNA and abnormal proteins, predicted to trigger damage-associated molecular patterns (DAMPs) known to stimulate innate immune responses. A role for innate immunity in FSHD muscle pathology is also supported by high expression levels of complement genes in muscle biopsies and increased levels of complement C3 in the blood of FSHD patients.

[0514] To investigate the role of innate immunity in FSHD muscle pathology, we developed a novel humanized hematopoietic stem cell (HSC) / muscle transplantation mouse model, NSG-SGM3-W41. This mouse strain has been engineered to selectively expand human innate immune cell lineages following transplantation of umbilical cord blood (UCB)-derived hematopoietic stem cells (HSCs) without irradiation preconditioning. This allows for the co-transplantation of patient-derived FSHD (or unaffected control) muscle stem cells into the tibialis anterior (TA) muscle of mice to generate differentiated FSHD human muscle expressing the FSHD disease gene DUX4. Our findings demonstrate that in HSC-transplanted NSG-SGM3-W41 mice, FSHD muscle xenografts preferentially accumulate human macrophages and early B cells, express early complement RNAs encoding activators of both the classical and alternative pathways, and upregulate C3 RNA and protein, a mediator of the early complement response. FSHD muscle xenografts also undergo muscle renewal that is dependent on the specific HSC immune donor, supporting the concept that innate immunity directly contributes to FSHD pathology. Our results (i.e., that FSHD muscle xenografts do not express RNA encoding the complement membrane attack complex (MAC)) rule out a role for late complement in muscle turnover. Based on our findings, we hypothesize that C3 complement activated by the early complement pathway responds to FSHD muscle, produces DAMPs, and promotes muscle turnover by opsonizing FSHD muscle for macrophage recognition and phagocytosis.

[0515] Development of the NSG-SGM3-W41 Mouse Model of Human Innate Immunity

[0516] To investigate the role of the human innate immune system in FSHD muscle pathology, we developed a human CD34 + A mouse strain (NSG-SGM3-W41, line 6 above) was developed to co-implant and differentiate hematopoietic stem cells (HSCs) and human muscle stem cells isolated from muscle biopsies of FSHD and control patients. The NSG-SGM3-W41 mouse strain was first generated by crossing immunodeficient NSG-SGM3 mice expressing the human interleukin-3 gene (IL-3), human granulocyte / macrophage stimulating factor gene (GM-SCF), and human Steel factor gene (KITL) with NSG mice expressing the CRISPR Cas9 W41J point mutation of the Kit locus to achieve efficient multi-lineage engraftment of HSCs without irradiation.

[0517] Immune cell development was compared in NSG-SGM3 mice transplanted with or without 100 cGy irradiated HSC preconditioning and in non-irradiated NSG-SGM3-W41 mice. 5CD34+ HSCs were collected and blood samples from transplanted mice were analyzed for circulating human CD45+ immune cells by flow cytometry at 4, 6, 8, 10, and 12 weeks after HSC transplantation. Figure 1A , 8A-8C). The results are expressed as the percentage of human CD45+ blood cells ( Figure 1B Both irradiated NSG-SGM3 mice and non-irradiated NSG-SGM3-W41 mice showed 30-40% circulating human CD45+ hematopoietic cells 4 weeks after HSC injection, and this percentage increased to 70-80% at 12 weeks ( Figure 1B In contrast, non-irradiated NSG-SGM3 mice injected with HSCs had only 6% human CD45+ cells 4 weeks after HSC transplantation, and these cells increased to 48% at 12 weeks ( Figure 1B ), had significantly lower engraftment efficiency than irradiated NSG-SGM3 or non-irradiated NSG-SGM3-W41 mice at all time points.

[0518] The specific lineages of human immune cells generated in the blood of HSC-transplanted NSG-SGM3 mice (with or without 100 cGy irradiation pretreatment) and non-irradiated NSG-SGM3-W41 mice were compared using flow cytometry to determine the percentage of CD45+ cells co-expressing CD33 (myeloid cell marker), CD20 (B cell marker), and CD3 (T cell marker). Flow cytometric analysis was performed 4, 8, and 12 weeks after HSC engraftment ( Figures 1C-1E At 4 weeks, mice in all three groups were primarily colonized by CD33+ myeloid cells, with non-irradiated NSG-SGM3 having the lowest engraftment levels (average 32%) compared to irradiated NSG-SGM3 mice (50%) and NSG-SGM3-W41 mice (59%) ( Figure 1C ), while CD20+ B cells were very low and CD3+ T cells were absent. At 8 weeks after HSC injection, all three groups had low levels of CD33+ myeloid cells compared with 40% and 60% CD20+ B cells, and several animals in the irradiated NSG-SGM3 group and one animal in the NSG-SGM3-W41 group had low numbers of CD3+ T cells ( Figure 1D Twelve weeks after HSC injection, the blood of irradiated NSG-SGM3 mice had robust engraftment of CD33+ myeloid cells, CD20+ B cells, and CD3+ T cells; non-irradiated NSG-SGM3 mice showed predominantly CD20+ B cell engraftment; and NSG-SGM3-W41 mice showed robust engraftment of CD20+ B cells, intermediate levels of CD33+ myeloid cells, and low levels of CD3+ T cells ( Figure 1EThese data indicate that NSG-SGM3-W41 mice 8 weeks after HSC transplantation support robust development of myeloid and B cells and restrict T cell development, providing a model for co-transplantation of HSCs with muscle stem cells to study innate immune responses to FSHD muscle.

[0519] Transplantation of FSHD and control muscle stem cells in HSC-transplanted NSG-SGM3-W41 mice.

[0520] Next, we investigated whether HSC-transplanted NSG-SGM3-W41 mice support the engraftment and differentiation of muscle stem cells from patients with FSHD and unaffected controls. At 4 weeks, NSG-SGM3-W41 mice were transplanted with 10 HSCs from healthy UCB donors. 5 Two to three weeks after HSC transplantation, the hind limbs of HSC-transplanted mice were irradiated to block the growth of host mouse muscle stem cells, and the tibialis anterior (TA) muscle was then injured by barium chloride injection to destroy the mouse TA muscle fibers and establish a niche for the engraftment and differentiation of human muscle biopsy-derived stem cells ( Figure 2A Then, 10% of the muscle tissue isolated from muscle biopsies of three FSHD families (12, 15, and 17) was transplanted into barium chloride-injured TA muscles. 6 CD56+ muscle stem cells, including affected FSHD patients (12A, 15A, and 17A) and unaffected control first-degree relatives (12U, 15V, and 17U) ( Figure 2B FSHD cell lines with high (17A), medium (12A), and low (15A) DUX4 expression were selected for experiments to characterize the immune response to FSHD muscle ( Figure 2B ). Family 12 muscle stem cells (12A / 12U) were co-transplanted with one HSC donor into the TA muscle of mice. Family 15 (15A / 15V) muscle stem cells were co-transplanted with two different HSC donors (15D1 and 15D2), and family 17 muscle stem cells were transplanted into the TA muscle of mice transplanted with HSCs from four different donors (17D1, 17D2, 17D3, and 17D4). Figure 2C Three to four weeks after muscle stem cell transplantation, mice were euthanized, their spleens isolated to assess the development of human B cells, myeloid cells, and T cells, and their TA muscles processed for immunohistology or RNA expression analysis ( Figure 2A ).

[0521] HSC immune engraftment was assessed by flow cytometric analysis of splenocytes, measuring CD45+ hematopoietic lineage cells, CD45+ / CD20+ B cells, CD45+ / CD33+ myeloid cells, and CD45+ / CD3+ T cells. Mice transplanted with all combinations of HSC donors and muscle stem cell donors developed comparable levels of hematopoietic CD45+ cells ( Figure 2D ), B cells ( Figure 2E ) and bone marrow cells ( Figure 2F ). Representative flow cytometry gating strategies are as follows Figure 8A None of the HSC-transplanted mice generated CD45+ / CD3+ T cells, confirming that NSG-SGM3-W41 mice allow for the expansion of innate immune cell lineages, but not T cell lineages, over an 8-week period following HSC transplantation ( Figure 2G ). By flow cytometry of splenocytes ( Figure 8B ) and by immunohistology of TA muscle ( Figure 8C ) A small number of mice did not engraft HSCs based on undetectable CD45+ staining.

[0522] Accumulation of CD45+ innate immune cells is enhanced in FSHD xenograft muscle compared to control muscle

[0523] To investigate whether human innate immune cells preferentially infiltrate FSHD muscle xenografts, TA muscles were immunostained for human-specific CD45 to identify HSC-derived innate immune cells and Hoechst to identify all nuclei ( Figure 3A Although CD45+ immune cells were identified in both FSHD and control TA xenografts ( Figure 3A ), but in 6 of 7 immunized donors, CD45+ cells were significantly more abundant in FSHD than control muscle xenografts ( Figure 3B ), thus reflecting increased infiltration and / or expansion of human immune cells in FSHD xenografts. To determine whether human CD45+ cells were localized in transplanted human muscle, serial sections of TA muscle were immunostained for human CD45 to visualize human leukocytes or for human spectrin β1 to visualize human myofibers. CD45+ cells colocalized with spectrin β1+ myofibers in FSHD xenografts compared to control muscle ( Figure 4C ), providing evidence that immune cells have a trophic effect on FSHD muscle.

[0524] Human CD19+ B cells and CD68+ macrophages are more abundant in FSHD than control muscle xenografts

[0525] To characterize immune cell types in muscle xenografts, FSHD and control TA muscles were sectioned and stained with the B cell marker human CD19 (hCD19) ( Figure 4A ) and macrophage marker human CD68 (hCD68) ( Figure 4C ) were immunostained. Across all immunogenic donors analyzed, significantly higher numbers of human B cells and macrophages were present in FSHD compared to control muscle ( Figure 4B (A and D). 17D1 and 17D2 TA muscles were processed for IHC, and these tissue samples were not suitable for immunofluorescence analysis. These data suggest that FSHD muscle promotes the influx and / or expansion of macrophages and B cells.

[0526] Muscle turnover in FSHD xenografts is immune donor-dependent

[0527] To investigate whether human innate immune cells contribute to FSHD muscle renewal, TA muscle sections from FSHD and control xenografts were co-immunostained with human-specific antibodies against laminin A / C, which recognize human nuclei, and spectrin β1, which recognizes differentiated human myofibers from immunized donors 12, 15D1, 15D2, 17D3, and 17D4. Xenografts from cohorts 17D1 and 17D2 were processed for IHC but not immunofluorescence analysis. Laminin A / C+ nuclei and spectrin β1+ myofibers were detected in both FSHD and control TA muscle xenografts. Figure 5A Notably, FSHD xenografts from groups 15D1, 15D2, and 17D4 had significantly fewer spectrin β1+ myofibers than control xenografts ( Figure 5B ), indicating that FSHD muscles are being renewed, while FSHD and control xenografts from cohorts 12 and 17D3 maintained similar levels of spectrin β1+ myofibers, despite these FSHD muscles being infiltrated by immune cells (Figures 3 and 4). To confirm that co-transplantation of innate immune cells reduces proliferation capacity, the number of spectrin β1+ myofibers was compared between immune-transplanted mice and mice without a developed immune system in cohorts 12 and 15 ( Figures 5C-5D Significantly fewer spectrin β1+ myofibers were observed in immune-transplanted 12A and 15A muscle xenografts, whereas similar numbers of fibers were observed in 12U and 15V with or without immune transplantation, indicating that control muscles did not undergo renewal in response to their co-transplanted immune donors ( Figure 5D ).

[0528] Inflammatory responses to FSHD muscle are immune donor-dependent

[0529] To analyze the immune and muscle gene expression profiles of FSHD and control xenografts, we designed a custom NanoString RNA expression quantification panel containing human-specific probes for immune, muscle, and DUX4 target genes. This NanoString panel measures the expression of 204 inflammatory genes, three muscle genes (MYH8, MYL2, and MEF2C), and two DUX4 transcriptional target genes (LEUTX and MBD3L2). As described above, NanoString analysis of FSHD and control xenografts from three different FSHD families (12, 15, and 17) was performed in NSG-SGM3-W41 mice transplanted with seven different HSC immune donors. Figure 2C ).

[0530] To identify genes differentially expressed in FSHD versus control xenografts, NanoString counts for each mouse were log2 transformed before calculating the fold change in FSHD versus control expression for all genes in all seven HSC donors and averaged within each muscle donor and immune donor combination. In four of the seven HSC donor groups (15D1, 15D2, 17D2, and 17D4), muscle gene expression levels were significantly reduced by up to 200-fold (log2 fold change -8.37) ( Figure 6A ), providing evidence of differential turnover of FSHD muscle in these groups, as also observed in immunohistological assays of spectrin β1+ myofibers in FSHD xenografts from groups 15D1, 15D2, and 17D4 ( FIG5 ). In contrast, groups 12 and 17D3 had increased expression of muscle genes in FSHD relative to controls, suggesting a regenerative response of FSHD muscle in these xenografts ( Figure 6A). Differentially expressed human immune genes included early complement pathway genes in both the classical and alternative pathways, including C3, a key mediator of the complement response; C1R, C1S, C1QA, and C1QB, which constitute the C1 complex of the classical complement pathway that initiates complement activation through interaction with pathogens or DAMPs; C2 serine proteases; and CFB and CFD, which are unique to the alternative pathway and also respond to DAMPs (Figure 6). Their expression levels varied based on muscle group and HSC immune donor. 17D2 FSHD xenografts had low complement gene expression and high muscle turnover, but also accumulated macrophages and B cells, suggesting that 17D2 donor immune cells effectively targeted FSHD muscle for renewal (Figure 4). Notably, C3 expression trended higher in FSHD xenograft muscles from the three FSHD groups that responded to all seven immune donors. Expression of all human late complement RNAs, including C5-C9 encoding components of the membrane attack complex (MAC), was undetectable in both FSHD and control muscles. Furthermore, NSG-SGM3-W41 mice are deficient in the C5 complement component and are therefore unable to elicit a mouse host MAC response. In addition to complement genes, expression of several chemokines, including CXCL1, CXCL2, CXCL6, CXCL9, CXCL10, and CCL13, was also elevated in several cohorts of FSHD xenografts compared with controls.

[0531] Myofibers in FSHD xenografts show increased C3 deposition

[0532] Cryosections of human immune-muscle transplanted TA muscles were immunostained with a human-specific antibody against spectrin β1 to identify human muscle fibers and human-specific C3 to investigate the localization of human C3 relative to the humanized muscle region. Immunohistological analysis of cohorts 12, 15D1, 15D2, 17D3, and 17D4 showed abundant expression and localization of C3 in FSHD muscle fibers compared to control fibers ( Figure 7A ), supporting the NanoString RNA expression findings. Human C3 was detected only in the humanized regions of transplanted mouse TA muscle and localized on the surface and within FSHD myofibers, but also concentrated in the area surrounding the myofibers, where we hypothesized it to be enriched in human immune cells. We quantified the abundance of C3 puncta in spectrin β1+ human muscle fibers and found that in all analyzed groups, the FSHD transplanted sections had a significantly higher percentage of fibers containing greater than 10 C3 puncta ( Figure 7B The white arrows in the high-magnification FSHD image highlight a large number of spots ( Figure 7AUsing a mouse-specific C3 antibody, mouse C3 was not detected in the xenografts by immunohistology (data not shown). Taken together, these data indicate that both FSHD and control xenografts express human C3 and that FSHD xenografts have a greater percentage of myofibers that are highly decorated with C3.

[0533] Discussion and Conclusion

[0534] We have developed a humanized innate immune / muscle mouse model to investigate the role of the innate immune response to FSHD muscle. Our findings confirm that FSHD muscle xenografts from all three FSHD families generate an innate inflammatory response to the corresponding immune donor. FSHD xenografts elicited enhanced infiltration of macrophages and early B cells compared with control xenografts, suggesting that FSHD muscle trophically promotes and / or enhances the expansion of innate immune cells within FSHD xenografts. FSHD xenografts expressed human early complement RNA and human C3 RNA and protein as part of the innate immune inflammatory response to FSHD muscle, whereas expression of mouse C3 protein was undetectable. FSHD xenografts also underwent our hypothesized immune donor-dependent muscle turnover, as demonstrated by the differential muscle turnover responses of 17A FSHD xenografts to four different immune donors (Figure 6). Compared with donor 17D1, which promoted lower turnover, two of the four 17A immune donors (17D2 and 17D4) promoted extensive muscle turnover, and donor 17D3 promoted increased muscle gene expression, likely reflecting a regenerative response to muscle damage caused by resident muscle stem cells in the xenograft, as observed in FSHD muscle. Although no muscle turnover was observed in 17D3, macrophages and early B cells from 17D3 and 17D4 HSC donors preferentially accumulated in FSHD muscle xenografts and expressed elevated C3, indicating a robust inflammatory response. These HSC donor-dependent differences in FSHD muscle turnover may reflect quantitative differences in immune donor potency relative to the fixed endpoints of our analysis. Studies are underway to establish live animal imaging reporter muscle stem cell lines for establishing muscle xenografts. This will enable monitoring the dynamics of muscle turnover in individual muscle xenografts during differentiation and maturation in response to stem cells from different immune donors. Our data suggest that individual immune donors produce innate immune cells with varying immunoreactivity, which may mimic aspects of the variability in disease progression observed in FSHD patients and families with multiple affected members. Innate immune responses vary across the population, so the variability we observed in the immune responses of healthy immune donors to FSHD xenografts is expected. Future studies of immune donor variability in this model will address these possibilities.

[0535] Our innate immune muscle xenograft model establishes a role for innate immunity in FSHD muscle pathology, but the mechanisms by which FSHD muscle has a trophic effect on innate immune cells remain to be determined. Our working hypothesis is that FSHD muscle attracts macrophages and early B cells through DUX4-mediated production of DAMPs, which stimulate the production of complement factor C3 and early complement classical and alternative pathway convertases that process C3 to C3b. Through this mechanism, C3b binds and conditions FSHD muscle for recognition and renewal by macrophage phagocytosis. Current studies are focused on investigating the functions of DUX4 and C3 in FSHD muscle renewal using DUX4 siRNA therapy and early complement pathway-specific immunotherapy, with the goal of developing combination therapies to treat FSHD disease initiation and progression.

[0536] We have generated a humanized innate immunity-FSHD muscle xenograft model using NSG-SGM3-W41 mice to study the innate immune response to FSHD muscle. When our model was standardized using muscle biopsy-derived myoblasts from three FSHD patients and matched healthy controls, as well as HSCs from seven healthy donors, we found that human B cells and macrophages preferentially infiltrated FSHD muscle in all cohorts. Although immune cells infiltrated FSHD xenografts in all cohorts, renewal of FSHD muscle was only observed in four of the seven cohorts, indicating that the response was immune donor-dependent. Finally, we observed increased expression of complement genes from both the classical and alternative pathways in FSHD transplanted muscle compared to control transplanted muscle, suggesting potential mechanisms and novel targetable pathways for amelioration of FSHD muscle pathology.

[0537] method

[0538] Mouse model generation

[0539] NOD.Cg-Kit was developed as described in Table 1 above em1Mvw Prkdc scid IL2rg tm1Wjl Tg(CMV-IL3,CSF2,KITL)Eav / MloySzJ(NSG-SGM3-W41) mice. NSG-SGM3. The W41 mutation in the mouse Kit gene (consisting of a G to A point mutation (V831M) in the kinase domain) was directly generated in NSG zygotes using CRISPR-Cas9 and oligonucleotide-mediated homology-directed repair as described previously. To reduce the possibility of off-target mutations, a truncated guide was used to target the sequence: GCACGACTGCCCGTGAAG (SEQ ID NO: 1), and NSG-Kit W41The allele was generated using the donor oligonucleotide template: AGGGGAGGTGGCTGGAGGTCACAAGGTTTAAGGTCCTCGTCTATCGCTGTCTTCATTAGCTGCTTGAATTTGCTGTGTTCCGTTCTAGGCACGACTGCCCATGAAGTGGATGGCACCAGAGAGCATTTTCAGCTGCGTGTACACATTTGAAAGTGATGTCTGGTCCTATGGGATTTTCCTCTGGGAGCTCTTCTCCTTAG (SEQ ID NO: 2). W41 Mice were crossed and further crossed to immobilize the NSG-SGM3 Kit W41 All genes in mice were homozygous.

[0540] Isolation of human umbilical cord blood (UCB)-HSCs and transplantation into mice

[0541] Human UCB was obtained under the Committee for the Protection of Human Subjects of the University of Massachusetts Chan Medical School. UCB was provided by the University of Massachusetts Memorial Umbilical Cord Blood Donation Program. Groups of male and female NSG-SGM3-W41 mice, aged 4 to 8 weeks, were intravenously injected with 1 x 10 5 Human UCB was transplanted with CD3-depleted (Miltenyi Biotech) human CD34+ HSCs. Flow cytometric analysis of blood from transplanted mice at the indicated time points quantified the engraftment of the human immune system. For experimental studies, mice with >10% peripheral human CD45+ cells and >5% human CD3+ T cells were used.

[0542] Flow cytometry

[0543] To analyze the development of the human immune system in HSC-transplanted NSG-SGM3-W41 mice, the following monoclonal antibodies specific for human antigens were used: human CD45 (2D1), CD3 (UCHT1), CD20 (2H7), and CD33 (WM53). Mouse leukocytes were depleted with anti-mouse CD45 (30F-11). Antibodies were purchased from BD Biosciences, Inc. (CA) or BioLegend (CA). Single cell suspensions of spleens were prepared from transplanted mice, and whole blood was collected in heparin. 5 × 10 cells in 50 μl or 100 μl of whole blood were washed with FACS buffer (PBS supplemented with 2% fetal bovine serum (HyClone, UT) and 0.02% sodium azide (Sigma, MO)). 5 Single cell suspensions of splenocytes were then pre-incubated with rat anti-mouse FcR11b (clone 2.4G2, BD Biosciences, CA) to block Fc binding. Specific antibodies against cell surface antigens were then added to the samples and incubated at 4°C for 30 minutes. The stained samples were then washed and fixed with 2% paraformaldehyde for cell suspensions or BD FACS lysis buffer for whole blood. At least 100,000 events were acquired on an LSRII instrument (BD Biosciences, CA) or Aurora (Cytek Biosciences, CA). Data analysis was performed using FlowJo software (Tree Star, Inc., OR).

[0544] Cell culture

[0545] CD56+ FAC-sorted FSHD and control myoblasts from families 12, 15, and 17 were cultured on 0.1% gelatin (Sigma G9391)-coated 15 cm dishes in HMP medium (Ham's F10 (Cellgro 10-070-CV) supplemented with 20% FBS (Hyclone SH30071.03) and 1% chicken embryo extract (prepared in-house)) and passaged using TrypLE (ThermoFisher) when they reached 70% confluence.

[0546] Muscle xenografts

[0547] NSG-SGM3-W41 mice were used in accordance with the Institutional Animal Care and Use Committee (IACUC) of UMass Chan Medical School. Mice were anesthetized with ketamine / xylazine and irradiated to 18 Gy of their hind limbs using a FaxitronCellRad X-ray cabinet (Faxitron Bioptics LLC) to eliminate the host mouse satellite cell population. Lead shielding was used to limit the irradiation exposure to the hind limbs only. One day after irradiation, mice were anesthetized with an isoflurane vaporizer (SurgiVet model 100) and injected bilaterally with 50 μl of 1.2% barium chloride (Sigma) into the tibialis anterior (TA) muscle to degenerate the mouse muscles. Three days after muscle injury, 1×10 6 CD56+ biopsy-derived myoblasts were resuspended in 50 μl of 1 mg / mL laminin (Sigma, L2020) in phosphate-buffered saline (PBS) and injected bilaterally into the TA muscle. 3-4 weeks after transplantation, xenografted mice were euthanized by CO2 asphyxiation and subsequent cervical dislocation. For immunohistological experiments, TA muscles were embedded in Tissue-Tek OCT compound (Sakura), frozen on liquid nitrogen-cooled isopentane, and kept at -80°C until frozen sections. For RNA isolation, xenografted TA muscles were quickly frozen in liquid nitrogen and kept at -80°C until RNA isolation.

[0548] RNA isolation for NanoString

[0549] RNA was isolated from xenografted TA muscles using the Aurum Total RNA Fatty and Fibrous Tissue kit (Bio-Rad) according to the manufacturer's instructions. For NanoString digital RNA quantification, 150 ng of total RNA was used for each xenografted TA muscle. In all analyses on the nCounter Sprint profiler (NanoString Technologies, Seattle, WA), a custom inflammation NanoString panel was used, which has human-specific probes for muscle protein genes (MEF2C, MYH8, and MYL2), DUX4 target genes (LEUTX and MBD3L2), inflammatory genes, and multiple housekeeping genes. Raw mRNA counts for each TA sample were normalized to a panel of housekeeping genes (RPL13A, GAPDH, GUSB, HRPT1, PGK1, TUBB, and VCP) using nSolver software (NanoString Technologies, Seattle, WA).

[0550] TA sections and immunohistology

[0551] Frozen TA muscles embedded in tissue-Tek OCT compound (Sakura) were cryosectioned using a Leica CM3050 S Cryostat. 10 μm thick tissue sections were mounted on Superfrost Plus glass microscope slides (Fisher Scientific) and stored at -20°C. Upon thawing, sections were fixed with ice-cold acetone at -20°C for 10 minutes. For co-staining of laminin A / C (mab636) and spectrin β1 (NCL-SPEC1), we used the "mouse-on-mouse" (MOM) kit (Vector Laboratories) to reduce nonspecific antibody staining according to the manufacturer's instructions. Antibodies were used sequentially, and the slides were then incubated with Hoechst block for 10 minutes. For immunostaining of human CD45 (Dako, M0701), CD19 (Abcam, ab134114), CD68 (Agilent, clone PG-M1), or human-specific C3 (ThermoFisher, JF10-30), slides were incubated with primary antibodies overnight at 4°C, followed by 2 × 5-minute washes with PBS. The corresponding secondary antibodies were added and incubated for 1 hour at room temperature, followed by 2 × 5-minute washes with PBS. Slides were incubated with Hoechst for 10 minutes at room temperature, dried, and coverslipped with Fluorogel. Fluorescence images were captured using a Leica DMR fluorescence microscope equipped with an IKona monochrome, high-sensitivity 6MP camera and a Sony sensor.

[0552] statistics

[0553] NanoString, flow cytometry, and immunostaining quantitative data are presented as mean ± SEM. Statistical differences between NanoString RNA expression data and immunofluorescence quantification were assessed using the Welch's t test, and were considered significant when the P value was less than 0.05 (* = P < 0.05, ** = P < 0.01, *** = P < 0.001, **** = P < 0.0001). Statistical analysis was performed using Prism V9 (Graphpad Software LLC).

[0554] Example 7 - Unfractionated Human Umbilical Cord Blood (UCB) Transplantation into NSG Mouse Strain

[0555] 8-12 week old NSG-MHC DKO Tg(Hu-IL15), NSG-MHC DKO and NSG-Tg(Hu-IL7)(Hu-IL15) mice (strains 7, 2 and 5 in Table 1 above, respectively) were irradiated with 200 cGy and then transplanted with 5×10 4 CD34 + Human hematopoietic stem cells (HSC) and 1.9×10 6 Personal human CD3 + Unfractionated human umbilical cord blood (UCB) containing T cells. 2 / 10, 7 / 8, and 0 / 10 of NSG-MHC DKO Tg (Hu-IL15), NSG-MHC DKO, and NSG-Tg (Hu-IL7) (Hu-IL15) mice, respectively, survived to at least 6 weeks after irradiation and transplantation. These survival figures indicate that implantation of unfractionated human UCB in NSG mice expressing Hu-IL15 reduced overall survival. To increase survival time to at least 6 weeks, the amount of irradiation can be reduced, the number of transplanted human T cells can be reduced, human interleukin-4 can be expressed (e.g., using any of the expression vectors provided herein), or some combination thereof can be performed.

[0556] The mean percentage of human immune cells expressed in surviving NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice was assessed 6 weeks after irradiation and transplantation. Figure 9 In NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice, human CD45 + The mean percentages of monocytes were total CD45 + In NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice, human CD3 + The mean percentage of total CD3 T cells + In NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice, CD4 + The mean percentage of total CD4 T cells + In NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice, human CD8 + The average percentage of total CD8 T cells + About 45% and about 20% of T cells.

[0557] These results indicate that transgenic expression of human IL15 in NSG-MHC DKO mice reduces the expression of human leukocytes (CD45 + ) and CD4 + These results further demonstrate that transgenic expression of human IL15 in NSG-MHC DKO mice increases CD8 T cell proliferation relative to NSG-MHC DKO mice. + Overall, these results indicate that implantation of unfractionated UCB as described above in mice expressing human IL15 reduces the expression of human CD45 + Expression of monocytes and CD4 + Favoring CD8 T cells at the expense of + T cell expression.

[0558] Example 8 - Unfractionated Human UCB Transplanted into NSG Mouse Strain with Reduced Irradiation and T Cell Engraftment

[0559] NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice (strains 7 and 5, respectively, see Table 1 above) aged 8-12 weeks were irradiated with 100 cGy and then transplanted with 5×10 4 CD34 + Human hematopoietic stem cells (HSC) and 1.0×10 6 Personal human CD3 + Unfractionated human umbilical cord blood (UCB) for T cells. AAV-IL4 vector was also introduced into mice to express IL4. Compared with the experiment in Example 7, the amount of irradiation and the number of human CD3+ T cells transplanted in unfractionated UCB were approximately halved. 13 / 13 and 14 / 14 NSG-MHC DKO Tg (Hu-IL15) and NSG-Tg (Hu-IL7) (Hu-IL15) mice survived to 3 weeks after irradiation and implantation ( Figure 10B ), and 12 / 13 and 9 / 14 NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice survived to 3 weeks after irradiation and implantation ( Figure 10E These results suggest that reduced irradiation, reduced human CD3+ T cell engraftment, and / or AAV-IL4 expression improve the survival of NSG mice expressing human-IL15.

[0560] The percentage of human immune cells expressed in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice was evaluated 3 weeks after irradiation and transplantation. Figure 10A 、10B In NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, human CD45 + The average percentages of leukocytes were approximately 18% and approximately 25%, respectively. In NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice, human CD3 + The mean percentage of total CD3 T cells + In NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, human CD19 + The mean percentages of total CD45 + In NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, human CD4 + The mean percentages of total CD4 T cells were + In NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, human CD8 + The mean percentages of total CD8 T cells were + In NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, human CD56 + The average expression of natural killer cells was total CD45 + Taken together, these results suggest that expression of the MHC DKO allele and / or Hu-IL7 alters the relative expression of human CD45 in NSG mice transplanted with unfractionated UCB as described above. + Leukocyte expression, human CD4 + T cell expression and human CD8 + T cell expression.

[0561] The mean percentages of human T cell populations expressing IL-17 and IL-18 were also assessed in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice 3 weeks after irradiation and transplantation. Figure 10C In NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, human CD4 + CD38 +The mean percentages of total CD4 T cells were + CD38 + About 65% of human T cells. + HLA-DR + The mean percentages of total CD4 T cells were + About 5% and about 20% of HLA-DR+ T cells. Human CD8 + CD38 + The mean percentages of total CD8 T cells were + CD38 + About 70% and about 50% of T cells. Human CD8 + HLA-DR + The mean percentages of total CD8 T cells were + HLA-DR + Taken together, these results suggest that expression of the MHC DKO allele and / or Hu-IL7 alters human CD4 T cells in NSG mice transplanted with unfractionated UCB as described above. + HLA-DR + T cell expression, CD8 + CD38 + T cell expression and CD8 + HLA-DR + T cell expression.

[0562] Total CD45 expression was also assessed in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice at 3, 6, and 9 weeks after irradiation and transplantation. + Human CD45 in cells + The percentage of cells ( Figure 10E ). Human CD45 in NSG-MHC DKO Tg(Hu-IL15) mice 3, 6, and 9 weeks after irradiation and implantation + The average percentage of cells decreased from about 18% to about 10% to about 8%. + The average percentages of cells were about 25%, about 30%, and about 32%. + In NSG-MHC DKOTg (Hu-IL15) mice and NSG-Tg (Hu-IL7) (Hu-IL15) mice, approximately 92% of the cells were CD3 + T cells ( Figure 10FTaken together, these results indicate that expression of the MHC DKO allele reduces human CD45 expression in NSG mice transplanted with unfractionated UCB from 3 to 9 weeks of age, relative to NSG mice that do not express the MHC DKO allele but express Hu-IL7. + The percentage of cells.

[0563] Example 9 - Injection of Unfractionated UCB Dividing Cells into NSG Mouse Strain

[0564] NSG-MHC DKO Tg(Hu-IL15) mice (strain 7) were treated with split cell injections for human transplantation. In these split cell injections, CD34 + Hematopoietic stem cells (HSCs) are selected (e.g., isolated) from human UCB and transplanted (injected) into NSG-MHC DKO Tg (Hu-IL15) mice. The flow-through from this selection (which contains at least T cells, B cells, macrophages, dendritic cells, and natural killer (NK) cells) is called the negative fraction. The negative fraction is cryopreserved and cultured in mice with CD34 + HSCs were transplanted (injected) into these mice 6 weeks after transplantation of NSG-MHC DKO Tg(Hu-IL15).

[0565] The mean percentage of human immune cells expressed in NSG-MHC DKO Tg(Hu-IL15) mice was assessed 6 and 9 weeks after human UCB split cell transplantation. Figures 11A-11C In NSG-MHC DKO Tg(Hu-IL15), human CD45 + The average percentage of leukocytes was approximately 18% of the total. In NSG-MHC DKO Tg(Hu-IL15) mice, human CD45 + This percentage of cells increases from about 1%-25% to about 2%-40% ( Figure 11C In NSG-MHC DKO Tg(Hu-IL15) mice, human CD3 + The mean percentage of total CD3 T cells + In NSG-MHC DKO Tg(Hu-IL15) mice, human CD19 + The mean percentage of total CD45 B cells + In NSG-MHC DKO Tg(Hu-IL15) mice, human CD56 + The average percentage of NK cells was total CD56 +In NSG-MHC DKO Tg(Hu-IL15) mice, human CD33 + The mean percentage of bone marrow cells was total CD33 + About 3% of cells ( Figure 11A 、 11B Taken together, these results suggest that human CD3 + The percentage of T cells decreased with the implantation of split cells as described above (the above Figure 10F and Figure 11A and 11B In addition, from 6 to 9 weeks, human CD45 + Increased cell expression.

[0566] All references, patents, and patent applications disclosed herein are hereby incorporated by reference with respect to the subject matter for which they are individually cited, in some cases in their entirety.

[0567] The indefinite articles "a" and "an" as used herein in the specification and claims, unless expressly indicated otherwise, should be understood to mean "at least one".

[0568] It should also be understood that in any method claimed herein that includes more than one step or action, the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are recited unless explicitly stated to the contrary.

[0569] In the claims and the preceding description, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "comprising," and the like are to be construed as open-ended, meaning including, but not limited to, including. As provided in Section 2111.03 of the U.S. Patent Office Manual of Patent Examining Procedures, only the transitional phrases "consisting of" and "consisting essentially of" are closed or semi-closed transitional phrases, respectively.

[0570] The terms "about" and "substantially" preceding a numerical value refer to ±10% of the stated numerical value.

[0571] Where a numerical range is provided, every value between the upper and lower limit of that range is specifically contemplated and described herein.

Claims

1. An immunodeficient non-obese diabetic (NOD) mouse, comprising: (a) an endogenous Il2rg allele with a disabling mutation, an endogenous Prkdc allele with a disabling mutation, and an endogenous Kit allele with a disabling mutation; and (b) transgenes encoding human interleukin 3 (huIL3), human granulocyte-macrophage colony-stimulating factor (huGM-CSF), and human Steel factor (huSCF).

2. The immunodeficient mouse according to claim 1, wherein the immunodeficient mouse has been transplanted with human hematopoietic stem cells.

3. The immunodeficient mouse according to claim 1, wherein the immunodeficient mouse has been transplanted with human peripheral blood mononuclear cells.

4. The immunodeficient mouse according to any one of claims 1 to 3, wherein the immunodeficient mouse has been transplanted with diseased human cells.

5. The immunodeficient mouse according to claim 4, wherein the diseased human cells are obtained from a subject with a genetic disorder.

6. The immunodeficient mouse according to claim 5, wherein the genetic disorder is facioscapulohumeral muscular dystrophy (FSHD).

7. The immunodeficient mouse according to claim 6, wherein the diseased human cells are human muscle cells.

8. The immunodeficient mouse according to claim 7, wherein the human muscle cells are CD56+ muscle stem cells.

9. A method, which comprises: administering human hematopoietic stem cells to an unirradiated immunodeficient mouse according to claim 1, wherein the human hematopoietic stem cells develop into innate immune cells; and administering human diseased cells to the unirradiated immunodeficient mouse.

10. The method according to claim 9, wherein about 10 4 to about 10 6 human HSCs are administered.

11. The method according to claim 9 or 10, wherein the human diseased cells are administered about 4 to about 10 weeks after the administration of the human HSC.

12. The method according to any one of claims 9 to 11, wherein about 10 4 to about 10 6 human diseased cells are administered, optionally muscle cells, further optionally CD56+ muscle stem cells.

13. The method according to claim 12, wherein the human diseased cells are obtained from a subject with facioscapulohumeral muscular dystrophy (FSHD).

14. The method according to any one of claims 9 to 13, further comprising administering a treatment method to the immunodeficient mouse.

15. The method according to any one of claims 9 to 14, further comprising determining the response of the innate immune cells to the human diseased cells.

16. The method according to claim 15, wherein the response is an inflammatory response.

17. An immunodeficient non-obese diabetic (NOD) mouse, comprising: (a) Endogenous Il2rg alleles containing a disabling mutation, endogenous Prkdc alleles containing a disabling mutation, endogenous H2-K alleles containing a disabling mutation (H2-K null ); endogenous H2-D alleles containing a disabling mutation (H2-D null ); endogenous H2-A alleles containing a disabling mutation (H2-A null ); and (b) a transgene encoding human interleukin 15 (huIL15).

18. An immunodeficient non-obese diabetic (NOD) mouse, comprising: (a) an endogenous Il2rg allele with a disabling mutation and an endogenous Prkdc allele with a disabling mutation; and (b) a transgene encoding human interleukin 15 (huIL15) and a transgene encoding human interleukin 7 (huIL7).

19. A method, comprising: Administering human hematopoietic stem cells (HSC) or human peripheral blood mononuclear cells (PBMC) to the immunodeficient mouse according to claim 17 or 18, wherein the human HSC develop into innate immune cells, optionally wherein the mouse is unirradiated; and Administering human diseased cells to the immunodeficient mouse.

20. The method according to claim 19, wherein about 10 4 to about 10 6 human HSCs or human PBMCs are administered.

21. The method according to claim 19 or 20, wherein the human diseased cells are administered about 4 to about 10 weeks after administering the human HSC or human PBMC.

22. The method according to any one of claims 19 to 21, wherein about 10 4 to about 10 6 human diseased cells are administered.

23. The method according to any one of claims 19 to 22, further comprising administering a treatment method to the immunodeficient mouse.

24. The method according to any one of claims 19 to 23, further comprising determining the response of the innate immune cells to the human diseased cells.

25. The method according to claim 24, wherein the response is an inflammatory response.

Images