Csect protein related to plant disease resistance, recombinant vector and application thereof
By cloning the CsECT gene and overexpressing the CsECT protein in citrus, the gap in the regulation of plant disease resistance by the CsECT gene was filled, significantly improving the resistance of citrus to bacterial canker and enhancing the plant's disease resistance.
Patent Information
- Application Number
- CN202510223394.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-27
- Publication Date
- 2025-12-30
- Estimated Expiration
- 2045-02-27
AI Technical Summary
The regulatory role of the CsECT gene in plant disease resistance, especially bacterial canker, has not been reported in the current technology. Citrus and other plants are susceptible to diseases such as bacterial canker, resulting in serious economic losses.
By cloning the CsECT gene, constructing a recombinant vector, and overexpressing the CsECT protein, the disease resistance of plants can be improved. Specific methods include transferring the nucleic acid molecules of the CsECT protein into plants and using Agrobacterium-mediated transformation to achieve overexpression of the CsECT protein in citrus.
It significantly improved the resistance of citrus to bacterial canker, reduced the area of lesions, and enhanced the plant's disease resistance.
Smart Images

Figure CN120058887B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a CsECT protein, recombinant vector, and its application related to plant disease resistance. Background Technology
[0002] Citrus canker is a disease that affects many plants, including tomatoes, grapes, dragon fruit, citrus, kiwifruit, melons, poplars, willows, and fast-growing Chinese locust trees. Citrus canker is particularly severe. Citrus is the world's most popular fruit, grown in over 100 countries worldwide, and is one of the world's most important commercial fruit trees. It is also the most widely cultivated and highest-yielding fruit in my country. Citrus is susceptible to various diseases, such as Huanglongbing (HLB), citrus canker, anthracnose, and sooty mold. Citrus infected with citrus canker initially develops spongy pustules on the leaves, later leading to twig dieback, fruit drop, and even orchard destruction. These diseases cause significant economic losses.
[0003] The CsECT gene encodes m in citrus (Citrus sinensis). 6 The key gene for ARNA methylation reading proteins encodes a product belonging to the YTH domain protein family. The CsECT gene sequence is 2133 bp in length, and its open reading frame encodes a 711-amino acid protein with a typical YTH domain at its N-terminus. Existing research indicates that plant ECT homologs play important roles in growth and development. For example, Arabidopsis thaliana AtECT2 has been shown to methylate ARNA through... 6 A-dependent regulation of leaf polarity development; tomato SlECT3 can affect fruit ripening. Rice OsECT4 has been reported to participate in drought stress response, but its mechanism of action is limited to abiotic stress response. Although the functions of ECT family genes in plant growth, development, and abiotic stress have been preliminarily explored, their regulatory role in disease resistance (especially bacterial canker) has not been reported. No studies on the relationship between CsECT genes and plant disease resistance have been reported in the current technology. Summary of the Invention
[0004] The purpose of this invention is to provide a CsECT protein related to plant disease resistance, which can improve plant disease resistance.
[0005] To address the aforementioned technical problems, the following technical solutions are proposed:
[0006] The present invention provides a CsECT protein related to plant disease resistance, the amino acid sequence of which is shown in SEQ ID NO:8.
[0007] The present invention provides a nucleic acid molecule encoding the CsECT protein described in the above technical solution, wherein the CDS sequence of the nucleic acid molecule is shown in SEQ ID NO:1.
[0008] This invention provides a recombinant vector, comprising a starting vector and the nucleic acid molecule described in the above technical solution.
[0009] This invention provides a recombinant bacterium, comprising an original strain and the recombinant vector described in the above technical solution.
[0010] This invention provides the application of the CsECT protein described in the above-mentioned technical solution, or the nucleic acid molecule of the CsECT protein described in the above-mentioned technical solution, or the recombinant vector described in the above-mentioned technical solution, or the recombinant bacteria described in the above-mentioned technical solution, in improving the disease resistance of plants.
[0011] Preferably, the improvement of plant disease resistance includes improving plant resistance to bacterial canker.
[0012] Preferably, the enhancement method includes overexpression of the CsECT protein.
[0013] Preferably, the application includes the following steps: transferring a nucleic acid molecule encoding the CsECT protein into a plant to induce CsECT protein overexpression.
[0014] This invention provides a method for improving plant disease resistance or creating disease-resistant plants, wherein a recombinant vector is transferred into a plant to obtain a plant with improved disease resistance; the recombinant vector is the recombinant vector described in the above technical solution or the recombinant vector constructed by the construction method described in the above technical solution.
[0015] Preferably, the plant includes citrus.
[0016] The beneficial effects of this invention: This invention provides a CsECT protein related to plant disease resistance. The CsECT protein described in this invention is encoded by the nucleic acid molecule CsECT and is presumed to act as an m 6 A reader, affecting the metabolism of its target mRNA, including improving the stability of disease resistance-related target genes and promoting the expression of disease resistance genes, thereby enhancing plant disease resistance. The results of the examples show that after cloning the CsECT gene, CsECT transgenic citrus was constructed. Overexpression of the CsECT gene in citrus significantly improved the citrus's resistance to bacterial canker, thus enhancing its overall disease resistance. Therefore, the CsECT protein synthesized from the CsECT gene described in this invention can improve plant disease resistance. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0018] Figure 1 The images show fluorescence screening results of wild-type non-GMO citrus and CsECT transgenic citrus from Example 1.
[0019] Figure 2 The disease resistance phenotypes of CsECT transgenic citrus (OE) and empty vector control group (Control) in Example 2 are shown in the figure.
[0020] Figure 3 Phenotypic diagrams of CsECT transgenic citrus inoculated with citrus canker by needle puncture method and empty vector control citrus in Example 2;
[0021] Figure 4 Phenotypic diagrams of CsECT transgenic citrus inoculated with citrus ulcerus by injection method and empty control citrus. (Example 2) Detailed Implementation
[0022] The present invention provides a CsECT protein, the amino acid sequence of which is shown in SEQ ID NO:8.
[0023] The CsECT protein sequence described in this invention has a length of 711 amino acids and a molecular weight of 77,898.19.
[0024] The present invention also provides a nucleic acid molecule encoding the CsECT protein described in the above technical solution, wherein the CDS sequence of the nucleic acid molecule is shown in SEQ ID NO:1.
[0025] As an optional implementation method, the cloning of the nucleic acid molecule includes: extracting total RNA from Citrus reticulata 'Chachi' leaves, performing reverse transcription to obtain cDNA, designing upstream primer CsECT-F and downstream primer CsECT-R, and performing PCR amplification using Citrus reticulata 'Chachi' cDNA as a template to obtain the PCR amplification product. The PCR amplification is performed in 25 μL increments, comprising: 12.5 μL 2×PrimeSTAR, 1 μL upstream primer, 1 μL downstream primer, 1 μL template Citrus reticulata 'Chachi' (cDNA), and 9.5 μL H2O. The PCR amplification program includes: pre-denaturation at 95℃ for 5 min, denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 2 min, for 32 cycles; followed by a final extension at 72℃ for 10 min. After obtaining the PCR amplification product, this invention ligates the PCR amplification product into a cloning vector and transforms the ligation product into *E. coli* for culture, obtaining a resistant *E. coli* bacterial culture. Sequencing reveals the CDS sequence of the nucleic acid molecule CsECT, encoding the CsECT protein, with a CDS sequence length of 2133 bp. As an optional implementation, the cloning vector includes a T-vector (pEASY-BluntCloning Vector). After cloning, the plasmid is extracted from the resistant *E. coli* bacterial culture to obtain a recombinant plasmid. Overexpression of the CsECT gene in citrus plants can enhance the resistance of citrus to citrus canker.
[0026] The present invention also provides a recombinant vector, comprising a starting vector and the gene CsECT encoding the CsECT protein as described in the above technical solution.
[0027] As an optional implementation, the starting vector of the present invention includes an overexpression vector; as an optional implementation, the overexpression vector includes a 35S overexpression vector.
[0028] The present invention also provides a method for constructing the recombinant vector described in the above technical solution, comprising the following steps:
[0029] The gene described in the above technical solution is amplified using amplification primers to obtain the amplification product;
[0030] The amplification product is ligated into the starting vector to obtain the recombinant vector.
[0031] This invention utilizes amplification primers to amplify the gene described in the above technical solution to obtain amplification products; the amplification process of the gene CsECT in this invention has been discussed above and will not be repeated here.
[0032] As an optional implementation, the present invention preferably ligates the amplification product and a cloning vector before ligating the amplification product to the overexpression vector to obtain a recombinant plasmid. In the present invention, the cloning vector is a T-vector (pEASY-Blunt Cloning Vector). The preparation process of the recombinant plasmid has been described above and will not be repeated here.
[0033] After obtaining the recombinant plasmid, the present invention uses the recombinant plasmid as a template for PCR amplification to obtain the amplification product. The primers used for PCR amplification using the recombinant plasmid as a template in the present invention include an upstream primer 35S-CsECT-F and a downstream primer 35S-CsECT-R; the preferred nucleotide sequence of the upstream primer 35S-CsECT-F is shown in SEQ ID No. 4, and the preferred nucleotide sequence of the downstream primer 35S-CsECT-R is shown in SEQ ID No. 5.
[0034] This invention ligates the obtained amplification product and the starting vector to obtain the recombinant vector. As an optional embodiment, the starting vector includes an overexpression vector; in a specific embodiment of this invention, the overexpression vector includes a 35S overexpression vector. As an optional embodiment, the ligation system includes: 1 μL of gel-recovered PCR amplification product fragment, 1 μL of pAGM243-35S-GFP plasmid, 1 μL of 10 mM ATP, 1 μL of buffer G, 0.5 μL of T4 DNA ligase, 0.5 μL of LPiI, and 5 μL of ddH2O. The ligation reaction program includes: 37℃ for 10 min, 16℃ for 10 min, 3 cycles; 37℃ for 10 min, 65℃ for 20 min.
[0035] As an optional implementation, after ligation, a ligation product is obtained. This invention transforms the ligation product into *E. coli*, and after culture and sequencing, obtains a positive strain. The positive strain is then extracted using a plasmid extraction kit to obtain a recombinant vector. In a specific embodiment of this invention, the ligation product is transformed into DH5α *E. coli*, and after culture and sequencing, a positive pAGM243-35s-CsECT-GFP strain is obtained. The pAGM243-35s-CsECT-GFP plasmid is then extracted using a plasmid extraction kit.
[0036] The present invention also provides a recombinant bacterium, comprising an original strain and the recombinant vector described in the above technical solution.
[0037] As an optional implementation, the original strain of the present invention includes Agrobacterium tumefaciens EHA105.
[0038] As an optional implementation method, the preparation method of the recombinant vector of the present invention has been discussed above and will not be repeated here.
[0039] This invention provides the application of the CsECT protein, the nucleic acid molecule encoding the CsECT protein, the recombinant vector, or the recombinant bacteria described in the above-mentioned technical solutions, in improving plant disease resistance. The preferred application of this invention includes the following steps: transferring the nucleic acid molecule encoding the CsECT protein into a plant to induce CsECT protein overexpression.
[0040] As an optional implementation, the recombinant vector contains the fluorescent protein GFP, which turns green after the transgenic plant is irradiated, facilitating the screening of transgenic plants.
[0041] As an optional implementation, the plant described in this invention includes citrus. In a specific embodiment of this invention, the citrus is taken as a Qingjinju (a type of citrus fruit) for effect verification. In this embodiment of the invention, the transgenic citrus plant is preferably obtained by the following method: transferring the CsECT gene from the Chazhigan (a type of citrus fruit) into the citrus plant to obtain a CsECT transgenic citrus plant. The method of transformation into the citrus plant described in this invention is Agrobacterium-mediated transformation. The Agrobacterium-mediated transformation method described in this invention can use conventional methods and is not particularly limited.
[0042] As an optional implementation, the improvement of plant disease resistance described in this invention includes improving plant resistance to citrus canker. The pathogen causing citrus canker described in this invention includes Xanthomonas citri subsp. citri (Xcc).
[0043] The Agrobacterium strain used in this invention is preferably Agrobacterium EHA105. The transgenic CsECT citrus plants used in this invention are preferably screened and verified using a fluorescence spectrometer. CsECT transgenic citrus plants with GFP fluorescent tags exhibit green fluorescence in their leaves after irradiation with a fluorescence spectrometer.
[0044] This invention provides a method for improving plant disease resistance by transferring a recombinant vector into plants to obtain CsECT transgenic plants; the recombinant vector is the recombinant vector described in the above technical solution or the recombinant vector constructed by the construction method of the above technical solution.
[0045] As an optional embodiment, the plant described in this invention includes citrus. As an optional embodiment, the transformation method includes Agrobacterium-mediated transformation. The Agrobacterium-mediated transformation of this invention includes Agrobacterium EHA105. The Agrobacterium-mediated transformation of this invention includes: mixing the recombinant vector with competent Agrobacterium cells and sequentially freezing, water bathing, and standing to obtain a transformation solution; culturing and screening the transformation solution to obtain positive Agrobacterium; culturing the positive Agrobacterium to obtain a culture medium; mixing the culture medium with acetylsyleugenol to obtain an infection solution; and infecting plant wounds with the infection solution. The freezing, water bathing, standing, transformation solution culture, and screening described in this invention can use conventional parameters and are not particularly limited. The time for infecting plant wounds with the infection solution of this invention is 5 minutes, and the concentration of acetylsyleugenol in the infection solution is 50 μg / mL. The CsECT transgenic plants of this invention show a significant reduction in the severity of canker disease and a significant reduction in lesion area.
[0046] This invention clones the CsECT gene and constructs CsECT transgenic citrus. Experiments show that overexpression of the CsECT gene in citrus significantly improves its resistance to bacterial canker. The CsECT gene of this invention has potential application value in plant disease resistance.
[0047] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0048] This invention clones the CsECT gene of the tea branch mandarin orange, and the citrus variety used for transgenic modification is the Qingjinju.
[0049] Example 1: Cloning of the CsECT gene in citrus
[0050] 1. Extraction of total RNA and reverse transcription of cDNA from leaves of Citrus reticulata 'Chazhi'
[0051] A small amount of Citrus reticulata 'Chachi' leaves were collected, ground, and total RNA was extracted from the leaves using the FastPure Plant Total RNA Isolation Kit (catalog number RC401-01) from Jiangsu Novizan Pharmaceutical Co., Ltd. The extraction quality of total RNA was then assessed by 1% agarose gel electrophoresis, and the RNA concentration was detected using a NanoDrop2000 spectrophotometer. The TAKRA PrimeScript reverse transcription kit was used. TMcDNA was obtained by reverse transcription using the RT reagent kit with gDNA Eraser (RR047A). The reverse transcription process was as follows: 2 μg of total RNA was used as a template, and 1.5 μL of 5×gDNA Eraser Buffer and 1 μL of gDNA Eraser were added. The volume was brought to 15 μL with RNase-free dH2O. After mixing the sample thoroughly, it was incubated in a PCR instrument at 42°C for 2 min to remove genomic DNA. Then, 5 μL of 5×PrimeScript Buffer, 1.5 μL of PrimeScript RT Enzyme Mix I, 1.5 μL of RT PrimerMix, and 2 μL of RNase-free dH2O were added. After thorough mixing, the mixture was incubated at 37°C for 15 min, then at 85°C for 5 s, and finally cooled to 4°C to obtain cDNA. The cDNA was stored at -30°C.
[0052] 2. CsECT gene cloning
[0053] Using the cDNA obtained in step 1 as a template, and CsECT-F (SEQ ID NO: 2): ATGGCTACTACTGTTGCTCCTGCTG; CsECT-R (SEQ ID NO: 3): ACAACCATTTGCAACCCCATTTGCC as primers, PCR amplification was performed using the following mixture: 12.5 μL 2×PrimeSTAR, 1 μL CsECT-F, 1 μL CsECT-R, 1 μL cDNA, and 9.5 μL H2O. The mixture was thoroughly mixed before PCR amplification. The PCR reaction system was as follows: pre-denaturation at 95℃ for 5 min, denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 2 min, for 32 cycles; followed by a final extension at 72℃ for 10 min. The PCR products were recovered using the agarose gel DNA recovery kit (catalog number DP219) from Tiangen Biotech (Beijing) Co., Ltd.
[0054] The PCR gel-recovered product was ligated into the T-vector (pEASY-Blunt Cloning Vector). Specifically, 1 μL of T-vector was added to 4 μL of the PCR gel-recovered product, and the mixture was incubated at 37°C for 5 min to obtain the ligation product. The ligation product was then added to DH5α E. coli competent cells, incubated on ice for 15 min, followed by heat shock at 42°C for 90 s, and then incubated on ice for 2 min. The cells were then added to LB broth and incubated at 37°C at 180 rpm. The resulting culture was then plated on ampicillin-resistant medium and incubated overnight at 37°C. Single colonies were picked, and the bacterial culture was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. A 2133 bp sequence was obtained, which, after alignment, was identified as the CsECT CDS sequence of the citrus gene, as shown in SEQ ID NO: 1.
[0055] The CsECTCDS sequence is as follows:
[0056]
[0057] The amino acid sequence of the CsECT protein encoded by the gene CsECT is shown in SEQ ID NO:8:
[0058] SEQ ID NO:8: MATTVAPAVEKASDLLQKLSLDSQTKSLEISEHTKKPSANQYGSVDSVNAAANGQIPSERSGTPFLNDFMDPNMCYVPNGYPSTAFYYGGYDGNVGEWDDYTRYVSQDGVDMTSGVYGDNGSLMYHHGYGYAPYPPYSPATSPVPTMGTDGQLYGPQHYQYPHYFQPITPTSSPYSPSPVAPTPGDIPTSVAADQKPLPVESTNGKSNGVANAGGVKGNNGSAPFKPTYQPFNSNNTYGRGSLPGRGPASGYQDPRCNLDGMRSPIPWLDGPVISDARPVASNTFNSSISNVNNVASSRNQNYRPNSHYMGLHHPRPMSGMGAAQGFMNMNRMYPNKLYGQYGNTFRSGVGFGSNGYDLRTNGRGWLSVDGKYKSRGRGNGYFGYGNENMDGLNELNRGPRAKGAKNQKGSAPNALPVKEQNVLTNGTAEDENDKISLSPDRDEYNKADFPEEYTDAKFFVIKSYSEDDVHKSIKYSVWASTPNGNKKLDAAYQEAQQKSRSCPVFLLFSVNTSGQFVGLAEMAGPVDFNKNVEYWQQDKWTGCFPVKWHIVKDVPNSLLKHITLENNENKPVTNSRDTQEIKLEQGLKLIKIFKDHPSKTCILDDFGFYETRQKTIQEKKAKQQQFQKQVWEGKPAEEKKELANGELKTQKSSEVASDLVEERTTTVQSNGDLRLSENGSVAKTGDAHKGSKPVVVSEKVILANGVANGC。
[0059] 3. Construction of the 35S overexpression vector using the goldengate method
[0060] Using the plasmid ligated with the T-vector in step 2 as a template, PCR amplification was performed using 35S-CsECT-F (SEQ ID NO: 4): GTGAAGACAAAATGGCTACTACTGTTGCTCCTGC and 35S-CsECT-R (SEQ ID NO: 5): GTGAAGACAAAAGCCTAACAACCATTTGCAACCCCATTTG to obtain the PCR gel-recovered fragments.
[0061] After gel recovery, the vector was ligated according to the following system: 1 μL PCR gel-recovered fragment, 1 μL pAGM243-35s-GFP plasmid, 1 μL 10mM ATP, 1 μL buffer G, 0.5 μL T4 DNA ligase, 0.5 μL BpiI, and 5 μL ddH2O. The reaction program was as follows: 37℃ for 10 min, 16℃ for 10 min, 3 cycles; 37℃ for 10 min, 65℃ for 20 min. The ligated vector was transformed into DH5α Escherichia coli. Positive pAGM243-35s-CsECT-GFP strains were obtained by PCR detection and sequencing by Beijing Qingke Biotechnology Co., Ltd. The pAGM243-35s-CsECT-GFP plasmid was extracted using a plasmid extraction kit and stored at -30℃ for later use. The pAGM243-35s-GFP vector of this invention is also known as the Kg2E-35SA-FLAG vector. The preparation method of the Kg2E-35SA-FLAG vector is the same as that in paragraphs
[0023] to
[0032] of CN118166023A, which describes a simple and efficient citrus genetic transformation vector and its construction method and application. The pAGM243 vector sequence is shown in paragraphs
[0034] to
[0037] of CN118166023A.
[0062] 4. Agrobacterium-mediated transformation and citrus transformation
[0063] The pAGM243-35s-CsECT-GFP plasmid was transformed into Agrobacterium tumefaciens EHA105. Specifically, 5 μL of the plasmid was added to competent Agrobacterium tumefaciens EHA105 cells, incubated for 30 min, flash-frozen in liquid nitrogen for 1 min, then incubated in a 37°C water bath for 2 min, incubated at room temperature for 2 min, and then added to YEP medium. The cells were then plated on spectinomycin-resistant YEP medium with a spectinomycin concentration of 100 μg / mL and cultured at 28°C for 48 h. PCR detection confirmed the presence of positive pAGM243-35s-CsECT-GFP Agrobacterium tumefaciens. The single-clonal strain was cultured overnight at 200 rpm in YEP liquid medium containing RIF and spectinomycin resistance at 28°C, with a RIF concentration of 50 μg / mL and a spectinomycin concentration of 100 μg / mL. After inoculation into a new YEP medium containing RIF and spectinomycin resistance, it was further activated and cultured for about 12 hours. Then, 50 μg / mL of acetylsuccinone (AS) was added to the medium to obtain AS liquid containing Agrobacterium.
[0064] CsECT transgenic citrus group: The branches of the citrus kumquat were cut with a blade, and the wounds of the kumquat branches were soaked in AS liquid containing Agrobacterium for 5 minutes. The branches were then wrapped with plastic wrap. After 3 days, the plastic wrap was removed and the branches were cultured in normal light. New shoots appeared after about 1 month. CsECT positive transgenic citrus was obtained by screening with a handheld fluorescence instrument.
[0065] Wild-type non-GMO citrus: Same as the CsECT GMO citrus group, the only difference being that it was not subjected to Agrobacterium AS liquid immersion.
[0066] See the screening results Figure 1 Image A shows a wild-type non-GMO citrus kumquat under white light; image B shows a CsECT transgenic citrus kumquat under white light; images C and D show fluorescence under GFP excitation. Image C shows the wild-type non-GMO citrus kumquat under GFP excitation, exhibiting chlorophyll autofluorescence. The wild-type lacks GFP and therefore does not emit green light, only exhibiting red chlorophyll autofluorescence, resulting in a red color. Image D shows a CsECT transgenic citrus kumquat with a GFP fluorescent tag, exhibiting green fluorescence under GFP excitation. The transgenic citrus kumquat, due to the presence of both GFP (green fluorescence) and chlorophyll autofluorescence (red fluorescence), presents a combined pinkish-green appearance.
[0067] Example 2: Evaluation of disease resistance phenotype in transgenic citrus plants
[0068] Control group: The pAGM243-35s-GFP empty vector plasmid was transformed into Agrobacterium tumefaciens EHA105. Specifically, 5 μL of the pAGM243-35s-GFP empty vector plasmid was added to competent Agrobacterium tumefaciens EHA105 cells, incubated for 30 min, flash-frozen in liquid nitrogen for 1 min, incubated at 37°C for 2 min, incubated at room temperature for 2 min, then added to YEP medium, spread on spectinomycin-resistant medium, and cultured at 28°C for 48 h. After overnight culture at 28°C and 200 rpm in YEP liquid medium containing RIF and spectinomycin resistance, the single clone strain was inoculated into fresh YEP medium containing RIF and spectinomycin resistance and continued to be activated for about 12 h. 50 μg / mL of acetylsuccinone (AS) was added to the medium to obtain Agrobacterium infection solution containing the empty vector plasmid.
[0069] Preparation of empty vector control group citrus: Cut wounds on the branches of citrus kumquat with a blade, immerse the wounds of the kumquat branches in Agrobacterium infection solution containing empty vector plasmid for 5 minutes, and wrap the citrus branches with plastic wrap. After 3 days, unwrap the plastic wrap and culture under normal light. After about 1 month, new buds will grow. Screen them with a handheld fluorescence instrument to obtain empty vector control group citrus.
[0070] The CsECT transgenic citrus (OE) obtained in Example 1 and the empty control group (Control) citrus were placed in an outdoor net house for cultivation. Under uniform conditions without pesticide spraying, the disease resistance results of the OE and Control groups were as follows: Figure 2 As shown, the control group suffered from more severe diseases, which, judging from the appearance, were caused by spider mites, while the CsECT transgenic citrus (OE) showed good growth.
[0071] Further analysis was conducted to determine whether CsECT transgenic citrus also exhibited resistance to citrus canker, a common citrus disease. The specific process is as follows:
[0072] The preserved Xanthomonas citri subsp. citri (Xcc) cytopathic bacterium was streaked on LB solid medium and cultured at 28°C for 2 days. Then, it was inoculated into 1 mL of LB liquid medium and cultured overnight at 28°C and 180 rpm. After identification using cytopathic bacterium-specific primers F: TTCGGCGTCAACAAAATG (SEQ ID NO: 6) and R: AACTCCAGCACATACGGGTC (SEQ ID NO: 7), a second amplification culture was performed. Specifically, 500 μL of the XCC culture was added to 50 mL of LB liquid medium and cultured overnight for 12 h. The culture was then centrifuged at 5000 rpm for 10 min, the supernatant was discarded, and the culture was resuspended in sterile water to OD. 600=0.3 for later use, resulting in XCC bacterial suspension. Strain Xcc belongs to the Asian pathogenic type (type A).
[0073] One-year-old CsECT transgenic citrus (OE) and empty control citrus (Control) were cultured in a greenhouse. The two types of citrus had the same growth rate and were cultured at a temperature of 25°C for inoculation with citrus canker.
[0074] There are two methods for inoculating against citrus canker: the first method is the needle method, inoculating the citrus leaf with a needle and then inoculating the wound with 3 μL of XCC bacterial solution; the second method is the injection method, inoculating the citrus leaf with a needle and then injecting the bacterial solution into the citrus leaf with a 1 mL syringe.
[0075] CsECT transgenic citrus inoculated with *C. citrus canker* and the empty control group citrus were further cultured in a 25℃ greenhouse under normal water and fertilizer management. After 9 days, the disease incidence in the inoculated transgenic citrus and the empty control group was recorded. Results are as follows... Figure 3 and Figure 4 As shown, Figure 3 Image A shows the upper surface of a citrus leaf inoculated with *Citrus canker* using the needle-pricking method; image B shows the lower surface of a citrus leaf inoculated with *Citrus canker* using the needle-pricking method; image C is a magnified view of a portion of image B; and image D is a statistical chart of canker lesion area. The canker lesion areas of the three biological replicates in the Control group were 0.15 cm². 2 0.10cm 2 and 0.11cm 2 The areas of the three biologically recurrent ulcer lesions in the OE group were 0.05 cm². 2 0.03cm 2 and 0.02cm 2 . Figure 4 Image A shows the front view of a citrus leaf inoculated with citrus canker via injection, and image B shows the back view of a citrus leaf inoculated with citrus canker via injection.
[0076] according to Figure 3 and Figure 4 It can be seen that, 9 days after inoculation with the citrus canker pathogen, the incidence of citrus canker in transgenic citrus plants was significantly lower than that in the uninoculated control plants. Figure 4 Furthermore, the lesion area of the transgenic citrus was significantly smaller than that of the untransplanted control plant. Figure 3 ).
[0077] In summary, this invention cloned the CsECT gene and constructed CsECT transgenic citrus. Experiments showed that overexpression of the CsECT gene in citrus can significantly improve the citrus's resistance to citrus canker.
[0078] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A CsECT protein associated with disease resistance in plants, characterized in that, The amino acid sequence of the CsECT protein is shown as SEQ ID NO:
8.
2. A nucleic acid molecule encoding the CsECT protein of claim 1, characterized in that, The CDS sequence of the nucleic acid molecule is shown as SEQ ID NO:
1.
3. A recombinant vector, characterized in that, The CsECT protein of claim 1 or the nucleic acid molecule of claim 2 or the recombinant vector of claim 3 or the recombinant bacteria of claim 4.
4. A recombinant bacterium, characterized in that, The CsECT protein of claim 1 or the nucleic acid molecule of claim 2 or the recombinant vector of claim 3 or the recombinant bacteria of claim 4.
5. Use of the CsECT protein of claim 1 or the nucleic acid molecule of claim 2 or the recombinant vector of claim 3 or the recombinant bacteria of claim 4 in improving the disease resistance of a plant. The improved disease resistance of the plant is improved resistance to bacterial canker. The plant is a citrus.
6. Use according to claim 5, characterized in that, The improved method comprises overexpressing the CsECT protein.
7. Use according to claim 5 or 6, characterized in that, The use comprises the step of: introducing a nucleic acid molecule encoding the CsECT protein into a plant to induce overexpression of the CsECT protein.
8. A method for increasing disease resistance in a plant or creating a disease resistant plant, comprising, The plant is a citrus. The disease resistance is resistance to bacterial canker.
Citation Information
Patent Citations
Simple, convenient and efficient citrus genetic transformation final vector as well as construction method and application thereof
CN118166023A
Application of CsMEK5 gene and encoding protein thereof in improving citrus canker resistance and transgenic plant
CN117757769A