Terpyridyl ruthenium and polyoxometallate composite material, preparation method, application and sensor

Abstract

The invention relates to a terpyridyl ruthenium and polyoxometallate composite material, a preparation method, application and a sensor. The composite material of the terpyridyl ruthenium and the polyoxometallate comprises the polyoxometallate, and the terpyridyl ruthenium is loaded on the polyoxometallate. The invention also provides a preparation method of the composite material. The invention also provides an application of the composite material as an electrochemiluminescence material. The invention also provides a sensor which comprises the composite material provided by the invention. The invention solves the problem of low luminescence stability when the existing terpyridyl ruthenium is used as an electrochemical luminescence reagent.

Description

Technical Field

[0001] The present invention relates to the technical field of electrochemiluminescent materials, and particularly relates to a composite material of ruthenium terpyridine and polyoxometalate, a preparation method, an application and a sensor. Background Art

[0002] Phthalate esters (PAEs), as the most widely used plasticizers globally, have seen their production increase from 1.8 million tons in the 1970s to over 8 million tons in 2018. China, as the world's largest consumer of plasticizers, accounted for 42% of the consumption in 2017. Since PAEs are only physically bound to the plastic matrix rather than chemically bonded, they are extremely prone to migrate into the environment during production, use, and disposal. Through surface runoff and atmospheric deposition, etc., PAEs ultimately enter water bodies such as the ocean, rivers, and lakes, forming persistent pollution. Among them, dibutyl phthalate (DBP), as a typical representative, has become a priority pollutant under key control globally due to its strong migration and bioaccumulation properties.

[0003] The harm of DBP to the ecosystem and human health is multiple and irreversible. Research has confirmed that DBP in water can be directly enriched by aquatic organisms and transmitted to the human body through the food chain, causing systemic poisoning such as immune system damage, metabolic disorders, and endocrine disorders. Its genotoxicity and developmental toxicity may also pose a transgenerational genetic risk. It is worth noting that there is an order-of-magnitude difference between the pollution exposure concentration of DBP and the conventional detection limit (μg / L level), which means that even low-concentration residues may produce significant biological effects, posing stringent requirements for the sensitivity and timeliness of detection technologies.

[0004] Existing detection technologies, such as gas chromatography, liquid chromatography, and their hyphenated techniques with mass spectrometry, can achieve accurate detection, but there are significant application bottlenecks: on the one hand, the purchase cost of large-scale instrument equipment is extremely high (the price of a single mass spectrometer can reach the million level), requiring professional personnel to operate and having complex maintenance; on the other hand, the samples need to undergo cumbersome pretreatment such as solid-phase extraction and derivatization (taking 4 - 6 hours), making it difficult to achieve on-site rapid analysis. More critically, the current methods cannot meet the real-time, portable, and high-throughput detection requirements for in-situ monitoring of water environments. This technical defect leads to a lag in pollution warning, directly affecting the effectiveness of environmental risk assessment and governance decisions, and becoming a technical shortcoming restricting the prevention and control of DBP pollution.

[0005] Electrochemiluminescence (ECL) is a detection method that generates optical signals through electrochemical excitation. Its core principle is to apply a specific voltage on the electrode surface to drive the redox reaction of electroactive substances to generate excited states. This technology combines the high controllability of electrochemistry and the high sensitivity of chemiluminescence, which is an ideal combination of electrochemistry and spectroscopy and has been widely used in diagnosis, analysis, and environmental detection. Among them, ruthenium tris(bipyridine) is a commonly used electrochemiluminescent reagent. Although it has good electrochemiluminescent performance, due to its extremely strong water solubility, it is very easy to leak from the glassy carbon electrode into the solution, resulting in the problem of unstable luminescence and affecting the accuracy of detection results. Therefore, seeking a luminescent material with stable luminescence to improve its electrochemiluminescence stability is a key issue for its better application. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide a composite material of ruthenium tris(bipyridine) and polyoxometalate, a preparation method, an application, and a sensor to solve the problem of low luminescence stability of existing ruthenium tris(bipyridine) as an electrochemiluminescent reagent.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is as follows: A composite material of ruthenium tris(bipyridine) and polyoxometalate, including polyoxometalate, and the polyoxometalate is loaded with ruthenium tris(bipyridine).

[0008] According to the above technical means, using polyoxometalate as a solid support material to load ruthenium tris(bipyridine) through electrostatic interaction to obtain a composite material. Using this composite material (Ru-Co 4 P 2 W 18 ) as an electrochemiluminescent material can significantly improve the electrochemiluminescent performance and stability of ruthenium tris(bipyridine). It effectively solves the problem of low luminescence stability of existing ruthenium tris(bipyridine) as an electrochemiluminescent reagent.

[0009] Preferably, the polyoxometalate loads the ruthenium tris(bipyridine) through electrostatic interaction.

[0010] Preferably, the polyoxometalate is selected from Co 4 P 2 W 18 .

[0011] Among them, polyoxometalate is a new type of nano-inorganic macromolecule, which is composed of a certain structure of multi-metal atoms and heteroatoms and is a group of cluster compounds bridged by oxygen atoms. Due to its unique electronic properties and diverse structures, polyoxometalates have been widely used in various fields such as materials, catalysis, and supercapacitors. Co 4 P 2 W 18is a unique polyoxometalate with a unique morphology, stable atomic composition, and a certain size. Through experimental research, it is found that Co 4 P 2 W 18 has good water solubility and exists in the form of relatively large anions in ultrapure water. It is negatively charged and can adsorb a large amount of positively charged tris(bipyridine)ruthenium, providing the feasibility for it to become an excellent host material for luminescent substances. Among them, Co 4 P 2 W 18 is the abbreviated molecular formula of the polyoxometalate in this application. The full name of Co 4 P 2 W 18 is K 10 Co 4 (H 2 O) 2 (PW 9 O 34 ) 2 .

[0012] The present invention also provides a method for preparing a composite material, including the following steps: Add tungstate, cobalt salt, phosphate, and hydrochloric acid to water, heat under reflux, cool, and filter to obtain a filtrate; Add a chloride salt to the filtrate and filter to obtain a precipitate; Dissolve the precipitate and perform recrystallization to obtain the polyoxometalate; Disperse dichlorotris(2,2′-bipyridine)ruthenium(II) hexahydrate (Ru(bpy) 3 Cl 2 ·6H 2 O) in water to obtain a dichlorotris(2,2′-bipyridine)ruthenium(II) solution, and disperse the polyoxometalate in water to obtain a polyoxometalate solution; Under the conditions of heating and stirring, dropwise add the polyoxometalate solution to the dichlorotris(2,2′-bipyridine)ruthenium(II) solution to obtain the composite material.

[0013] Preparing the polyoxometalate by the method of heating under reflux effectively improves the yield and purity of the metal oxalate.

[0014] By dropwise adding the polyoxometalate solution to the dichlorotris(2,2′-bipyridine)ruthenium(II) solution and combining with the heating condition, not only the reaction rate is effectively improved, but also the uniform loading of tris(bipyridine)ruthenium is effectively ensured, thereby ensuring the electrochemiluminescence performance and stability of the composite material (Ru-Co 4 P 2 W 18 ) as an electrochemiluminescent material.

[0015] Among them, after gradually adding a polyoxometalate solution drop by drop to a solution of dichlorotris(2,2'-dipyridyl)ruthenium(II), the cation (Ru(bpy) 3 2- ) in dichlorotris(2,2'-dipyridyl)ruthenium(II) dissociates from the anion (Cl - ), and the metal cation (K + ) in the polyoxometalate dissociates from the polyacid anion (Co 4 (H 2 O) 2 (PW 9 O 34 ) 2 10- ), so that the cation (Ru(bpy) 3 2- ) combines with the polyacid anion (Co 4 (H 2 O) 2 (PW 9 O 34 ) 2 10- ) to form a Ru-Co 4 P 2 W 18 composite material, that is, [Ru(bpy) 3 5 [Co 4 (H 2 O) 2 (PW 9 O 34 ) 2 composite material.

[0016] Preferably, the temperature of the heating reflux is 110 °C to 130 °C, and the time is 10 h to 14 h.

[0017] Preferably, the temperature of the heating reflux is 120 °C.

[0018] Preferably, the temperature of the recrystallization is 3 °C to 8 °C.

[0019] Preferably, the heating temperature for slowly adding the polyoxometalate solution is 60 °C to 70 °C.

[0020] Preferably, the mass ratio of the tungstate, cobalt salt, phosphate and chloride is 10 - 20: 1.8 g - 3.9: 0.48 - 0.96: 10 - 20.

[0021] Preferably, the dichlorotris(2,2'-dipyridyl)ruthenium(II) hexahydrate (Ru(bpy) 3 Cl​2 ·6H 2 O) and the mass ratio of the tungstate to the polyoxometalate is 18.7 to 37.4: 274.1 to 548.2.

[0022] Preferably, the tungstate is selected from Na 2 WO 4 ·2H 2 O and / or Na 2 WO 4 .

[0023] Preferably, the cobalt salt is selected from Co(NO 3 ) 2 and / or Co(NO 3 ) 2 ·6H 2 O.

[0024] Preferably, the phosphate is selected from Na 2 HPO 4 .

[0025] Preferably, the chloride salt is selected from KCl.

[0026] The present invention also provides an application of the composite material as described in the present invention as an electrochemiluminescent material.

[0027] The present invention also provides a sensor, comprising the composite material as described in the present invention.

[0028] Preferably, the sensor is an electrochemiluminescent sensor.

[0029] Preferably, the preparation method of the electrochemiluminescent sensor comprises the following steps: S1. Preparation of polyoxometalate Co 4 P 2 W 18 {K 10 Co 4 (H 2 O) 2 (PW 9 O 34 ) 2 ·20H 2 O}: 10 g to 20 g of Na 2 WO 4 ·2H 2 O, 1.8 g to 3.9 g of Co(NO 3 ) 2 ·6H 2 O, 0.48 g to 0.96 g of Na 2 HPO 4Mix with 3.1 mL to 6.2 mL of 6 M hydrochloric acid aqueous solution and add it to 100 mL of water. Immediately, an insoluble light purple substance is produced, and the upper layer is a light red to dark red solution, obtaining a mixture; heat the mixture under reflux at a temperature of 110 °C to 130 °C for 12 h. When the mixture cools, the insoluble light purple solid is filtered off to obtain a filtrate; add an excess of KCl (10 g to 20 g) to the filtrate, and immediately a precipitate is formed; filter out the precipitate to obtain a precipitate; dissolve the precipitate in boiling water to obtain a mixed solution, and perform recrystallization on the mixed solution at 5 °C overnight to obtain blue-violet crystals, namely Co 4 P 2 W 18 .

[0030] S2, Ru-Co 4 P 2 W 18 Preparation of Disperse 18.7 mg to 37.4 mg of ruthenium(II) tris(2,2′-dipyridyl) dichloride hexahydrate (Ru(bpy) 3 Cl 2 ·6H 2 O) and 274.1 mg to 548.2 mg of blue-violet crystals Co 4 P 2 W 18 in 10 mL of deionized water respectively and stir for 10 min to obtain Ru(bpy) 3 Cl 2 solution and Co 4 P 2 W 18 solution; subsequently, continuously stir the Ru(bpy) 3 Cl 2 solution at a temperature of 65 °C, slowly add Co 4 P 2 W 18 solution, making the mixed solution change from orange-red to khaki, and the mixed solution becomes turbid. Continue to stir for 3 h, then collect the solid product by centrifugal washing with water and ethanol, and dry the solid product overnight at a temperature of 60 °C to obtain a solid powder; after grinding the solid powder, obtain Ru-Co 4 P 2 W 18 nanoparticles.

[0031] S3, Preparation of Fe-MoO v : Mix 0.30 g to 0.60 g of tannic acid (TA), 0.215 g to 0.43 g of sodium molybdate heptahydrate (Na2 MoO 4 ·7H 2 O) and 0.395 g to 0.79 g of ferric chloride (FeCl 3 ) were dissolved in 35 mL of distilled water, stirred for 30 min to obtain a mixed solution; the mixed solution was transferred to a 50 mL Teflon-lined autoclave and reacted at 160 °C for 10 h, the solid product was collected, and the solid product was washed three times with distilled water to obtain Fe-MoO v .

[0032] S4, Fe-MoO v Preparation of Fe-MoO 10 mg to 20 mg of Fe-MoO v was dispersed in 30 mL of deionized water and sonicated for 8 h to obtain an Fe-MoO v solution; 200 mg to 400 mg of 4-amino-2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO-NH 2 ) was fully dissolved in 80 mL of deionized water and magnetically stirred for 20 min to obtain a TEMPO-NH 2 solution; 100 mg to 200 mg of dopamine hydrochloride was dissolved in 20 mL of deionized water to obtain a dopamine hydrochloride solution; the dopamine hydrochloride solution was quickly injected into the TEMPO-NH 2 solution, stirred for 4 h, and then quickly injected into the Fe-MoO v solution, stirred for 5 h, and the solid product was collected by centrifugal washing in water and ethanol, and the solid product was dried overnight at 60 °C to obtain a solid powder, and after grinding the solid powder, FMP nanoparticles were obtained.

[0033] S5. Preparation of aptamer-incubated FMP: The carboxyl-modified aptamer apta 1 (5'-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3') was first activated by amide condensation, specifically including: adding 50 μL of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) with a concentration of 5 mg / mL and 100 μL of N-hydroxysuccinimide (NHS) with a concentration of 5 mg / mL to MES buffer solution (pH 6.0, 50 mM), and then adding 200 μL to 400 μL of the aptamer apta 1(2.5 μM), incubate for 30 min, then add 500 μL of an aqueous solution of FMP nanoparticles with a concentration of 1 mg / mL, react at room temperature for 4 h to obtain a mixed solution; centrifuge the mixed solution at 8000 rpm for 10 min to remove the unbound aptamer apta 1 , obtain a precipitate; resuspend the precipitate in 500 μL of 10 mM PBS phosphate buffer solution (pH 7.4) containing BSA (0.5 % w / v) and 0.05 % (v / v) Tween-20 to obtain an aptamer-incubated FMP solution, and store it at 4 °C.

[0034] S6. Preparation of electrochemiluminescence sensor: 1) Polish a glassy carbon electrode with a diameter of 4 mm successively with 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders, and rinse it thoroughly with ultrapure water; 2) Ultrasonicate Ru-Co 4 P 2 W 18 until all the particles are uniformly dispersed in water to make a suspension of Ru-Co 4 P 2 W 18 with a concentration of 3 - 6 mg / mL, drop 10 μL of the suspension on the surface of the glassy carbon electrode washed in step 1) as a sensing substrate, and place it at 37 °C to dry; 3) Drop 10 μL of 0.4 % wt chitosan solution on the surface of the glassy carbon electrode dried in step 2), and place it at 37 °C to dry; 4) Add 100 μL of DNA 1 (5'-HOOC-GAGCTGAGCG-3') to a mixture of N-hydroxysuccinimide (NHS) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) with a concentration of 1 mg / mL, stir well, then drop 10 μL onto the glassy carbon electrode dried in step 3), and place it at 37 °C to dry; then, rinse it three times with PBS buffer solution at pH 7.4 to remove the unbound DNA 1 and the remaining EDC and NHS, and place it at 37 °C to dry; 5) Drop 3 μL of a bovine serum albumin solution with a mass fraction of 1 - 3% on the surface of the glassy carbon electrode dried in step 4) to block the non-specific active sites on the electrode surface, rinse the electrode surface with PBS phosphate buffer solution at pH 7.4, and place it at 4 °C to dry; 6) Drop 5 μL of the FMP solution incubated with the aptamer at a concentration of 1 mg / mL onto the surface of the glassy carbon electrode dried in step 5), rinse the electrode surface with phosphate buffer solution PBS at pH 7.4, and place it at 4 °C to dry. After construction, an electrochemiluminescence sensor is obtained.

[0035] Among them, the DNA 1 has the nucleotide sequence shown in SEQ ID No.1; The sequence of SEQ ID No.1 is: GAGCTGAGCG; apta 1 has the nucleotide sequence shown in SEQ ID No.2; The sequence of SEQ ID No.2 is: CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.

[0036] Preferably, the sensor is used to detect phthalate esters (PAEs) in water.

[0037] Preferably, the electrochemiluminescence sensor is used to detect dibutyl phthalate (DBP) in water. The detection method includes two types: electrochemiluminescence test and colorimetric analysis test. Among them, The colorimetric analysis test includes the following steps: (1) Immerse the constructed electrochemiluminescence sensor in an immersion solution containing 2 mL of PBS buffer solution (pH 4.0 - 3.0) with dibutyl phthalate for 10 min; wash the electrochemiluminescence sensor once with 1 mL of PBS buffer solution at pH 4.0 - 3.0, and re-inject the washing solution into the immersion solution; at this time, the electrochemiluminescence sensor can be used for electrochemiluminescence test; (2) Add 200 μL of 3% hydrogen peroxide solution to the immersion solution, let it stand for 5 min, then add 100 μL of TMB solution. It can be observed that the solution changes from colorless to blue. The higher the concentration of DBP in the immersion solution, the deeper the blue color. The test is completed.

[0038] The electrochemiluminescence test includes the following steps: (1) Use a three-electrode system of an electrochemical analyzer for testing. The saturated silver / silver chloride electrode is used as the reference electrode, the platinum electrode is used as the auxiliary electrode, and the prepared electrochemiluminescence sensor is used as the working electrode. The test is carried out in 10 mL of PBS at pH 6.0 - 8.0 and 50 mM - 180 mM of potassium persulfate solution; (2)Detect dibutyl phthalate (DBP) by cyclic voltammetry, set the voltage range to -1.5 V to 0 V, and the voltage of the photomultiplier tube to 800 V; (3)After the electrode device is completed, start the instrument, detect the electrochemiluminescence signal intensity corresponding to different concentrations of DBP, and plot the working curve; (4)Replace the DBP standard solution with the DBP sample solution to be measured for detection, and obtain the concentration of DBP in the DBP sample solution to be measured.

[0039] Preferably, the sensor is used to detect dibutyl phthalate (DBP) in water, and the linear range of electrochemiluminescence detection of the sensor for dibutyl phthalate (DBP) is 0.1 pg / mL to 100 ng / mL, and the visual colorimetric detection linear range is 0.1 ng / mL to 100 ng / mL.

[0040] Preferably, the sensor is used to detect dibutyl phthalate (DBP) in the ocean or river.

[0041] Advantages of the present invention: The composite material of the present invention uses the successfully synthesized polyoxometalate K10Co4(H2O)2(PW9O34)2·20H2O as a solid support material to load ruthenium terpyridine through electrostatic interaction to obtain a composite material. Using this composite material as the electrochemiluminescence material (Ru-Co 4 P 2 W 18 ) in the electrochemiluminescence sensor. Due to the presence of the polyoxometalate K10Co4(H2O)2(PW9O34)2·20H2O, the electrochemiluminescence performance and stability of ruthenium terpyridine are significantly improved. It solves the problem of low luminescence stability of the existing ruthenium terpyridine as an electrochemiluminescence reagent. At the same time, due to the unique structure and electronic properties of the polyoxometalate, the luminescence signal is further improved.

[0042] The sensor of the present invention, by using a composite material (Ru-Co 4 P 2 W 18)(As an electrochemiluminescence material in an electrochemiluminescence sensor, it is used for the detection of dibutyl phthalate (DBP) in water. It has the advantages of short response time, wide linear range, low detection limit, good stability and reproducibility, and can achieve simple, fast, highly sensitive and specific detection. Through experimental determination, the linear range of the electrochemiluminescence detection of DBP by the electrochemiluminescence sensor of the present invention is 0.1 pg / mL to 100 ng / mL. The visual colorimetric detection linear range is 0.1 ng / mL to 100 ng / mL, which significantly improves the sensitivity and accuracy of detection. In the technical field of electrochemiluminescence materials, it has great popularization and application value.) Description of the Drawings

[0043] Figure 1 SEM image of the Ru-Co 4 P 2 W 18 nanoparticles prepared in Example 1; Figure 2 SEM image of the Ru-Co 4 P 2 W 18 TEM image of the nanoparticles prepared in Example 1; Figure 3 SEM image of the Ru-Co 4 P 2 W 18 EDS image of the nanoparticles prepared in Example 1; Figure 4 SEM image of the Ru-Co 4 P 2 W 18 EDS energy spectrum surface scan analysis result image of the nanoparticles; Figure 5 Infrared spectrum image of Co 4 P 2 W 18 prepared in S4 of Example 1; Figure 6 Electrochemiluminescence working curve; Figure 7 SEM image of the Ru-Co 4 P 2 W 18 Electrochemiluminescence stability test results of the nanoparticles prepared in Example 1. Detailed Embodiments

[0044] The embodiments of the present invention will be described below with reference to the preferred embodiments. Those skilled in the art can easily understand the other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be understood that the preferred embodiments are only for illustrating the present invention, rather than for limiting the protection scope of the present invention.

[0045] Example 1 A preparation method of a composite material of ruthenium terpyridine and polyoxometalate, comprising the following steps: S1. Add 20 g of Na 2 WO 4 ·2H 2 O, 3.9 g of Co(NO 3 ) 2 ·6H 2 O, 0.96 g of Na 2 HPO 4 and 6.2 mL of 6 M hydrochloric acid aqueous solution into 100 mL of water to obtain a mixture; S2. Heat the mixture obtained in S1 under reflux at a temperature of 120 °C for 12 h, cool, and filter to obtain a filtrate; S3. Add an excess of KCl (20 g) to the filtrate obtained in S2 to obtain a precipitate; S4. Dissolve the precipitate obtained in S3 in boiling water, perform recrystallization, and recrystallize overnight at a temperature of 5 °C to obtain blue-violet crystals, namely Co 4 P 2 W 18 ; S5. Disperse 37.4 mg of dichlorotris(2,2'-dipyridyl)ruthenium(II) hexahydrate (Ru(bpy) 3 Cl 2 ·6H 2 O) and 548.2 mg of Co 4 P 2 W 18 respectively in 10 mL of deionized water and stir for 10 min to obtain a Ru(bpy) 3 Cl 2 solution and a Co 4 P 2 W 18 solution; S6. Continuously stir the Ru(bpy) 3 Cl 2 solution at a temperature of 65 °C, and slowly add dropwise Co4 P 2 W 18 The solution was continuously stirred for 3 h, and the solid product was collected by centrifugal washing with water and ethanol. The solid product was dried overnight at 60 °C to obtain a solid powder, and the solid powder was ground to obtain Ru-Co 4 P 2 W 18 nanoparticles.

[0046] Example 2 A preparation method of a composite material of ruthenium terpyridine and polyoxometalate, comprising the following steps: S1. Add 10 g of Na 2 WO 4 ·2H 2 O, 1.8 g of Co(NO 3 ) 2 ·6H 2 O, 0.48 g of Na 2 HPO 4 and 3.1 mL of 6 M hydrochloric acid aqueous solution to 100 mL of water to obtain a mixture; S2. Heat the mixture obtained in S1 under reflux at 110 °C for 12 h, cool, and filter to obtain a filtrate; S3. Add an excess of KCl (20 g) to the filtrate obtained in S2 to obtain a precipitate; S4. Dissolve the precipitate obtained in S3 in boiling water, perform recrystallization, and recrystallize overnight at 5 °C to obtain blue-violet crystals, namely Co 4 P 2 W 18 ; S5. 18.7 mg of dichlorotris(2,2'-dipyridyl)ruthenium(II) hexahydrate (Ru(bpy) 3 Cl 2 ·6H 2 O) and 274.1 mg of Co 4 P 2 W 18 were separately dispersed in 10 mL of deionized water and stirred for 10 min to obtain a Ru(bpy) 3 Cl 2 solution and a Co 4 P 2 W 18 solution; S6. Continuously stir the Ru(bpy) 3 Cl 2 solution at 65 °C, and slowly add dropwise Co 4 P2 W 18 The solution was continuously stirred for 3 h, and the solid product was collected by centrifugal washing in water and ethanol. The solid product was dried overnight at 60 °C to obtain a solid powder, and the solid powder was ground to obtain Ru-Co 4 P 2 W 18 nanoparticles.

[0047] Example 3 A preparation method of a composite material of ruthenium terpyridine and polyoxometalate, comprising the following steps: S1. Add 15 g of Na 2 WO 4 ·2H 2 O, 2.7 g of Co(NO 3 ) 2 ·6H 2 O, 0.72 g of Na 2 HPO 4 and 4.65 mL of 6 M hydrochloric acid aqueous solution to 100 mL of water to obtain a mixture; S2. Heat the mixture obtained in S1 under reflux at 120 °C for 12 h, cool, and filter to obtain a filtrate; S3. Add an excess of KCl (15 g) to the filtrate obtained in S2 to obtain a precipitate; S4. Dissolve the precipitate obtained in S3 in boiling water, perform recrystallization, and recrystallize overnight at 5 °C to obtain blue-violet crystals, namely Co 4 P 2 W 18 ; S5. 28.05 mg of dichlorotris(2,2'-bipyridine)ruthenium(II) hexahydrate (Ru(bpy) 3 Cl 2 ·6H 2 O) and 411.15 mg of Co 4 P 2 W 18 were respectively dispersed in 10 mL of deionized water and stirred for 10 min to obtain Ru(bpy) 3 Cl 2 solution and Co 4 P 2 W 18 solution; S6. Continuously stir the Ru(bpy) 3 Cl 2 solution at 65 °C, and slowly add Co 4 P 2 W18 The solution was continuously stirred for 3 h, and the solid product was collected by centrifugal washing in water and ethanol. The solid product was dried overnight at 60 °C to obtain a solid powder, and the solid powder was ground to obtain Ru-Co 4 P 2 W 18 nanoparticles.

[0048] Example 4 A preparation method of an electrochemiluminescence sensor, comprising the following steps: Step (1) Preparation of aptamer-incubated FMP: S1. Dissolve 0.60 g of tannic acid (TA), 0.43 g of sodium molybdate dihydrate (Na 2 MoO 4 ·7H 2 O) and 0.79 g of ferric chloride (FeCl 3 ) in 35 mL of distilled water, stir for 30 min to obtain a mixed solution; transfer the mixed solution to a 50 mL Teflon-lined autoclave and react at 160 °C for 10 h, collect the solid product, and wash the solid product three times with distilled water to obtain Fe-MoO v ; S2. Disperse 20 mg of the Fe-MoO v obtained in S1 into 30 mL of deionized water and sonicate for 8 h to obtain an Fe-MoO v solution; dissolve 400 mg of 4-amino-2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO-NH 2 ) in 80 mL of deionized water and stir magnetically for 20 min to obtain a TEMPO-NH 2 solution; dissolve 200 mg of dopamine hydrochloride in 20 mL of deionized water to obtain a dopamine hydrochloride solution; quickly inject the dopamine hydrochloride solution into the TEMPO-NH 2 solution, stir for 4 h, then quickly inject the Fe-MoO v solution, stir for 5 h, collect the solid product by centrifugal washing in water and ethanol, dry the solid product overnight at 60 °C to obtain a solid powder, and grind the solid powder to obtain FMP nanoparticles; S3. The carboxyl-modified aptamer apta 1Activation is first carried out through amide condensation, specifically including: adding 50 μL of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) with a concentration of 5 mg / mL and 100 μL of N-hydroxysuccinimide (NHS) with a concentration of 5 mg / mL into MES buffer solution (pH 6.0, 50 mM), and then adding 400 μL of aptamer apta 1 (2.5 μM), incubating for 30 min, and then adding 500 μL of an aqueous solution of FMP nanoparticles in S2 with a concentration of 1 mg / mL, reacting at room temperature for 4 h to obtain a mixed solution; centrifuging the mixed solution at 8000 rpm for 10 min to remove the unbound aptamer apta 1 , obtaining a precipitate, which is the FMP incubated with the aptamer; resuspending the precipitate in 500 μL of 10 mM PBS phosphate buffer solution (pH 7.4) containing BSA (0.5 % w / v) and 0.05 % (v / v) Tween-20 to obtain a solution of FMP incubated with the aptamer, and storing it at 4 °C.

[0049] Among them, the nucleotide sequence of the aptamer apta 1 is shown in SEQ ID No.2; The sequence of SEQ ID No.2 is: CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.

[0050] The carboxyl-modified aptamer apta 1 is 5'-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3'.

[0051] Step (2) Preparation of the electrochemiluminescence sensor: S1. Polish a glassy carbon electrode with a diameter of 4 mm successively with 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders, and rinse it thoroughly with ultrapure water; S2. Ultrasonicate the Ru-Co 4 P 2 W 18 prepared in Example 1 until all the particles are uniformly dispersed in water to obtain a suspension of Ru-Co 4 P 2 W 18 with a concentration of 6 mg / mL, drop 10 μL of the suspension on the surface of the glassy carbon electrode washed in S1 as a sensing substrate, and dry it at 37 °C; S3. Drop 10 μL of 0.4 %wt chitosan solution onto the surface of the air-dried glassy carbon electrode in S2, and place it at 37 °C to dry. S4. Add 100 μL of DNA 1 (5'-HOOC-GAGCTGAGCG-3') to a mixture of N-hydroxysuccinimide (NHS) with a concentration of 1 mg / mL and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) with a concentration of 1 mg / mL. After stirring well, drop 10 μL onto the air-dried glassy carbon electrode in S3, and place it at 37 °C to dry. Then, rinse it three times with PBS buffer solution at pH 7.4 to remove unbound DNA 1 as well as residual EDC and NHS, and place it at 37 °C to dry. S5. Drop 3 μL of bovine serum albumin solution with a mass fraction of 1-3% onto the surface of the air-dried glassy carbon electrode in step S4 to block non-specific active sites on the electrode surface. Rinse the electrode surface with phosphate buffer solution PBS at pH 7.4, and place it at 4 °C to dry. S6. Drop 5 μL of the FMP solution incubated with the aptamer prepared in step (1) with a concentration of 1 mg / mL onto the surface of the air-dried glassy carbon electrode in step S5. Rinse the electrode surface with phosphate buffer solution PBS at pH 7.4, and place it at 4 °C to dry. After construction, an electrochemiluminescence sensor is obtained.

[0052] Example 5 A preparation method of an electrochemiluminescence sensor, comprising the following steps: Step (1) Preparation of aptamer-incubated FMP: S1. Dissolve 0.30 g of tannic acid (TA), 0.215 g of sodium molybdate dihydrate (Na 2 MoO 4 ·7H 2 O) and 0.395 g of ferric chloride (FeCl 3 ) in 35 mL of distilled water, stir for 30 min to obtain a mixed solution; transfer the mixed solution to a 50 mL Teflon-lined autoclave, and react at a temperature of 160 °C for 10 h. Collect the solid product, and wash the solid product three times with distilled water to obtain Fe-MoO v . S2. Disperse 10 mg of Fe-MoO obtained in S1 v in 30 mL of deionized water, and ultrasonicate for 8 h to obtain an Fe-MoO v solution; add 200 mg of 4-amino-2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO-NH 2)(Dissolve it thoroughly in 80 mL of deionized water and stir magnetically for 20 min to obtain a TEMPO-NH 2 solution; Dissolve 100 mg of dopamine hydrochloride in 20 mL of deionized water to obtain a dopamine hydrochloride solution; Quickly inject the dopamine hydrochloride solution into the TEMPO-NH 2 solution, stir for 4 h, then quickly inject the Fe-MoO v solution, stir for 5 h, collect the solid product by centrifugal washing in water and ethanol, dry the solid product overnight at a temperature of 60 °C to obtain a solid powder, and grind the solid powder to obtain FMP nanoparticles.

[0053] S3. Activate the carboxyl-modified aptamer apta 1 by amide condensation first, specifically including: Add 50 μL of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) with a concentration of 5 mg / mL and 100 μL of N-hydroxysuccinimide (NHS) with a concentration of 5 mg / mL to the MES buffer solution (pH 6.0, 50 mM), then add 400 μL of the aptamer apta 1 (2.5 μM), incubate for 30 min, then add 500 μL of the FMP nanoparticle solution in S2 with a concentration of 1 mg / mL, react at room temperature for 4 h to obtain a mixed solution; Centrifuge the mixed solution at 8000 rpm for 10 min to remove the unbound aptamer apta 1 , obtain a precipitate, which is the FMP incubated with the aptamer; Resuspend the precipitate in 500 μL of 10 mM PBS phosphate buffer solution (pH 7.4) containing BSA (0.5 % w / v) and 0.05 % (v / v) Tween-20 to obtain an FMP solution incubated with the aptamer, and store it at a temperature of 4 °C.

[0054] Among them, the nucleotide sequence of the aptamer apta 1 is shown in SEQ ID No.2; The sequence of SEQ ID No.2 is: CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.

[0055] The carboxyl-modified aptamer apta 1 is 5'-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3'.

[0056] Step (2) Preparation of the electrochemiluminescence sensor: S1. Polish a glassy carbon electrode with a diameter of 4 mm successively using 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders, and rinse it thoroughly with ultrapure water; S2. Ultrasonically disperse all the particles of Ru-Co 4 P 2 W 18 prepared in Example 2 in water until all particles are uniformly dispersed to make a Ru-Co 4 P 2 W 18 suspension with a concentration of 3 mg / mL. Drop 10 µL of the suspension on the surface of the glassy carbon electrode washed in S1 as the sensing substrate, and place it at 37 °C to dry; S3. Drop 10 μL of 0.4 %wt chitosan solution on the surface of the glassy carbon electrode dried in S2, and place it at 37 °C to dry; S4. Add 100 μL of DNA 1 (5'-HOOC-GAGCTGAGCG-3') to a mixture of N-hydroxysuccinimide (NHS) with a concentration of 1 mg / mL and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) with a concentration of 1 mg / mL. After stirring well, drop 10 μL onto the glassy carbon electrode dried in S3, and place it at 37 °C to dry; then, rinse it three times with PBS buffer solution at pH 7.4 to remove unbound DNA 1 as well as residual EDC and NHS, and place it at 37 °C to dry; 5) Drop 3 µL of bovine serum albumin solution with a mass fraction of 1 - 3 % on the surface of the glassy carbon electrode dried in step 4) to block non-specific active sites on the electrode surface. Rinse the electrode surface with PBS buffer solution at pH 7.4, and place it at 4 °C to dry; 6) Drop 5 µL of FMP solution incubated with the aptamer prepared in step (1) with a concentration of 1 mg / mL on the surface of the glassy carbon electrode dried in step 5). Rinse the electrode surface with PBS buffer solution at pH 7.4, and place it at 4 °C to dry. After completion, an electrochemiluminescence sensor is obtained.

[0057] Example 6 A method for preparing an electrochemiluminescence sensor, comprising the following steps: Step (1) Preparation of aptamer-incubated FMP: S1. Dissolve 0.45 g of tannic acid (TA), 0.323 g of sodium molybdate dihydrate (Na 2 MoO 4 ·7H 2 O) and 0.593 g of ferric chloride (FeCl3 ) was dissolved in 35 mL of distilled water and stirred for 30 min to obtain a mixed solution; the mixed solution was transferred to a 50 mL Teflon-lined autoclave and reacted at 160 °C for 10 h. The solid product was collected and washed three times with distilled water to obtain Fe-MoO v ; S2. 15 mg of Fe-MoO obtained in S1 v was dispersed in 30 mL of deionized water and sonicated for 8 h to obtain an Fe-MoO v solution; 300 mg of 4-amino-2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO-NH 2 ) was fully dissolved in 80 mL of deionized water and magnetically stirred for 20 min to obtain a TEMPO-NH 2 solution; 150 mg of dopamine hydrochloride was dissolved in 20 mL of deionized water to obtain a dopamine hydrochloride solution; the dopamine hydrochloride solution was quickly injected into the TEMPO-NH 2 solution. After stirring for 4 h, it was then quickly injected into the Fe-MoO v solution. After stirring for 5 h, the solid product was collected by centrifugal washing in water and ethanol, and the solid product was dried overnight at 60 °C. The solid powder was ground to obtain FMP nanoparticles.

[0058] S3. The carboxyl-modified aptamer apta 1 was first activated by amide condensation, specifically including: adding 50 μL of a mixture of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) at a concentration of 5 mg / mL and N-hydroxysuccinimide (NHS) at a concentration of 5 mg / mL dissolved in MES buffer solution (pH 6, 50 mM) to 400 μL of the aptamer apta 1 (2.5 μM), incubating for 30 min, and then adding 500 μL of an aqueous solution of FMP nanoparticles in S2 at a concentration of 1 mg / mL. The reaction was carried out at room temperature for 4 h to obtain a mixed solution; the mixed solution was centrifuged at 8000 rpm for 10 min to remove the unbound aptamer apta 1 , and the precipitate obtained was the FMP incubated with the aptamer; the precipitate was resuspended in 500 μL of 10 mM PBS phosphate buffer solution (pH 7.4) containing BSA (0.5% w / v) and 0.05% (v / v) Tween-20 to obtain an FMP solution incubated with the aptamer, which was stored at 4 °C.

[0059] Among them, the aptamer apta1 The nucleotide sequence of 1 is shown in SEQ ID No. 2; The sequence of SEQ ID No. 2 is: CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.

[0060] Carboxyl-modified aptamer apta 1 is 5'-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3'.

[0061] Step (2) Preparation of the electrochemiluminescence sensor: S1. A glassy carbon electrode with a diameter of 4 mm is polished successively with 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders, and rinsed thoroughly with ultrapure water; S2. The Ru-Co 4 P 2 W 18 prepared in Example 3 is sonicated until all particles are uniformly dispersed in water to form a Ru-Co 4 P 2 W 18 suspension with a concentration of 4.5 mg / mL. 10 µL of the suspension is dropped onto the surface of the glassy carbon electrode rinsed in S1 as the sensing substrate, and it is left to dry at 37 °C; S3. 10 μL of a 0.4 %wt chitosan solution is dropped onto the surface of the glassy carbon electrode dried in S2, and it is left to dry at 37 °C; S4. 100 μL of DNA 1 (5'-HOOC-GAGCTGAGCG-3') is added to a mixture of N-hydroxysuccinimide (NHS) with a concentration of 1 mg / mL and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) with a concentration of 1 mg / mL. After thorough stirring, 10 μL is dropped onto the glassy carbon electrode dried in S3, and it is left to dry at 37 °C; then, it is rinsed three times with a PBS buffer solution at pH 7.4 to remove unbound DNA 1 as well as residual EDC and NHS, and left to dry at 37 °C; S5. 3 µL of a bovine serum albumin solution with a mass fraction of 1-3% is dropped onto the surface of the glassy carbon electrode dried in step S4 to block the non-specific active sites on the electrode surface. The electrode surface is rinsed with a phosphate buffer solution PBS at pH 7.4 and left to dry at 4 °C; S6. Drop 5 μL of the FMP solution incubated with the aptamer prepared in step (1) at a concentration of 1 mg / mL onto the surface of the glassy carbon electrode dried in step S5. Rinse the electrode surface with phosphate buffer solution PBS at pH 7.4, and place it at 4 °C to dry. After construction, an electrochemiluminescence sensor is obtained.

[0062] Example 7 A method for preparing an electrochemiluminescence sensor, comprising the following steps: Step (1) Preparation of aptamer-incubated MnO x Quencher preparation Add 100 mg of KMnO 4 to 50 mL of water and stir vigorously for 0.5 h. Then, inject 1 mL of oleic acid (OA) into the above mixture and stir vigorously at room temperature for 5 h. After that, the rough brownish-black product is centrifuged and washed repeatedly with deionized water and alcohol to remove any residual reactants. The precipitate is dried in vacuo at 60 °C. Add 0.25 g of MnO x , 80 mL of toluene and 0.5 mL of APTES into a three-necked flask and stir rapidly at 120 °C for 6 h. The mixture is centrifuged at 6500 rpm for 10 min, washed three times with water, and then collected. The precipitate is dried in vacuo at 60 °C to obtain amino-modified MnO x nanoparticles.

[0063] The carboxyl-modified aptamer apta 1 is first activated by amide condensation, specifically including: adding 50 μL of a mixture of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) at a concentration of 5 mg / mL and N-hydroxysuccinimide (NHS) at a concentration of 5 mg / mL dissolved in MES buffer solution (pH 6, 50 mM) to 400 μL of the aptamer apta 1 (2.5 μM), incubating for 30 min, and then adding 500 μL of an aqueous solution of the MnO x nanoparticles in (1) at a concentration of 1 mg / mL, reacting at room temperature for 4 h to obtain a mixed solution; centrifuging the mixed solution at 8000 rpm for 10 min to remove the unbound aptamer apta 1 , obtaining a precipitate, which is the aptamer-incubated MnO x ; resuspending the precipitate in 500 μL of 10 mM PBS phosphate buffer solution (pH 7.4) containing BSA (0.5 % w / v) and 0.05 % (v / v) Tween-20 to obtain an aptamer-incubated MnO x solution, and storing it at a temperature of 4 °C; Among them, the aptamer apta 1 has a nucleotide sequence as shown in SEQ ID No. 2; The sequence of SEQ ID No. 2 is: CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.

[0064] The carboxyl-modified aptamer apta 1 is 5'-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3'.

[0065] Step (2) Preparation of the electrochemiluminescence sensor: S1. A glassy carbon electrode with a diameter of 4 mm is polished successively with 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders, and rinsed thoroughly with ultrapure water; S2. The Ru-Co 4 P 2 W 18 prepared in Example 1 is ultrasonicated until all particles are uniformly dispersed in water to obtain a Ru-Co 4 P 2 W 18 suspension with a concentration of 6 mg / mL. 10 µL of the suspension is dropped onto the surface of the glassy carbon electrode washed in S1 as the sensing substrate, and it is placed at 37 °C to dry; S3. 10 μL of 0.4 %wt chitosan solution is dropped onto the surface of the glassy carbon electrode dried in S2, and it is placed at 37 °C to dry; S4. 100 μL of DNA 1 (5'-HOOC-GAGCTGAGCG-3') is added to a mixture of N-hydroxysuccinimide (NHS) with a concentration of 1 mg / mL and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) with a concentration of 1 mg / mL. After stirring thoroughly, 10 μL is dropped onto the glassy carbon electrode dried in S3, and it is placed at 37 °C to dry; then, it is rinsed three times with PBS buffer solution at pH 7.4 to remove unbound DNA 1 as well as residual EDC and NHS, and it is placed at 37 °C to dry; S5. 3 µL of a bovine serum albumin solution with a mass fraction of 1-3% is dropped onto the surface of the glassy carbon electrode dried in step S4 to block the non-specific active sites on the electrode surface. The electrode surface is rinsed with phosphate buffer solution PBS at pH 7.4, and it is placed at 4 °C to dry; S6. Drop 5 μL of the aptamer-incubated MnO solution prepared in step (1) with a concentration of 1 mg / mL onto the surface of the glassy carbon electrode dried in step S5. Rinse the electrode surface with phosphate buffer solution PBS at pH 7.4, and place it to dry at 4°C. After completion of construction, an electrochemiluminescence sensor is obtained. x Solution, rinse the electrode surface with phosphate buffer solution PBS at pH 7.4, and place it to dry at 4°C. After completion of construction, an electrochemiluminescence sensor is obtained.

[0066] Detection and analysis 1) Scanning electron microscopy analysis Perform scanning electron microscopy analysis on the Ru-Co 4 P 2 W 18 nanoparticles prepared in Example 1. The results are as Figure 1 shown.

[0067] From Figure 1 the analysis, it can be seen that the prepared Ru-Co 4 P 2 W 18 is in a particulate structure, with an oily substance structure similar to an organic compound covering the surface and there are voids. It can be known that Ru(bpy) 3 2+ is successfully loaded on the surface of the negatively charged Co 4 (H 2 O) 2 (PW 9 O 34 ) 2 10- polyoxometalate molecule surface, indicating that the synthesis of Ru-Co 4 P 2 W 18 is successful.

[0068] 2) Transmission electron microscopy analysis Perform transmission electron microscopy analysis on the Ru-Co 4 P 2 W 18 nanoparticles prepared in Example 1. The results are as Figure 2 shown.

[0069] From Figure 2 the analysis, it can be seen that the structure of Ru-Co 4 P 2 W 18 is lamellar, and it shows that the anionic polyoxometalate molecule Co 4 (H 2 O) 2 (PW 9 O 34 ) 2 10- and Ru(bpy) 3 2+Combined by electrostatic force into a network structure, indicating Ru-Co 4 P 2 W 18 The synthesis was successful.

[0070] 3) EDS energy spectrum analysis The Ru-Co 4 P 2 W 18 nanoparticles prepared in Example 1 were subjected to EDS analysis, and the results are as Figure 3 and Figure 4 shown.

[0071] From Figure 3 and Figure 4 it can be analyzed that the Ru-Co 4 P 2 W 18 nanoparticles contain elements such as Ru, Co, P, W, O, C, etc., and the elements of Ru, Co, P, W, O and C are evenly distributed, thus proving the successful synthesis of Ru-Co 4 P 2 W 18 .

[0072] 4) Infrared absorption spectrum analysis The Co 4 P 2 W 18 prepared in S4 of Example 1 was subjected to infrared absorption spectrum analysis, and the results are as Figure 5 shown.

[0073] From Figure 5 it can be analyzed that in the infrared fingerprint region from 1300 cm -1 to 400 cm -1 the absorption peaks that appear are consistent with Co 4 P 2 W 18 , indicating that the synthesis of Co 4 P 2 W 18 was successful.

[0074] 5) Electrochemiluminescence working curve Specific operation steps: Prepare 2 mL solutions with concentrations of 2.5×10 -5 ng / mL, 5×10 -5 ng / mL, 10 -4 ng / mL, 2×10 -4 ng / mL, 4×10 -4 ng / mL, 8×10 -4 ng / mL, 5×10 -3 ng / mL, 10-2 ng / mL, 10 -1 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 20 ng / mL, 40 ng / mL and 100 ng / mL DBP buffer solution (pH 4.0 - 3.0); Use the three - electrode system of an electrochemical analyzer for testing. The saturated silver / silver chloride electrode is used as the reference electrode, the platinum electrode is used as the auxiliary electrode, and the electrochemiluminescence sensor constructed in Example 4 is used as the working electrode. Immerse it in DBP buffer solutions of different concentrations for 10 min, then wash the electrochemiluminescence sensor once with 1 mL of PBS buffer solution with pH 4.0 - 3.0. Inject the washing solution back into the immersion solution, and then perform electrochemiluminescence testing; Detect dibutyl phthalate (DBP) by cyclic voltammetry, set the voltage range to - 1.5 V - 0 V, and the photomultiplier tube voltage to 800 V; After the electrode device is completed, start the instrument, detect the electrochemiluminescence signal intensity corresponding to different concentrations of DBP, draw the working curve, and plot the result data to obtain the working curve. The results are as Figure 6 shown.

[0075] From Figure 6 analysis, it can be seen that the working curve of the constructed electrochemiluminescence sensor has a good linear relationship, and the square of its correlation coefficient reaches 0.992. Among them, the ordinate in the working curve is the ECL emission intensity, and the abscissa is the logarithm of the DBP concentration (ng / mL). Affected by the quenching ability of FMP nanoparticles, the lower the DBP concentration, the better the FMP quenching effect, and the lower the ECL intensity. This also proves that the electrochemiluminescence sensor of the present invention has the advantages of high sensitivity and detection accuracy.

[0076] 6) Electrochemiluminescence stability test Specific operation steps: 1. Use the three - electrode system of an electrochemical analyzer for testing. The saturated silver / silver chloride electrode is used as the reference electrode, the platinum electrode is used as the auxiliary electrode, and the electrochemiluminescence sensor constructed in Example 4 is used as the working electrode. Test in 10 mL of PBS with pH 6.0 and 50 mM potassium persulfate solution; 2. Detect by cyclic voltammetry, set the voltage range to - 1.5 - 0 V, the photomultiplier tube voltage to 800 V, and continue for 85 s. The results are as Figure 7 shown.

[0077] From Figure 7 analysis, it can be seen that three ECL signals are generated within 85 s, and the ECL intensity is close to 18 ka.u. three times, and the three signal intensities are similar, thus proving Ru - Co 4 P2 W 18 Stability of electrochemiluminescence.

[0078] 7) Detection of dibutyl phthalate Colorimetric analysis test procedure: (1) Immerse the glassy carbon electrode of the sensor constructed in Example 4 into 2 mL of PBS buffer solution (pH 4.0) containing dibutyl phthalate for 10 min, then wash it once with 1 mL of PBS buffer solution at pH 4.0 and reinject the washing solution into the soaking solution; at this time, the glassy carbon electrode can be used for electrochemiluminescence testing.

[0079] (2) Add 200 μL of 3% hydrogen peroxide solution to the soaking solution, let it stand for 5 min, then add 100 μL of TMB solution. It can be observed that the solution changes from colorless to blue. The higher the concentration of DBP in the soaking solution, the deeper the blue color. The test is completed.

[0080] Electrochemiluminescence test procedure: (1) Use a three-electrode system of an electrochemical analyzer for testing. The saturated silver / silver chloride electrode is used as the reference electrode, the platinum electrode is used as the auxiliary electrode, and the electrochemiluminescence sensor prepared in Example 4 is used as the working electrode for testing in 10 mL of PBS at pH 6.0 and 50 mM potassium persulfate solution; (2) Detect dibutyl phthalate (DBP) by cyclic voltammetry, set the voltage range to -1.5 V to 0 V, and the photomultiplier tube voltage to 800 V; (3) After the electrode device is completed, start the instrument, detect the electrochemiluminescence signal intensity corresponding to different concentrations of DBP, and draw a working curve; (4) Just replace the DBP standard solution with the DBP sample solution to be tested for detection.

[0081] Colorimetric analysis test procedure: (1) Immerse the glassy carbon electrode of the electrochemiluminescence sensor constructed in Example 5 into 2 mL of PBS buffer solution (pH 3.0) containing dibutyl phthalate for 10 min, then wash it once with 1 mL of PBS buffer solution at pH 3.0 and reinject the washing solution into the soaking solution; at this time, the glassy carbon electrode can be used for electrochemiluminescence testing (2) Add 200 μL of 3% hydrogen peroxide solution to the soaking solution, let it stand for 5 min, then add 100 μL of TMB solution. It can be observed that the solution changes from colorless to blue. The higher the concentration of DBP in the soaking solution, the deeper the blue color. The test is completed.

[0082] Electrochemiluminescence test procedure: (1) The test was performed using an electrochemical analyzer three-electrode system, with a saturated silver / silver chloride electrode as the reference electrode, a platinum electrode as the auxiliary electrode, and the electrochemiluminescence sensor prepared in Example 5 as the working electrode, in 10 mL of PBS, pH = 8.0, and 150 mM potassium persulfate solution; (2) Detect dibutyl phthalate (DBP) by cyclic voltammetry, set the voltage range to -1.5 V~0 V, and the photomultiplier tube voltage to 800 V; (3) After the electrode assembly is completed, start the instrument, detect the electrochemiluminescence signal intensity corresponding to different concentrations of DBP, and draw a working curve; (4) Replace the DBP standard solution with the DBP sample solution to be tested.

[0083] In summary, the electrochemiluminescent sensor of the present invention uses a hydrothermal method to synthesize Fe-MoO v , Fe-MoO wrapped by dopamine self-aggregation v Polydopamine microparticles were formed, and then the carboxylated aptamer (apta 1 ) for signal conditioning and quenching. Specifically, with the addition of analyte (DBP), FMP-apta 1 Ru-Co 4 P 2 W 18 -DNA 1 -apta 1 - FMP sensor system broken, part of FMP-apta 1 Free in the buffer solution, and catalyzes H 2 O 2 The reduction of Ru-Co releases hydroxyl radicals (OH•), which promote the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) for colorimetric detection. 4 P 2 W 18 -DNA 1 -apta 1 -FMP sensing system is combined on the sensing interface to produce significant ECL quenching signal. By matching the visual and ECL signal intensities, acceptable prediction and accuracy analysis are achieved. At the same time, all steps can be pre-processed in advance, and the sensing system is built in advance for rapid on-site detection, avoiding the disadvantage of layer-by-layer dripping to build the sensing system during on-site detection. It realizes portable, instant, sensitive and visual detection of butyl phthalate in water samples, which has great promotion and application value in the field of electrochemiluminescent material technology.

[0084] The above embodiments are only preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art of this technology on the basis of the present invention are all within the protection scope of the present invention.

Claims

1. A composite material of terpyridine ruthenium and polyoxometalate, characterized in that: The invention comprises a polyoxometalate, wherein the polyoxometalate is loaded with terpyridine ruthenium.

2. The composite material of terpyridine ruthenium and polyoxometalate according to claim 1, characterized in that: The polyoxometalate loads the terpyridine ruthenium through electrostatic action; And / or, the polyoxometalate is selected from Co4P2W 18 .

3. A method for preparing a composite material according to claim 1 or claim 2, characterized in that: The following steps are involved: Tungstate, cobalt salt, phosphate and hydrochloric acid are added into water, heated to reflux, cooled and filtered to obtain a filtrate; Add chloride salt to the filtrate and filter to obtain a precipitate; dissolving the precipitate and recrystallizing it to obtain polyoxometalate; Dispersing dichlorotris(2,2′-bipyridine)ruthenium(II) hexahydrate (Ru(bpy)3Cl2·6H2O) in water to obtain a dichlorotris(2,2′-bipyridine)ruthenium(II) solution, and dispersing a polyoxometalate in water to obtain a polyoxometalate solution; Under heating conditions, a polyoxometalate solution is added dropwise to a dichlorotris(2,2'-bipyridine)ruthenium(II) solution to obtain a composite material.

4. The preparation method according to claim 3, characterized in that: The heating reflux temperature is 110°C to 130°C, and the time is 10 h to 14 h; And / or, the recrystallization temperature is 3°C to 8°C; And / or, the heating temperature for dropwise adding the polyoxometalate solution is 60°C to 70°C.

5. The preparation method according to claim 3, characterized in that: The mass ratio of the tungstate, cobalt salt, phosphate and chloride salt is 10~20:1.8g~3.9:0.48~0.96:10~20; And / or, the mass ratio of dichlorotris(2,2′-bipyridine)ruthenium(II) hexahydrate (Ru(bpy)3Cl2·6H2O) to polyoxometalate is 18.7-37.4:274.1-548.

2.

6. The preparation method according to claim 3, characterized in that: The tungstate is selected from Na2WO4·2H2O and / or Na2WO4; and / or, the cobalt salt is selected from Co(NO3)2 and / or Co(NO3)2·6H2O; And / or, the phosphate is selected from Na2HPO4; And / or, the chloride salt is selected from KCl.

7. Use of the composite material according to claim 1 or claim 2, characterized in that: The composite material is used as an electrochemiluminescent material.

8. A sensor, characterized in that: Comprising the composite material as claimed in claim 1 or claim 2.

9. Use of the sensor according to claim 8, characterized in that: The sensor is used to detect phthalate esters (PAEs) in water.

10. Use of the sensor according to claim 9, characterized in that: The sensor is used to detect butylene phthalate (DBP) in water. The linear range of electrochemiluminescence detection of butylene phthalate (DBP) by the sensor is 0.01 pg / mL to 100 ng / mL, and the linear range of visual colorimetric detection is 0.1 ng / mL to 100 ng / mL.

Images