Geotrichum candidum and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to geotrichum candidum and application thereof, the geotrichum candidum is preserved in China Center for Type Culture Collection in October 2023, the preservation address is China Center for Type Culture Collection, Luojia Mountain, Eight way, Wuchang District, Wuhan City, Hubei Province, the preservation number of the geotrichum candidum is CCTCC NO.M 20232053, and the geotrichum candidum is applied to production of lipase. The geotrichum candidum provided by the invention is high in enzyme production efficiency, and the produced lipase is high in enzyme activity and high in enzyme activity stability.

Description

Technical Field

[0001] This application relates to the field of microbial technology, and in particular, to a Geotrichum candidum and its application. Background Art

[0002] Lipase is an important class of glycerol ester bond hydrolases that can catalyze the hydrolysis of triglycerides at the oil-water interface to produce fatty acids and glycerol, as well as intermediate products monoglycerides and diglycerides. Utilizing the catalytic characteristics of lipase, its application in the biodiesel industry has good industrialization prospects. Biodiesel is fatty acid methyl ester obtained by the transesterification reaction of animal and plant oils and short-chain alcohols, and it is a clean biofuel and an excellent substitute for petrochemical diesel. The traditional chemical method for preparing biodiesel has defects such as relatively harsh substrate conditions, complex post-treatment procedures of the reaction, and relatively large environmental pollution. The biocatalytic method for preparing biodiesel well makes up for this defect.

[0003] The morphological characteristics of Geotrichum candidum are between those of yeasts and molds. It is a type of eukaryotic microorganism widely present in the environment and is often used in the brewing of foods such as cheese, beer, liquor, and fermented bean curd. It can produce pectinase, coenzyme Q, and lipase, and increase the content of medium-chain fatty acids and antimicrobial activity, etc.

[0004] However, at present, the level of lipase production by Geotrichum candidum is low, the enzyme activity is low, and its enzyme activity stability is also poor. These limit its application in industrial production. Therefore, carrying out relevant research work to improve lipase activity and its stability has positive practical significance. Summary of the Invention

[0005] In order to improve the enzyme activity of lipase produced by Geotrichum candidum, this application provides a Geotrichum candidum and its application.

[0006] The Geotrichum candidum and its application provided by this application adopt the following technical solutions:

[0007] In the first aspect, this application provides a Geotrichum candidum, adopting the following technical solutions:

[0008] A Geotrichum candidum was deposited at the China Center for Type Culture Collection on October 2023. The deposit address is: China Center for Type Culture Collection, Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit number of the Geotrichum candidum is CCTCC NO. M 20232053.

[0009] By adopting the above technical solution, although Geotrichum candidum can produce lipase, the current production level of lipase is relatively low, the enzyme activity is low, and the enzyme activity stability is cross, which greatly limits the application of biodiesel prepared by biological methods in industrial production. In this application, specific gene modification is carried out on Geotrichum candidum through gene splicing modification technology, and a highly active promoter of Escherichia coli is inserted into the gene fragment of Geotrichum candidum, enhancing the secretion activity of Geotrichum candidum, improving the enzyme production efficiency of Geotrichum candidum, and then through the two-step separation and purification of lipase, lipase with high activity is obtained.

[0010] Preferably, the 16S rRNA gene sequence of the Geotrichum candidum is as shown in SEQ ID NO: 1.

[0011] In the second aspect, this application provides the use of a strain of Geotrichum candidum for producing lipase.

[0012] By adopting the above technical solution, the genetically modified Geotrichum candidum has high secretion activity, high enzyme production efficiency, and high activity of the produced lipase.

[0013] Preferably, the steps for producing lipase are as follows: Put the Geotrichum candidum described in claim 1 into a fermenter, add a culture medium, adjust the pH to 6 - 7, control the culture temperature at 38 - 40 °C, the first culture time is 280 - 336 h, and then for each tank, 10% of the bacterial liquid is left, and after adding new culture medium, the culture time is 72 h; the obtained enzyme solution is subjected to crushing and separation, dehydrated and dried to become powdered enzyme, and then packed and stored.

[0014] By adopting the above technical solution, the fermenter and the culture medium are used to expand the production and proliferation of Geotrichum candidum. The final enzyme solution can reach 40000 U / ml, and the enzyme activity can reach 800000 U / g after dehydration and drying, greatly improving the enzyme production efficiency of Geotrichum candidum, the activity of the produced lipase, and the enzyme activity stability.

[0015] Preferably, the culture temperature is 39 °C, and the first culture time is 312 h.

[0016] By adopting the above technical solution, under the conditions of a culture temperature of 39 °C and a first culture time of 312 h, the expansion production and proliferation of Geotrichum candidum are carried out, and the obtained final enzyme solution has the highest content and the highest enzyme activity.

[0017] Preferably, the culture medium comprises the following components in parts by weight: 40 - 70 parts of glucose, 30 - 70 parts of beef extract, 30 - 70 parts of peptone, 3 - 6 parts of magnesium sulfate heptahydrate, 30 - 50 parts of dipotassium hydrogen phosphate, 5 - 20 parts of potassium dihydrogen phosphate, 3 - 7 parts of calcium chloride, and 80 - 110 parts of an inducer, and the inducer comprises olive oil, palmitic acid, and methanol.

[0018] By adopting the above technical solution, when using the culture medium composed of the above components in weight fractions to expand and proliferate Geotrichum candidum, enzyme solution with a higher concentration and lipase with higher activity and enzyme activity stability can be obtained.

[0019] Using glucose as the carbon source for Geotrichum candidum, beef extract and peptone as the nitrogen source for Geotrichum candidum, and supplementing trace elements such as magnesium sulfate heptahydrate, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, and calcium chloride, and then inducing the production of lipase by Geotrichum candidum by adding an inducer further improves the efficiency of lipase production by Geotrichum candidum and the activity of the produced lipase.

[0020] Among them, the inducer includes olive oil, palmitic acid, and methanol. Olive oil is rich in unsaturated fatty acids such as oleic acid and linoleic acid. These fatty acids can serve as substrates for lipase production by Geotrichum candidum and stimulate the production of the enzyme. At the same time, olive oil also contains some other bioactive substances such as polyphenolic compounds and vitamin E, etc. These substances may have a certain regulatory effect on the yield and activity of lipase produced by Geotrichum candidum.

[0021] Palmitic acid is a saturated fatty acid and can also serve as a substrate and inducer for lipase production by Geotrichum candidum. Adding palmitic acid can provide more substrate supply and stimulate the production of lipase by Geotrichum candidum.

[0022] By adding olive oil and palmitic acid simultaneously, different types of fatty acids can be provided as substrates to stimulate the yield of lipase produced by Geotrichum candidum. In addition, other bioactive substances in olive oil may also have a certain regulatory effect on the enzyme yield and activity.

[0023] Methanol activates the intracellular signal transduction pathway by acting on the cell membrane, further increasing the synthesis and secretion of lipase. At the same time, polyunsaturated fatty acids (such as linoleic acid and linolenic acid) in olive oil and palmitic acid can serve as signal molecules or precursor molecules and participate in the regulation of intracellular signal transduction. These fatty acids can activate the signal pathway through ways such as modifying the lipid composition of the cell membrane, participating in protein translation and post-translational modification, and affecting the production and metabolism of intracellular signal molecules. Some antioxidant substances and polyphenolic compounds in olive oil also have the effect of activating the signal pathway. These active substances can directly interact with intracellular signal molecules, change their activity or transport, and thus affect the transmission of the signal pathway and intracellular metabolism. Under the synergistic effect of methanol, olive oil, and palmitic acid, the enzyme production efficiency of Geotrichum candidum is greatly improved.

[0024] Preferably, the inducer is composed of olive oil, palmitic acid, and methanol in a ratio of (10 - 20):(15 - 25):(2 - 8).

[0025] By adopting the above technical solution, a inducer composed of olive oil, palmitic acid and methanol in a ratio of (10 - 20):(15 - 25):(2 - 8) is used to expand the production and proliferation of Geotrichum candidum, greatly improving the enzyme production efficiency of Geotrichum candidum, as well as the activity and enzyme activity stability of the produced lipase.

[0026] Preferably, the inducer is composed in a ratio of 17:21:3.

[0027] By adopting the above technical solution, a inducer composed of olive oil, palmitic acid and methanol in a ratio of 17:21:3 is used to expand the production and proliferation of Geotrichum candidum, further improving the enzyme production efficiency of Geotrichum candidum, as well as the activity and enzyme activity stability of the produced lipase.

[0028] Preferably, the lipase can be used for the production of biodiesel.

[0029] In summary, the present application includes at least one of the following beneficial technical effects:

[0030] 1. In the present application, Geotrichum candidum is subjected to specific gene modification through gene splicing and modification technology, and a highly active promoter of Escherichia coli is inserted into the gene fragment of Geotrichum candidum, enhancing the secretion activity of Geotrichum candidum and improving the enzyme production efficiency of Geotrichum candidum. Subsequently, through the two-step purification of lipase, lipase with high activity is obtained;

[0031] 2. A fermenter and a culture solution are used to expand the production and proliferation of Geotrichum candidum. The final enzyme solution of the reaction can reach 40000 U / ml, and the enzyme activity can reach 800000 U / g after dehydration and drying, greatly improving the enzyme production efficiency of Geotrichum candidum, the activity of the produced fat, and the enzyme activity stability;

[0032] 3. The enzyme production rate of Geotrichum candidum without gene modification is low and the activity is poor. Previously, when using the enzyme to produce biodiesel, the cost of the enzyme was as high as 225 yuan / t. After gene modification, Geotrichum candidum has a high enzyme production rate and enhanced activity, and the product can be well purified and separated. The cost for producing biodiesel can be reduced to 50 yuan / t, greatly saving the production cost of biodiesel for enterprises and improving the applicability of enzymatic production of biodiesel. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 is the construction map of the fusion expression vector. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0034] The following further details the present application in conjunction with the drawings and embodiments.

[0035] Raw Materials

[0036] Geotrichum candidum: commercially available CICC 1315;

[0037] Plasmid Extraction Kit: Yeasen Biotech Co., Ltd.;

[0038] YPD Medium: 1% yeast extract, 2% peptone, 2% glucose;

[0039] LB Medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride;

[0040] Yeast extract, ampicillin, tryptone, yeast extract, peptone, glucose, beef extract, magnesium sulfate heptahydrate, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, calcium chloride, olive oil, palmitic acid, and methanol were all purchased from Sinopharm Group.

[0041] Examples

[0042] Example 1

[0043] 1. Modification of Geotrichum candidum:

[0044] Use gene editing technology to modify Geotrichum candidum pp1315 to improve its enzyme production activity. The specific steps are as follows:

[0045] 1) Construction of vectors

[0046] First, select the codons for highly efficient expression in Escherichia coli as follows:

[0047] T01: 5’ctagcatatgcaccaccaccaccaccactatggccgcaaaaaacgccgccagcgccgccgcgataacaatccgaacatc3’

[0048] TP02 and TP04: 3’gctgagtcactacttgcgttcgaagatc5’

[0049] TP03: 5’ctagcatatgcaccaccaccac3’

[0050] Design the restriction endonucleases Ndel, Hind and the cleavage site P01 corresponding to the codons: 5’ctagcatatgcaccaccaccaccaccacgataacaatccgaacatc3’

[0051] Collect 1 - 5 ml of Escherichia coli 24-hour culture medium.

[0052] Resuspend the bacterial cell pellet with 250 ul of Solution P1 and shake until completely suspended.

[0053] Add 250 ul of Solution P2 and quickly invert 6 - 8 times to fully lyse the cells.

[0054] Add 350 ul of Solution P3, immediately invert quickly 6 - 8 times to mix evenly. At this time, white flocculent precipitates appear. Centrifuge at 10,000 rpm for 5 min on a high-speed centrifuge and take the supernatant.

[0055] Add the centrifuged supernatant to the adsorption column CB (the adsorption column is placed in a centrifuge tube), and place it on the high-speed centrifuge again. Centrifuge at 10,000 rpm for 30 s and discard the upper centrifugate.

[0056] Add 700 ul of washing solution, which is absolute ethanol. Centrifuge at 10,000 rpm for 30 s and discard the upper washing solution.

[0057] Put the adsorption column CB back into the collection tube, add 50 - 100 ul of elution solution in the middle part of the adsorption membrane. The elution solution is deionized water. Let it stand at room temperature for 2 min and collect the obtained solution, which is pure DNA.

[0058] Digest with restriction endonucleases Ndel and hind double digestion to extract the gene fragment of Escherichia coli.

[0059] Composition of the digestion solution

[0060]

[0061] Set the temperature at 20 °C and the time at 10 h.

[0062] 2) PCR amplify the above codons

[0063] PCR reaction substrates

[0064]

[0065] Reaction program setting

[0066]

[0067]

[0068] 3) Link the product with DNA ligase

[0069] Select pMD18-T Vector to link with the product, control the temperature at 20 °C and link for 6 h. 4) Extract the gene sequence of Geotrichum candidum, break the Geotrichum candidum cells by restriction endonuclease cleavage sites, centrifuge, and take the upper supernatant, and concentrate by cold blowing.

[0070] Search for cleavage sites:

[0071] >1:23519 - 24451

[0072] tggtaatggaggatgagcctagagaagccacaataaagccttcttatt

[0073] 5) Connect the vector carrying the E. coli triple codons with the DNA of Geotrichum candidum as the reaction substrate

[0074]

[0075] Reaction conditions

[0076] Temperature: 18 - 20 °C

[0077] pH: 6 - 7

[0078] Time: 14 - 17 h

[0079] 6) Introduce the recombinant gene into the recipient cell

[0080] Inoculate Geotrichum candidum into LB liquid medium, culture it overnight at 37 °C with shaking, and then dilute it 100 - fold with deionized water. Place the cultured bacteria on ice for 10 minutes to slow down metabolic activities and make the cells more stable. Centrifuge at 4 °C and 4000 rpm for 5 minutes, discard the supernatant, and resuspend the precipitate slowly with 0.1 M CaCl 2 solution, and let it stand in an ice bath for 30 minutes to allow Ca 2 + ions to bind to the negatively charged phospholipids of the cell membrane and reduce the membrane potential. Centrifuge the cells again and resuspend them in 600 μL of CaCl 2 solution to obtain high - concentration competent cells. Add 60 ng of recombinant plasmid DNA to the competent cells and mix gently. Let the mixture stand on ice for 30 minutes to allow the DNA to fully contact the cells. Then, incubate it in a shaker at 37 °C for 50 minutes to promote cell repair and plasmid expression. Spread the revived cells on LB agar medium. Incubate it in an incubator at 37 °C overnight and screen the medium with colony growth.

[0081] 7) Induced expression of the fusion gene in Geotrichum candidum

[0082] Strain activation: Add 3 ml of ampicillin with a concentration of 0.03 mg / ml to YPD medium, pick a single colony and put it into a shaker, culture it at 37 °C and 150 rpm for 24 h.

[0083] Secondary activation of the strain: Take 300 μg of the activated strain respectively and add it to 100 ml of LB medium containing ampicillin, put it into a shaker, culture it at 37 °C and 150 rpm for 24 h to make the OD value of the bacterial liquid between 0.5 - 1.0.

[0084] Induced expression of the fusion protein: Add the bacterial solution to the YPD medium, control the reaction temperature at 19°C, 150 rpm, and shake culture for 48 h.

[0085] Extraction of the fused protein: Pour the solution in the YPD medium into a centrifuge tube, centrifuge at 8000 rpm, take the supernatant, and add it to the Buffer solution to suspend the precipitate.

[0086] The above strain is preserved in the China Center for Type Culture Collection, the preservation address is: China Center for Type Culture Collection, Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, the preservation number is CCTCC NO: M20232053, the preservation date is October 26, 2023, and the Latin name is LCK6601 Geotrichum candiduam LCK6601.

[0087] The construction map of the fusion expression vector is as attached Figure 1 shown.

[0088] Entrust Myriad Genetics to detect and complete the partial target gene sequence of the recombinant Geotrichum candidum

[0089] The sequencing results of the promoter end Seq1 and the deduced amino acid sequence are as follows:

[0090] GATCCGTTAACTACGAAAATAGGCAACTTATTCTTAAGGG GCAAATTAA

[0091] TTTATGTTTTCCCGTCACCAACGACAAAATTTGCGAGGCTCTTTCCGAAA

[0092] ATAGAGTTGATCTTTGTCGTCACTGGATGTACTGTACATC CATACAGTAA

[0093] CTCACAGGGG CTGGATTGATTATGTACACTGCAGGCTATGCACATCGTGA

[0094] TTCGTCGTTCTCATCCACAGCAAGTAAAATTGCGCGTGTCTCTACGGAAA

[0095] ACACTACAGCCGGGCTTATCATGAAGTTTCTATCGCGAAGATCAGCCC

[0096] ATGATGACGCAACTTCTACT GTTGCCATTGTTACAGCAACTCGGTCAGCA

[0097] ATCGCGCTGGCAACTCTGGTAACACCGCAACAAAAACTGAGTCGCGAAT

[0098] GGGTTCAGGCATCTGGGCTACCCTTAACGAAAGTAATGCAGATTAGCCAG

[0099] CTCTCCCCTTGCCACACCGTGGAGTCAATGGTTCGCGCTTTACGCACGGG

[0100] CAATTACAGCGTGGTGATCGGTTGGTTGGCAGATGATTTGACTGAAGAAG

[0101] AGCATGCTGAACTTGTTGATGCGGCAAATGAAGGTAACGCTATGGGGTTT。

[0102] 2. Cultivation of Lipase

[0103] Put the Geotrichum candidum obtained in the laboratory into a 500 kg fermenter, add the culture medium, adjust the pH to 6.5, control the temperature at 39 °C, the first cultivation time is 312 h, and then 10% of the bacterial liquid remains in each tank. After adding the new culture medium, the cultivation time is 72 h.

[0104] The obtained enzyme solution is broken and separated, dehydrated and dried to become powder enzyme, and then packed and stored.

[0105] The above-mentioned culture medium is composed of the following raw materials by weight:

[0106] 50 kg of glucose, 50 kg of beef extract, 50 kg of peptone, 5 kg of magnesium sulfate heptahydrate, 40 kg of dipotassium hydrogen phosphate, 10 kg of potassium dihydrogen phosphate, 5 kg of CaCl 2 5 kg and 100 kg of inducer, and the inducer is composed of olive oil, palmitic acid and methanol in a weight ratio of 17:21:3.

[0107] Examples 2 - 11

[0108] Examples 2 - 11 are all based on the method of Example 1, and the formula of the culture medium is adjusted. The specific adjustment situations are shown in Table 1 below. Among them, the inducer is composed of olive oil, palmitic acid and methanol in a weight ratio of 17:21:3.

[0109] Table 1 Adjustment Table of the Culture Medium Formula in Examples 1 - 11

[0110]

[0111] Example 12

[0112] On the basis of the method of Example 1, the composition ratio of the inducer in the culture medium was adjusted in Example 12, olive oil: palmitic acid: methanol = 10:15:8.

[0113] Example 13

[0114] On the basis of the method of Example 1, the composition ratio of the inducer in the culture medium was adjusted in Example 13, olive oil: palmitic acid: methanol = 20:25:2.

[0115] Example 14

[0116] On the basis of the method of Example 1, the composition ratio of the inducer in the culture medium was adjusted in Example 14, and methanol was not added.

[0117] Example 15

[0118] On the basis of the method of Example 1, the composition ratio of the inducer in the culture medium was adjusted in Example 15, and olive oil was not added.

[0119] Example 16

[0120] On the basis of the method of Example 1, the composition ratio of the inducer in the culture medium was adjusted in Example 16, and palmitic acid was not added.

[0121] Example 17

[0122] On the basis of the method of Example 1, no inducer was added to the culture medium in Example 17.

[0123] Example 18

[0124] On the basis of the method of Example 1, the influence of the first culture time on the lipase production of Geotrichum candidum was explored in Example 18, and the first culture time was adjusted to 200 h.

[0125] Example 19

[0126] On the basis of the method of Example 1, the influence of the first culture time on the lipase production of Geotrichum candidum was explored in Example 19, and the first culture time was adjusted to 280 h.

[0127] Example 20

[0128] On the basis of the method of Example 1, the influence of the first culture time on the lipase production of Geotrichum candidum was explored in Example 20, and the first culture time was adjusted to 336 h.

[0129] Comparative Example

[0130] Comparative Example 1

[0131] Based on the method of Example 1, Geotrichum candidum pp1315 that has not been genetically modified by gene editing technology was selected.

[0132] Comparative Example 2

[0133] Based on the method of Example 1, Geotrichum candidum pp1315 that has not been genetically modified by gene editing technology was selected, and no inducer was added to the culture medium.

[0134] Performance Detection Test

[0135] To further explore the lipase production activity of Geotrichum candidum after genetic modification by gene editing technology, the following examples were further carried out in this application for verification. The detection results are shown in Table 2 below.

[0136] Determination of lipase activity: The determination of lipase activity was carried out by the olive oil emulsification hydrolysis titration method. The definition of enzyme activity is: the amount of enzyme consumed by lipase to hydrolyze the olive oil emulsion to produce 1 pmol / min of fatty acid under the conditions of 40 °C and pH 7.5 is defined as 1 lipase activity unit (denoted as 1 U).

[0137] Table 2 Detection data of Examples 1-20 and Comparative Examples 1-2

[0138]

[0139]

[0140] Referring to Table 2, the components and proportions of the culture medium were adjusted in Examples 1-20. The test results showed that Geotrichum candidum modified by gene editing technology had a high enzyme production efficiency, and the lipase produced had a high enzyme activity. After adjusting the components and proportions of the culture medium, an improved culture medium was used to expand the production and proliferation of Geotrichum candidum, further improving the enzyme production efficiency of Geotrichum candidum and the enzyme activity and enzyme activity stability of the produced lipase. Among them, the components and proportions of the culture medium in Example 1 had the best promoting effect on the enzyme production efficiency of Geotrichum candidum.

[0141] Taking Example 1 as a control, Examples 2-3 investigated the influence of the ratio of carbon source and nitrogen source on the lipase production of Geotrichum candidum. The test results showed that when the carbon source and nitrogen source changed within a certain range, the influence on the lipase production of Geotrichum candidum was small, and Geotrichum candidum still had a good enzyme production efficiency.

[0142] Taking Example 1 as a control, Examples 4-9 investigated the influence of the ratio of trace elements on the lipase production of Geotrichum candidum. The test results showed that when the trace elements changed within a reasonable range, the influence on the lipase production of Geotrichum candidum was small, and the enzyme production efficiency of Geotrichum candidum was slightly lower than that of Example 1 but still relatively good.

[0143] Taking Example 1 as a control, Examples 10 - 11 investigated the effect of the content of the inducer on the lipase production of Geotrichum candidum. The test results showed that when the content of the inducer varied within a reasonable range, the effect on the lipase production of Geotrichum candidum was relatively small, and the enzyme production efficiency of Geotrichum candidum was slightly lower than that of Example 1 but still relatively good.

[0144] Taking Example 1 as a control, Examples 12 - 13 investigated the components and ratios of the added inducer on the lipase production of Geotrichum candidum. The test results showed that when the component ratios of the inducer varied within a certain range, the effect on the lipase production of Geotrichum candidum was relatively small, and the enzyme production efficiency of Geotrichum candidum was slightly lower than that of Example 1 but still relatively good.

[0145] Taking Example 1 as a control, Example 14 investigated the effect of methanol in the inducer on the lipase production of Geotrichum candidum. The test results showed that when methanol was not added to the inducer, the enzyme production efficiency of Geotrichum candidum was significantly lower than that of Example 1.

[0146] Taking Example 1 as a control, Example 15 investigated the effect of olive oil in the inducer on the lipase production of Geotrichum candidum. The test results showed that when olive oil was not added to the inducer, the enzyme production efficiency of Geotrichum candidum was significantly lower than that of Example 1.

[0147] Taking Example 1 as a control, Example 14 investigated the effect of palmitic acid in the inducer on the lipase production of Geotrichum candidum. The test results showed that when palmitic acid was not added to the inducer, the enzyme production efficiency of Geotrichum candidum was significantly lower than that of Example 1.

[0148] Taking Example 1 as a control, Example 17 investigated the effect of adding an inducer on the lipase production of Geotrichum candidum. The test results showed that when the inducer was not added to the culture medium, the enzyme production efficiency of Geotrichum candidum was significantly lower than that of Example 1 but still much higher than that of Geotrichum candidum without genetic scissors technology modification.

[0149] Combining Examples 14 - 17, it can be seen that the inducer has an obvious effect on improving the enzyme production efficiency of Geotrichum candidum, and this effect is the result of the synergistic action of methanol, olive oil, and palmitic acid, rather than the synergistic action of one or two of them.

[0150] Taking Example 1 as a control, Example 18 investigated the effect of the first culture time on the lipase production of Geotrichum candidum. The test results showed that when the first culture time was short, the lipase yield was low. The test results indicated that when the first culture time was short, the lipase production of Geotrichum candidum was incomplete, resulting in a low lipase yield.

[0151] Taking Example 1 as a control, Example 19 investigated the effect of the first cultivation time on lipase production by Geotrichum candidum. The test results showed that when the first cultivation time was increased from 200 h to 280 h, the lipase yield gradually increased, but was still lower than that of Example 1.

[0152] Taking Example 1 as a control, Example 20 investigated the effect of the first cultivation time on lipase production by Geotrichum candidum. The test results showed that when the first cultivation time was longer, the lipase activity was slightly lower than that of Example 1. Based on the test results, it was speculated that the lipase activity might be reduced due to the too long first cultivation time.

[0153] Different from Example 1, in Comparative Example 1, Geotrichum candidum that had not been modified by gene splicing technology was selected, and the culture medium used was the same as that in Example 1. The test results showed that the enzyme production efficiency and enzyme activity of Geotrichum candidum in Comparative Example 1 were much lower than those in Example 1, indicating that the enzyme production efficiency and enzyme activity of Geotrichum candidum modified by gene splicing technology had been greatly improved.

[0154] Different from Example 1, in Comparative Example 1, Geotrichum candidum that had not been modified by gene splicing technology was selected and no inducer was added to the culture medium. The test results showed that the enzyme production efficiency and enzyme activity of Geotrichum candidum in Comparative Example 1 were much lower than those in Example 17 and also lower than those in Comparative Example 1, indicating that the enzyme production efficiency and enzyme activity of Geotrichum candidum modified by gene splicing technology had been greatly improved, and the culture medium had a good promoting effect on the enzyme production efficiency of Geotrichum candidum.

[0155] The above are all preferred embodiments of this application. The protection scope of this application is not limited hereby. Therefore, all equivalent changes made according to the structure, shape, and principle of this application shall be covered within the protection scope of this application.

Claims

1. A Geotrichum candidum, characterized in that: It was preserved in the China Center for Type Culture Collection in October 2023, and the preservation address is: China Center for Type Culture Collection, Luojiashan, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The preservation number of the candidum is CCTCC NO.M 20232053.

2. The Geotrichum candidum according to claim 1, characterized in that: The 16S rRNA gene sequence of Geotrichum candidum is shown as SEQ ID NO:

1.

3. An application of Geotrichum candidum according to any one of claims 1 to 2, characterized in that: The Geotrichum candidum is used for producing lipase.

4. The use of Geotrichum candidum according to claim 3, characterized in that: The lipase production steps are as follows: putting the Geotrichum candidum described in claim 1 into a fermentation tank, adding culture solution, adjusting the pH to 6-7, controlling the culture temperature to 38-40° C., the first culture time is 280-336 hours, and then each tank has 10% of the remaining bacterial solution, after which new culture solution is added, the culture time is 72 hours; The obtained enzyme liquid is crushed, separated, dehydrated and dried to become powdered enzyme, which is then packed and stored.

5. The use of Geotrichum candidum according to claim 4, characterized in that: The culture temperature is 39° C., and the first culture time is 312 h.

6. The use of Geotrichum candidum according to claim 4, characterized in that: The culture solution comprises the following components in parts by weight: 40-70 parts of glucose, 30-70 parts of beef extract, 30-70 parts of peptone, 3-6 parts of magnesium sulfate heptahydrate, 30-50 parts of dipotassium hydrogen phosphate, 5-20 parts of potassium dihydrogen phosphate, 3-7 parts of calcium chloride and 80-110 parts of an inducer, wherein the inducer comprises olive oil, palmitic acid and methanol.

7. The use of Geotrichum candidum according to claim 6, characterized in that: The inducer is composed of olive oil, palmitic acid and methanol in a ratio of (10-20):(15-25):(2-8).

8. The use of Geotrichum candidum according to claim 6, characterized in that: The inducer is composed according to the ratio of 17:21:

3.

9. The use of Geotrichum candidum according to claim 3, characterized in that: The lipase can be used in the production of biodiesel.

Images