Cellulose degrading bacterium (Trichoderma erinaceum) A18, culture medium and preparation method of culture medium

Abstract

The invention relates to a cellulose degrading bacterium (Trichoderma erinaceum) A18, a culture medium and a preparation method of the culture medium, the strain is preserved in Guangdong Microbial Culture Collection Center, the preservation number is GDMCC No.65616, and the strain is screened from soil and fallen leaves in Nanning. The culture medium comprises a seed culture medium and an enzyme production culture medium, wherein the seed culture medium comprises the following components: 10g / L of sodium carboxymethyl cellulose, 3g / L of peptone, 4g / L of monopotassium phosphate, 0.3 g / L of magnesium sulfate heptahydrate and 0-0.3 g / L of calcium chloride; the enzyme production culture medium is prepared from 8-12 g / L of sodium carboxymethyl cellulose, 2-3 g / L of peptone, 0.2-3 g / L of yeast powder, 0.2-2 g / L of ammonium sulfate, 4 g / L of monopotassium phosphate, 0.3 g / L of magnesium sulfate heptahydrate and 0.002 g / L of zinc chloride. The seed culture medium and the enzyme production culture medium are prepared by distilled water and then put into a high-pressure sterilization pot to be sterilized at 121 DEG C, inoculation is carried out in proportion, and closed anaerobic culture is carried out. By adopting the method, the cellulose incision enzyme activity of the cellulose degrading bacterium A18 can be effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, in particular to a cellulose-degrading bacterium, a culture medium and a method for preparing the culture medium. Background Art

[0002] Roughage contains a large amount of cellulose, and its value as a feed raw material is relatively low. Reducing the cellulose content of roughage can improve the feeding value of roughage. Trichoderma has a strong ability to produce cellulose, and has the advantages of a relatively complete and highly active cellulase system, and most of them are extracellular enzymes that are easy to purify. It is more prominent in cellulose degradation and is superior to other microorganisms. At the same time, fungi are rich in bacterial proteins, and fungal fermentation can more significantly improve the nutritional value of roughage than bacterial fermentation. During the fermentation of roughage, lactic acid bacteria will play a role in producing lactic acid and acetic acid to lower the pH of the feed itself. The use of acid-resistant cellulose-degrading bacteria will be more conducive to the secretion of cellulose endonucleases that can still have high enzyme activity at low pH, thereby making it more effective in reducing cellulose. Chinese patent CN103820361B discloses a strain of high-temperature cellulose-degrading bacteria and its application. The strain has cellulose-degrading enzyme activity and can degrade cellulose in the presence of an auxiliary carbon source. This strain can grow in a temperature range of 50-85°C, with a pH range of 5.5-8.0 and an optimum pH of 6.5. However, its optimum pH is relatively high. During the fermentation of roughage, lactic acid bacteria produce lactic acid and acetic acid, which lower the pH. Therefore, using this strain can result in poor cellulose degradation. Therefore, developing a culture medium that can increase the activity of the endocellulase of acid-resistant cellulose-degrading bacteria is beneficial for improving the fermentation efficiency of cellulose-degrading bacteria in roughage. Summary of the Invention

[0003] To address the problem of high cellulose content in roughage, the present invention provides a cellulose-degrading bacterium, a culture medium, and a method for preparing the culture medium. The culture medium can effectively enhance the activity of the endocellulose enzyme of the cellulose-degrading bacterium (Trichoderma erinaceum) A18, thereby enabling the cellulose-degrading bacterium (Trichoderma erinaceum) A18 to secrete an endocellulose enzyme that maintains high activity even at a pH of 4.

[0004] To achieve the above objectives, the present invention adopts the following technical solution: A cellulose-degrading bacterium (Trichoderma erinaceum) A18 was deposited in the Guangdong Provincial Microbial Culture Collection Center on December 11, 2024, with the deposit number: GDMCC No. 65616. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0005] The cellulose-degrading bacteria (Trichoderma erinaceum) A18 was screened from soil and fallen leaves in Nanning City.

[0006] The properties of the cellulose degrading bacteria (Trichoderma erinaceum) A18 are as follows:

[0007] The strain possesses cellulose-degrading enzyme activity and can degrade cellulose in the presence of a supplementary carbon source. It can grow in the temperature range of 20-35°C and the pH range of 4.0-7.0, with an optimum pH of approximately 4.8. After two days of cultivation on PDA solid medium, its colonies are characterized by irregular white filaments, which gradually transform into dark green with continued cultivation. The ITS region of this strain was amplified by PCR using universal primers (ITS1-6F) 5′-GGAAGTAAAAGTCGTAACAA-3′ and (ITS4-2R) 5′-TCCTCCGCTTATTGATATGC-3′. A phylogenetic tree was constructed using MEGA11 software after comparison with the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). A phylogenetic tree was constructed based on the ITS sequence of strain A18. It was found that strain A18 was most closely related to Trichoderma erinaceum, with a bootstrap value of 99. Therefore, strain A18 was considered to be Trichoderma erinaceum and was named Trichoderma erinaceum A18.

[0008] The screening and identification of the cellulose degrading bacteria (Trichoderma erinaceum) A18 comprises the following steps:

[0009] (1) The collected soil and fallen leaves were mixed with physiological saline, soaked, filtered, plated on PDA medium, cultured, and purified until a single colony was obtained;

[0010] (2) The single colonies obtained were inoculated on Congo red medium to form a clear transparent zone, and then rescreened;

[0011] (3) Inoculate the colonies that form clear transparent circles into filter paper strip culture medium and perform rescreening. The ones with higher degree of filter paper disintegration are tested for cellulase activity;

[0012] (4) After the determination, the cells with higher endocellulose enzyme activity will be screened out for safety assessment;

[0013] (5) The safer strains were sequenced by ITS sequence, phylogenetic tree was constructed, and the strains were preserved.

[0014] A culture medium for improving the activity of cellulose-degrading bacteria (Trichoderma erinaceum) A18 endocellulose enzyme, comprising a seed culture medium and an enzyme-producing culture medium, wherein the seed culture medium comprises 10 g / L sodium carboxymethyl cellulose, 3 g / L peptone, 4 g / L potassium dihydrogen phosphate, 0.3 g / L magnesium sulfate heptahydrate, and 0-0.3 g / L calcium chloride; and the enzyme-producing culture medium comprises 8-12 g / L sodium carboxymethyl cellulose, 2-3 g / L peptone, 0.2-3 g / L yeast powder, 0.2-2 g / L ammonium sulfate, 4 g / L potassium dihydrogen phosphate, 0.3 g / L magnesium sulfate heptahydrate, and 0.002 g / L zinc chloride.

[0015] A method for preparing a culture medium for improving the activity of cellulose-degrading bacteria (Trichoderma erinaceum) A18 endocellulose enzyme comprises the following steps:

[0016] (1) The seed culture medium and enzyme production culture medium were prepared with distilled water, placed in an autoclave, and sterilized at 121°C for 20 minutes;

[0017] (2) Cellulose-degrading bacteria (Trichoderma erinaceum) A18 were placed in PDA medium for activation and propagation. After the plate was fully covered, the plate was rinsed with sterile water to obtain a suspension and placed in a 4°C refrigerator for later use.

[0018] (2) inoculating the suspension into the seed culture medium at a ratio of 2%, and incubating in a closed anaerobically manner for 2 days;

[0019] (3) After the seed culture medium is cultivated, the seed is inoculated into the enzyme production medium at a ratio of 2% to 6%, and the culture is closed and anaerobically cultivated for 5 days;

[0020] (4) After the culture is completed in the enzyme production medium, the cellulase activity is measured.

[0021] The method for determining the activity of endocellulose enzymes of cellulose-degrading bacteria is carried out according to the following steps:

[0022] (1) After the culture of the enzyme-producing medium is completed, the bacterial liquid obtained is centrifuged at 6000 rpm for 15 min to obtain a crude enzyme solution;

[0023] (2) Add 0.25 ml of crude enzyme solution to 0.75 ml of sodium citrate buffer solution with a concentration of 10 g / L sodium carboxymethyl cellulose. The solution was divided into a control tube and a test tube. 0.75 ml of 3,5-dinitrosalicylic acid reagent was added to the control tube at the same time. No reagent was added to the test tube. The tubes were placed in a 50°C water bath for 30 min.

[0024] (3) Immediately after the water bath is completed, add 0.75 ml of 3,5-dinitrosalicylic acid reagent to the test tube. Then, place the control tube and the test tube in a boiling water bath for 5 min. After cooling, adjust the blank tube to zero at a wavelength of 540 nm and record the absorbance of the test tube.

[0025] (4) preparing a glucose standard solution and processing it according to steps (2) and (3) to establish a standard curve for the glucose standard solution;

[0026] (5) The absorbance obtained in step (3) is substituted into the glucose standard curve to calculate the glucose content in the crude enzyme solution, and the cellulase activity of the crude enzyme solution is calculated according to the following formula:

[0027] Endocellulase activity

[0028] The method for determining the activity of cellulose-degrading bacteria endonuclease is as follows: the sodium citrate buffer solution in step (2) is prepared by dissolving 9.6 g of citric acid in 900 ml of distilled water, adjusting the pH to 4 with sodium hydroxide, and then diluting the volume to 1 L.

[0029] The method for determining the activity of cellulose-degrading bacteria endonuclease is as follows: in step (2), the 3,5-dinitrosalicylic acid reagent is prepared by heating 5.3 g / L of 3,5-dinitrosalicylic acid and 9.9 g / L of sodium hydroxide with 708 ml of deionized water to dissolve; then, 153 g / L of potassium sodium tartrate, 3.8 ml / L of melted phenol, and 4.15 g / L of sodium metabisulfite are added and fully dissolved, and the mixture is made up with deionized water.

[0030] In the method for determining the activity of cellulose-degrading bacteria endonuclease, the concentration of the glucose standard solution in step (4) is 1 mg / mL.

[0031] The present invention has the following beneficial effects:

[0032] The culture medium for improving the activity of cellulose-degrading bacteria endocellulose enzymes of the present invention can effectively improve the activity of cellulose-degrading bacteria (Trichoderma erinaceum) A18 endocellulose enzymes, so that the cellulose-degrading bacteria (Trichoderma erinaceum) A18 can secrete endocellulose enzymes that still have strong activity in an environment of pH=4. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is an example of filter paper strip disintegration screening of the cellulose-degrading bacteria (Trichoderma erinaceum) A18 described in the present invention.

[0034] Figure 2 This is the safety test result of the cellulose-degrading bacteria (Trichoderma erinaceum) A18 described in the present invention.

[0035] Figure 3 This is a phylogenetic tree of the cellulose-degrading bacteria (Trichoderma erinaceum) A18 described in the present invention based on ITS sequencing results. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is further described below through examples.

[0037] Example 1

[0038] Screening and Identification of Cellulose-Degrading Bacteria (Trichoderma erinaceum) A18

[0039] The collected soil and fallen leaves were mixed with physiological saline in a ratio of 1:9, soaked for 30 min, filtered through four layers of gauze, plated on PDA medium, cultured, and purified until a single colony was obtained;

[0040] After culturing A18 on PDA solid medium for 2 days, its colony characteristics are: white irregular filamentous fungi, and the white color will gradually turn into dark green with continued cultivation.

[0041] The obtained single colony was inoculated on Congo red medium composed of 10 g / L sodium carboxymethylcellulose (CMC-Na), 1 g / L K2PO4, 1 g / L (NH4)2SO4, 0.2 g / L MgSO4·7H2O, 0.02 g / L CaCl2, and 15 g / L agar. The one that formed a clear transparent zone was rescreened.

[0042] The colonies that formed clear transparent circles were inoculated into filter paper strip culture medium composed of filter paper strip (1×6cm), KH2PO4 1g / L, NaCl0.1g / L, MgSO4·7H2O 0.3g / L, FeCl3 0.01g / L, CaCl2 0.1g / L, pH 7.2-7.4, and rescreened. The results are shown in Figure 1 , the filter paper strips were disintegrated to a higher degree, and the cellulase activity was determined. The results are shown in Table 1;

[0043] Table 1 Endocellulase activity of screened strains

[0044]

[0045] After the test, the ones with higher endocellulose activity will be screened out for safety identification. Figure 2

[0046] The safer strains were sequenced by ITS sequence and phylogenetic tree was constructed. Figure 3 , and preserve it.

[0047] The ITS region of this strain was amplified by PCR using universal primers (ITS1-6F) 5′-GGAAGTAAAAGTCGTAACAA-3′ and (ITS4-2R) 5′-TCCTCCGCTTATTGATATGC-3′. After comparison with the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), a phylogenetic tree was constructed using MEGA11 software. A phylogenetic tree based on the ITS sequence of strain A18 revealed that strain A18 (sample A18) was most closely related to Trichoderma erinaceum, with a bootstrap score of 99. Therefore, strain A18 was considered to be Trichoderma erinaceum. The strain was named Trichoderma erinaceum A18. It was deposited with the Guangdong Provincial Center for Microbial Culture Collection on December 11, 2024, under the accession number GDMCC No. 65616. Collection address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0048] The sequence of A18 is as follows:

[0049] AGTCTGGGTATTACCGAGTTTACACTCCCAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGT

[0050] CACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTACTGTA

[0051] GTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACG

[0052] GATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAG

[0053] TGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCA

[0054] TTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGGAACCCCTCAGACGGGATCCCGGCCC

[0055] CGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCG

[0056] GCGCGTCCACGTCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTG

[0057] AACTTAAGCATATCAATAAGGGAAAGGAAAAGAACGGAAGGGAAGA.

[0058] Example 2

[0059] This embodiment is an example of a method for preparing a culture medium for improving the activity of endocellulose enzymes of cellulose-degrading bacteria according to the present invention, comprising the following steps:

[0060] (1) The seed culture medium and enzyme production culture medium were prepared with distilled water, placed in an autoclave, and sterilized at 121°C for 20 minutes;

[0061] (2) Cellulose-degrading bacteria (Trichoderma erinaceum) A18 were placed in PDA medium and poured into the medium for activation and propagation. After the mycelium was fully grown, 1 ml of sterile water was drawn up with a 1000 μl pipette tip to rinse the surface of the medium. This was repeated several times until no obvious colonies were distributed on the surface. The bacterial solution was then drawn into sterile water and placed in a 4°C refrigerator for later use.

[0062] (3) inoculating the suspension into the seed culture medium at a ratio of 2%, and incubating in a closed anaerobically manner for 2 days;

[0063] (4) After the seed culture medium is cultivated, the seed is inoculated into the enzyme production medium at a ratio of 2%, and the culture is closed and anaerobically cultivated for 5 days;

[0064] (5) After the culture is completed in the enzyme production medium, the cellulase activity is measured.

[0065] The enzyme production in the culture medium was determined using the 3,5-dinitrosalicylic acid method in a pH 4 buffer solution. The results are listed in Table 1.

[0066] Table 2 Example 2 Endocellulose enzyme activity

[0067]

[0068] From the test results in Table 1, it can be seen that the activity of the endocellulose enzyme in Example 2 is 2.93 U / mL, while the activity of the endocellulose enzyme in Comparative Example 1 is 1.62 U / mL, which is 80.86% higher than that in Comparative Example 1.

[0069] Example 3

[0070] This embodiment is another example of the method for preparing a culture medium for improving the activity of endocellulose enzymes of cellulose-degrading bacteria according to the present invention, comprising the following steps:

[0071] (1) The seed culture medium and enzyme production culture medium were prepared with distilled water, placed in an autoclave, and sterilized at 121°C for 20 minutes;

[0072] The composition of the seed culture medium is: sodium carboxymethyl cellulose 10g / L, peptone 3g / L, potassium dihydrogen phosphate 4g / L, magnesium sulfate heptahydrate 0.3g / L, calcium chloride 0.3g / L, pH is normal,

[0073] The enzyme production medium consists of: sodium carboxymethyl cellulose 8g / L, peptone 3g / L, yeast powder 0.2g / L, ammonium sulfate 2g / L, potassium dihydrogen phosphate 4g / L, magnesium sulfate heptahydrate 0.3g / L, calcium chloride 0.3g / L, zinc chloride 0.002g / L, pH 5.8.

[0074] (2) Cellulose-degrading bacteria (Trichoderma erinaceum) A18 were placed in PDA medium and poured into the medium for activation and propagation. After the mycelium was fully grown, 1 ml of sterile water was drawn up with a 1000 μl pipette tip to rinse the surface of the medium. This was repeated several times until no obvious colonies were distributed on the surface. The bacterial solution was then drawn into sterile water and placed in a 4°C refrigerator for later use.

[0075] (3) inoculating the suspension into the seed culture medium at a ratio of 2%, and incubating in a closed anaerobically manner for 2 days;

[0076] (4) After the seed culture medium is cultivated, the seed is inoculated into the enzyme production medium at a ratio of 2%, and the culture is closed and anaerobically cultivated for 5 days;

[0077] (5) After the culture is completed in the enzyme production medium, the cellulase activity is measured.

[0078] The enzyme production in the culture medium was determined using the 3,5-dinitrosalicylic acid method in a pH 4 buffer solution. The results are listed in Table 2.

[0079] Table 3 Example 3 Endocellulose enzyme activity

[0080]

[0081] From the test results in Table 2, it can be seen that the activity of the endocellulose enzyme in Example 3 is 2.89 U / mL, while the activity of the endocellulose enzyme in Comparative Example 1 is 1.62 U / mL, which is 78.40% higher than that in Comparative Example 1.

[0082] Example 4

[0083] This embodiment is another example of the method for preparing a culture medium for improving the activity of endocellulose enzymes of cellulose-degrading bacteria according to the present invention, comprising the following steps:

[0084] (1) The seed culture medium and enzyme production culture medium were prepared with distilled water, placed in an autoclave, and sterilized at 121°C for 20 minutes;

[0085] The composition of the seed culture medium is: sodium carboxymethyl cellulose 10g / L, peptone 3g / L, potassium dihydrogen phosphate 4g / L, magnesium sulfate heptahydrate 0.3g / L, calcium chloride 0.3g / L, pH is normal,

[0086] The enzyme production medium consists of: sodium carboxymethyl cellulose 8g / L, peptone 3g / L, yeast powder 0.2g / L, ammonium sulfate 2g / L, potassium dihydrogen phosphate 4g / L, magnesium sulfate heptahydrate 0.3g / L, calcium chloride 0.3g / L, zinc chloride 0.002g / L, pH 5.8.

[0087] (2) Cellulose-degrading bacteria (Trichoderma erinaceum) A18 were placed in PDA medium and poured into the medium for activation and propagation. After the mycelium was fully grown, 1 ml of sterile water was drawn up with a 1000 μl pipette tip to rinse the surface of the medium. This was repeated several times until no obvious colonies were distributed on the surface. The bacterial solution was then aspirated into sterile water and placed in a 4°C refrigerator for later use.

[0088] (3) inoculating the suspension into the seed culture medium at a ratio of 2%, and incubating in a closed anaerobically manner for 2 days;

[0089] (4) After the seed culture medium is cultivated, the seed is inoculated into the enzyme production medium at a ratio of 2%, and the culture is closed and anaerobically cultivated for 5 days;

[0090] (5) After the culture is completed in the enzyme production medium, the cellulase activity is measured.

[0091] The enzyme production in the culture medium was determined using the 3,5-dinitrosalicylic acid method in a pH 4 buffer solution. The results are listed in Table 3.

[0092] Table 4 Example 4 Endocellulose enzyme activity

[0093]

[0094] From the test results in Table 3, it can be seen that the activity of the endocellulose enzyme in Example 4 is 7.65 U / mL, while the activity of the endocellulose enzyme in Comparative Example 1 is 1.62 U / mL, which is 372.22% higher than that in Comparative Example 1.

[0095] From the above experimental results we can see that:

[0096] 1. The addition of metal ions in the culture medium significantly promoted the enzymatic activity of cellulase

[0097] The addition of metal ions to the culture medium significantly promoted the activity of cellulase. 2+ The effects on microorganisms are multifaceted. 2+ As a nutrient element necessary for microbial growth and metabolism, it participates in various physiological functions such as cell permeability regulation, signal regulation, and gene expression. 2+ It can also promote mitochondrial ATP synthesis and hyphae branching to promote the growth of microorganisms. 2+ It can also offset the excess Mg to a certain extent. 2+ Inhibitory effect on cellulase synthesis.

[0098] Zn 2+ It can participate in the synthesis of zinc finger proteins, which are a class of proteins containing zinc finger domains that are widely distributed in fungi. They are involved in cell proliferation, differentiation and apoptosis, as well as in the recognition of DNA, RNA and proteins. Zinc finger proteins with transcription factor functions account for the largest proportion in the zinc finger protein family, including zinc finger protein cellulase gene positive transcription factors (XYR1, ACE2, ACE3) and zinc finger protein negative regulatory transcription factors (CRE1, ACE1, RCE1). This shows that Zn 2+ The effect on cellulase production is two-sided. Studies have shown that at low concentrations of Zn 2+ Under the condition of 2+ It can promote the binding of substrate to enzyme active center, but too high Zn 2+ Will inhibit the growth of mycelium, while Zn 2+ When the content increases, not only the mRNA levels of XYR1, ACE2, and ACE3 increase, but also the mRNA level of CRE1, a transcription factor that inhibits the production of cellulase, increases. Therefore, excessive Zn 2+ This may lead to a decrease in the production of endocellulase, thereby affecting the activity of endocellulase in the system.

[0099] 2. Effect of nitrogen source combination on the activity of cellulase

[0100] We found that the combination of three nitrogen sources in the culture medium has an effect on the activity of its endocellulase, among which peptone has the greatest influencing factor. When the peptone content decreases, the activity of its endocellulase decreases more significantly, indicating that the cellulose-degrading bacteria (Trichoderma erinaceum) A18 is more inclined to use peptone as a nitrogen source to synthesize endocellulase.

[0101] 3. The culture medium in a low pH environment is more conducive to promoting the production of more acid-resistant cellulase by the strain

[0102] The experimental results show that a pH of 4.8 is more conducive to promoting the strain to produce more acid-resistant cellulase, or it may be that Trichoderma erinaceum A18 prefers to produce enzymes in a low pH environment.

[0103] The above results show that the culture medium prepared by the preparation method of the present invention can more effectively promote the cellulose-degrading bacteria (Trichoderma erinaceum) A18 to produce endocellulose enzyme with strong acid resistance.

Claims

1. A cellulose-degrading bacterium (Trichoderma erinaceum) A18, characterized in that: It is deposited in Guangdong Microbiological Culture Collection Center with the accession number: GDMCC No.65616.

2. The cellulose degrading bacteria (Trichoderma erinaceum) A18 according to claim 1, characterized in that The cellulose degrading bacteria (Trichoderma erinaceum) A18 was screened from soil and fallen leaves in Nanning.

3. The cellulose degrading bacteria (Trichoderma erinaceum) A18 according to claim 1, characterized in that The screening and identification of the cellulose degrading bacteria (Trichoderma erinaceum) A18 comprises the following steps: (1) The collected soil and fallen leaves are mixed with physiological saline, soaked, filtered, plated on PDA medium, cultured, and purified until a single colony is obtained; (2) The single colonies obtained were inoculated on Congo red medium to form a clear transparent zone, and then rescreened; (3) Inoculate the colonies that form clear transparent circles into filter paper strip culture medium and perform rescreening. The ones with higher degree of filter paper disintegration are tested for endocellulose enzyme activity; (4) After the determination, the cellulase with higher activity will be screened out for safety assessment; (5) The safer strains were sequenced by ITS sequence, phylogenetic tree was constructed, and the strains were preserved.

4. A culture medium for improving the activity of cellulose-degrading bacteria (Trichoderma erinaceum) A18 endocellulose enzyme, characterized in that: The culture medium includes a seed culture medium and an enzyme production culture medium, wherein the seed culture medium components are: 10 g / L sodium carboxymethyl cellulose, 3 g / L peptone, 4 g / L potassium dihydrogen phosphate, 0.3 g / L magnesium sulfate heptahydrate and 0-0.3 g / L calcium chloride; the enzyme production culture medium components are: 8-12 g / L sodium carboxymethyl cellulose, 2-3 g / L peptone, 0.2-3 g / L yeast powder, 0.2-2 g / L ammonium sulfate, 4 g / L potassium dihydrogen phosphate, 0.3 g / L magnesium sulfate heptahydrate and 0.002 g / L zinc chloride.

5. The method for preparing a culture medium for improving the activity of cellulose-degrading bacteria (Trichoderma erinaceum) A18 endocellulose enzyme according to claim 4, comprising the following steps: (1) The seed culture medium and the enzyme production culture medium were respectively prepared with distilled water and placed in an autoclave for sterilization at 121° C. for 20 min; (2) Cellulose-degrading bacteria (Trichoderma erinaceum) A18 were placed in PDA medium for activation and propagation. After the plate was fully covered, the plate was rinsed with sterile water to obtain a suspension and placed in a 4°C refrigerator for later use; (2) inoculating the suspension into the seed culture medium at a ratio of 2%, and conducting closed anaerobic culture for 2 days; (3) After the seed culture medium is cultured, the seed culture medium is inoculated at a ratio of 2% to 6% and cultured in a closed anaerobically manner for 5 days; (4) After the culture is completed in the enzyme production medium, the cellulase activity is measured.

6. The method for determining the activity of endocellulose of cellulose-degrading bacteria according to claim 5, characterized in that: Follow these steps: (1) After the culturing of the enzyme production medium, the obtained bacterial liquid was centrifuged at 6000 r / min for 15 min to obtain a crude enzyme liquid; (2) Add 0.25 ml of the crude enzyme solution into 0.75 ml of sodium citrate buffer solution with a concentration of 10 g / L sodium carboxymethyl cellulose, and divide it into a control tube and a test tube. At the same time, add 0.75 ml of 3,5-dinitrosalicylic acid reagent to the control tube, and do not add any reagent to the test tube. Place it in a 50°C water bath for 30 min; (3) After the water bath is completed, add 0.75 ml of 3,5-dinitrosalicylic acid reagent to the test tube immediately, then place the control tube and the test tube in a boiling water bath for 5 min, then take them out and cool them down, adjust the blank tube to zero at a wavelength of 540 nm, and record the absorbance of the test tube; (4) preparing a glucose standard solution, and processing according to steps (2) and (3) to establish a standard curve of the glucose standard solution; (5) The absorbance obtained in step (3) is substituted into the glucose standard curve to calculate the glucose content in the crude enzyme solution, and the endocellulose enzyme activity of the crude enzyme solution is calculated according to the following formula:

7. The method for determining the activity of endocellulose of cellulose-degrading bacteria according to claim 6, characterized in that: The sodium citrate buffer solution of step (2) is prepared by dissolving 9.6 g of citric acid in 900 ml of distilled water, adjusting the pH value to 4 with sodium hydroxide, and then fixing the volume to 1 L.

8. The method for determining the activity of endocellulose of cellulose-degrading bacteria according to claim 5, characterized in that: The preparation method of the 3,5-dinitrosalicylic acid reagent in step (2) is as follows: 5.3 g / L of 3,5-dinitrosalicylic acid and 9.9 g / L of sodium hydroxide are heated and dissolved with 708 ml of deionized water; then 153 g / L of potassium sodium tartrate, 3.8 ml / L of melted phenol and 4.15 g / L of sodium metabisulfite are added to fully dissolve, and the mixture is made up with deionized water.

9. The method for determining the activity of endocellulose of cellulose-degrading bacteria according to claim 5, characterized in that: The concentration of the glucose standard solution in step (4) is 1 mg / mL.

Images